Role of biotechnology in development biotic stress tolerance in crops

1. ASSIGNMENT on BT622
Topic – Role of Biotechnology in development
of biotic stress tolerance in crops
Presented by
Prabhat Kumar Singh
Ph.D. I year
Ag-Biotechnology
ACHARYA NARENDRA DEVA UNIVERSITY OF
AGRICULTURE AND TECHNOLOGY AYODHYA
Presented to –Dr. Shambhoo Prasad
Designation -Associate prof.
(Dept of PMB and GE)

2. Biotic stresses
in plants
Weeds
Insects
Fungi
Bacteria
Virus

3. Genetic engineering for Herbicide resistance
First Major achievement from genetic
engineering in plants.
Glyphosate ,Glufosinate, Sulfonylureas etc.
have been successfully ,Commercially
cultivated in USA and other countries.
Glyphosate

5. Details
Glyphosate, a weed killer, was introduced in the market by Monsanto Company
during 1970s.
 It is a leading broad spectrum, non-selective, systemic herbicide for the control of
annual and perennial weeds before the emergence of any agronomic crops.
 It is also used in non-crop and plantation crops. It is marketed under the trade
name Roundup.
 Glyphosate is used against the annual broadleaf weeds and grasses that compete
with the crops.
 When applied, it is absorbed through foliage and minimally through roots which
means it is only effective on active growing plants and cannot prevent seeds from
germinating. Recommended dose of application rates of glyphosate do not exceed
5.8 kg a.i. ha-1.(Active ingredients).

6. Mode of Action.
Glyphosate has often been termed as a “once-in-a-century herbicide”
because of its tremendous impact on weed management and the crop
production industry.
Glyphosate blocks the synthesis of essential amino acids through binding
and subsequent inactivation of an enzyme (EPSPS) that is critical in the
shikimate pathway .
By disrupting the synthesis of such defense compounds in plants, glyphosate
predisposes the crops to attack by soil-borne pathogens. Hence, it could be
argued that continuous crop exposure to glyphosate may increase plant
susceptibility to diseases .

7. CP4 EPSPS: The gene conferring resistance to the herbicide
Roundup
 The gene was found in Agrobacterium tumefaciens and
transferred to various plants
 Coincidentally, this organism is also used for creating
transgenic plants
TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG
ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA
CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG
CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC
CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
TTTATGCAAAAGTTTTGTTCCTTTAGGATTTCAGCATCAGTGGCTACAGCCTGCATGCTTCACGGTGCAAGCAGCCGGCCCGCAACCGCCCG
CAAATCCTCTGGCCTTTCCGGAACCGTCCGCATTCCCGGCGACAAGTCGATCTCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTG
AAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGCAAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAA
GGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCCTGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGC
CGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCGACAGCACCTTCATCGGCGACGCCTCGCTCACAAAGCGCCCGATGGGCCGCGTGT
TGAACCCGCTGCGCGAAATGGGCGTGCAGGTGAAATCGGAAGACGGTGACCGTCTTCCCGTTACCTTGCGCGGGCCGAAGACGCCGACGC
CGATCACCTACCGCGTGCCGATGGCCTCCGCACAGGTGAAGTCCGCCGTGCTGCTCGCCGGCCTCAACACGCCCGGCATCACGACGGTCAT
CGAGCCGATCATGACGTGCGATCATACGGAAAAGATGCTGCAGGGCTTTGGCGCCAACCTTACCGTCGAGACGGATGCGGACGGCGTGC
GCACCATCCGCCTGGAAGGCCGCGGCAAGCTCACCGGCCAAGTCATCGACGTGCCGGGCGACCCGTCCTCGACGGCCTTCCCGCTGGTTG
CGGCCCTGCTTGTTCCGGGCTCCGACGTCACCATCCTCAACGTGCTGATGAACCCCACCCGCACCGGCCTCATCCTGACGCTGCAGGAAATG
GGCGCCGACATCGAAGTCATCAACCTGCGCCTTGCCGGCGGCGAAGACGTGGCGGACCTGCGCGTTCGCTCCTCCACGCTGAAGGGCGTC
ACGGTGCCGGAAGACCGCGCGCCTCCGATGATCGACGAATATCCGATTCTCGCTGTCGCCGCCGCCTTCGCGGAAGGGGCGACCGTGATG
AACGGTCTGGAAGAACTCCGCGTCAAGGAAAGCGACCGCCTCTCGGCCGTCGCCAATGGCCTCAAGCTCAATGGCGTGGATTGCGATGAG
GGCGAGACGTCGCTCGTCGTGCGTGGCCGCCCTGACGGCAAGGGGCTCGGCAACGCCTCGGGCGCCGCCGTCGCCACCCATCTCGATCAC
CGCATCGCCATGAGCTTCCTCGTCATGGGCCTCGTGTCGGAAAACCCTGTCACGGTGGACGATGCCACGATGATCGCCACGAGCTTCCCGG
AGTTCATGGACCTGATGGCCGGGCTGGGCGCGAAGATCGAACTCTCCGATACGAAGGCTGCCTGATGAGCTCGAATTCGAGCTCGGTACC
GGATCCAATTCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT
GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACAT
TTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGGGATCGATC
CCCCACCGGTCCTTCATGTTCGGCGGTCTCGCGAGCGGTGAAACGCGCATCACCGGCCTTCTGGAAGGCGAGGACGTCATCAATACGGGC
AAGGCCATGCAGGCCATGGGCGCCAGGATCCGTAAGGAAGGCGACACCTGGATCATCGATGGCGTCGGCAATGGCGGCCTCCTGGCGCC
TGAGGCGCCGCTCGATTTCGGCAATGCCGCCACGGGCTGCCGCCTGACCATGGGCCTCGTCGGGGTCTACGATTTCAAGCGCATCATGCTG
GGAA

9. Glyphosate Herbicide
Glyphosate inhibits EPSPS enzyme - impeding the synthesis of
aromatic amino acids
Glyphosate
Proteins
CO2
H2O
NH3
aromatic
amino acids

10. Strategies for Glyphosate resistance crops
Overproduction of EPSPS enzyme
Encode an EPSPS enzyme that is tolerant to glyphosate
Produce an enzyme that inactivates glyphosate
Use a combination of 2 and 3

11. Advantages
 When applied appropriately, it can promote useful effects. In sugarcane,
for example, glyphosate application increases sucrose concentration
before harvest.
Use of glyphosate based herbicides reduces the need for conventional
tilling thereby reducing carbon dioxide emissions.
 Pure glyphosate is low in toxicity to fish and other wildlife, and it binds
tightly to soil so is unlikely to contaminate groundwater.
Use of glyphosate based herbicides reduces the need for labor-intensive
weed control, reduce pest pressure and improve crop quality and yield.

12.  Glyphosate based herbicides have a shorter active life span and safer chemistry
than many other herbicides, when used as per product label.
Disadvantages
Transgenic food product may allergy to human
Affect the soil flora
Developing super weeds
Affect natural Germplasm

13. Genetic engineering
for insect resistance

14. Approaches
Incorporating delta endotoxin sequence
from Bacillus thuringiensis
Incorporating plant derived genes like
lectins , Proteinase inhibitors etc.

15. Bacillus thuringinesis
Bacillus thuringiensis (or Bt) is a gram-positive, soil-dwelling bacterium, the
most commonly used biological pesticide worldwide.
B. thuringiensis also occurs naturally in the gut of caterpillars of various types
of moths and butterflies, as well on leaf surfaces, aquatic environments, animal
feces, insect-rich environments, and flour mills and grain-storage facilities.
During sporulation many Bt strains produce crystal proteins
(proteinaceous inclusions), called delta endotoxins that
have insecticidal action.
This has led to their use as insecticides, and more recently
to genetically modified crops using Bt genes, such as Bt corn. Many
crystal-producing Bt strains though, do not have insecticidal properties.

16. The crystal
The crystal, referred to as Cry toxin (cry from crystal), insecticidal crystal protein,
parasporal body, crystalline inclusion, or delta endotoxin, is a protein formed
during sporulation in Bt strains and aggregate to form crystals.
 Such Cry toxins are toxic to specific species of insects belonging to
Lepidoptera, Coleoptera, Hymenoptera, Diptera, and Nematoda.
They are harmless to human, vertebrates, and natural enemies of insects
In addition to the Cry toxins, some strains of Bt, like Bt israelensis, produce
another toxic crystal, named cytolytic protein or Cyt toxin.

17. The cry protein has three
domains: an alpha helical N
terminal domain, domain I;
a Greek key beta sheet
domain II;
and a "jelly roll" antiparallel
b-sandwich domain III.
The core of the protein is
the most highly conserved,
with Helix 5 of Domain I and
the areas of contact between
the domains being the most
highly conserved.
Structure of Cry Protein

18. Bt cotton is one of the first crop
protection products from
biotechnology.
 Bt cotton is a genetically
modified organism (GMO) or
genetically modified pest resistant
plant, which produces an
insecticide to combat bollworm.
 Bt cotton is a insect resistant
transgenic crop designed to fight
the bollworm.
 Bt cotton is one of the first crop
protection products from
biotechnology.
 Bt cotton is a genetically modified
organism (GMO) or genetically
modified pest resistant plant, which
produces an insecticide to combat
bollworm.
 Bt cotton is a insect resistant
transgenic crop designed to fight the
bollworm.
Bt-Cotton

19.  Monsanto scientists inserted a toxin gene from the bacterium
Bacillus thuringiensis into cotton plants to create a caterpillar-
resistant variety.
 In 2002, A joint venture between Monsanto and Mahyco introduced
Bt cotton in India.
Who invented Bt COTTON
Bt—What is It?
Bollworm larva feeding in boll

20. Mode of Action
Bt spores have to be ingested by the susceptible insect to cause mortality. The
Cry toxin becomes active by proteoletic enzymes in the alkaline gut juice (pH 7.5-
8.5).
Most cry toxins are actually pro-toxins of about 130 to 140 kDa, and after
activation, they become 60–70 kDa.
The activated toxin passes through the peritrophic membrane and binds to
specific receptors on apical microvillar brush border membrane of the epithelial
cells of the midgut making pores through which the toxin penetrates to such cells
that become swollen.
 The swelling continues until the cells lyse and separate from the basement
membrane of the midgut epithelium.

21. The alkaline gut juices then leak into the hemocoel causing the hemolymph pH
rises that leads to paralysis and death of the insect.
 However, it is mentioned that the naturally occurring bacteria in the
gut (E.coli and Enterobacter) penetrate to the hemocoel through the disrupted
epithelium caused by Bt toxins and multiply causing sepsis of the hemolymph
and death of the insect.
 In the Bt-moderately sensitive insects, such as Spodoptera spp., the
endospore has a considerable role in killing the insect by producing toxins during
its vegetative growth in the hemolymph.
 The insect or any living organism that does not have the receptors in gut
epithelial cells is not killed by Bt .

22. Flowchart

24. List of
different
genes
against
different
insect
class ;
Reference;
Plant
biotechnol
ogy book
by Andrian
Slator
et.al.,2019

25. Major Benefits of Bt Crops
Able to withstand pest attacks.
Minimal insecticide and fertilizer required, lowering production
costs.
Increased productivity in smaller land patches.
Profitable for marginal farmers (Less than 1 ha land).
Drawbacks of Bt Crops
Seeds more expensive than conventional/common variants.
Pests may grow immune to the GM seeds.
Natural gene flow between crops is fatally sidelined.
Ethical issues.

26. Some other Bt crops examples
Bt Brinjal
Bt brinjal is also produced by genetic transformation of a
crystal protein gene cry 1 Ac from the bacterium Bacillus
thuringiensis.
Bt brinjal was developed to provide resistance against
lepidopteron insects.
 The proteins produced by Bt genes bind to the receptors
present on the insect’s membrane, resulting in the formation of
pores on the membranes.
 This disrupts the digestive process and leads to the death of
the insect.

27. List of crops

28. Incorporating plant derived
genes like lectins , Proteinase
inhibitors etc.

29. Interfere with the digestive enzymes of the insect
Results in the nutrient deprivation causing death of the insects
According to their specificity, proteinase inhibitors (PIs) can be divided in four
classes
Serine Protease inhibitor
Cysteine protease inhibitors
Aspartic and metallo-protease inhibitors.
Bifunctional alpha-Amylase inhibitors.
Serine and cysteine-proteinase inhibitors inhibits mainly lepidopteran and
coleopteran.
Protease inhibitor

30. Most active inhibitor identified is cowpea trypsin inhibitor (Cp TI)
Transferred into at least ten other plant species.
Protein is an effective antimetabolite against a range of field and storage
pest.
 CpTI-transformed tobacco, field-tested and cause significant larval mortality
of cotton bollworm.
Serine proteinase inhibitors resulted in up to 100% mortality of first-instar
cotton leaf worms when expressed in tobacco.
Protease inhibitors, therefore, form complexes with these protease enzymes
and then inhibit their proteolytic activity, in addition to protecting certain cellular
constituents, tissues and fluids

31. These recombinant inhibitors mostly act by either tightly binding
to the active site of the protease enzyme as pseudo-substrates
or would use trapping, which is a rapid conformational change
that traps the cognate protease in a covalent complex fashion

32. CASE STUDY 1
Cowpea trypsin inhibitor. The first stage in the development of cowpea
trypsin inhibitor (CpTI) as an anti-insect, pest-Control|ed mechanism came from the
identification of strains of cowpea growing in Africa that were resistant to attack
from a range of insect pests.
The isolated insecticidal protein was found against Lepidoptera, Orthoptera, and
Coleoptera.
 Further tests showed that this protease isolated and inserted into transformation
vector pROK2 (a pBIN19 derivative) (Figure )
There are different ways of quantifying the extent of resistance of a plant to insect damage, either in
terms of measuring the amount of damage (loss of weight or leaf area), or assaying the effect of
eating the transgenic plant on the insect.
 Both types of bioassay were used to show that lepidopteran pests tobacco budworm, cotton
bollworm, and cotton leaf worm) fed on the CpTI transgenic tobacco plants did less damage and grew
less well than those on control plants (Figure )

33. Bioassay data for feeding trials of lepidopteran pests on CpTI transgenic tobacco plants.
The activity of three different lepidopteran pest larvae (Heliothis virescens, Helicoverpa
zea and Spodoptera littoralis) on transgenic tobacco plants carrying the CpTi gene was
assayed in the laboratory in two different ways:
(a) The extent of damage to the tobacco leaves was determined by measuring the leaf
area eaten;
(b) The growth of the larvae on the tobacco was determined by measuring insect
biomass. In both assays, there was a significant protective effect from the CpTi
transgene compared with control plants. (Redrawn with permission from Gatehouse et
al. (1992)

34. Alpha-Amylase inhibitors
 Insect larvae secrete a gut enzyme alpha- amylase to digest starch.
Blocking the activity of this enzyme by a-amylase inhibitor, the larvae can be
starved and killed.
a-Amylase inhibitor gene isolated from bean has been successfully transferred
and expressed in tobacco
 Provides resistance against Coleoptera.
Seven types of natural proteinaceous α-amylase inhibitors have been
identified, six of which are extracted from plants, namely the knottin-like
type, the γ-thionin-like type, the cereal type, the Kunitz type, the thaumatin-like
type, and the lectin-like type.
The knottin-like type, the Kunitz type and the thaumatin-like type are able to
affect only the amylase in insects.

35. Lectins
Lectins are carbohydrate-binding proteins found in many plant tissues
 Abundant in the seeds and storage tissues of some plant species
 Involves specific binding of lectin to glycoconjugates located in the midgut of
the insect
 Tobacco plants expressing a pea lectin were shown to be toxic to the
Lepidoptera Heliothis virescens.
Plant lectins are particularly effective against the sap sucking Hemiptera (Powell
et al., 1995). Therefore, enhancing their presence in some plant tissues may have
an insect tolerant effect.
 Transgenic rice with Galanthus nivalis (snow drop) agglutinin (GNA) has shown
resistance to brown plant hopper (BPH) (Nilaparvata lugens).

36. Virus Resistance
Coat Protein Gene
c DNA of Satellite RNA
Antisense RNA Approach
Ribozyme Mediated Approach

37. Coat Protein Gene
Transgenic plants having virus coat protein gene linked to strong
promoter.
Tobacco, tomato, alfalfa, sugarbeet, potato etc.
 First plant: 1986: tobacco, coat protein from TMV strain U1
 Expression of virus coat protein gene: confers resistance to
concerned virus and gives a measure of resistance to other related
virus.
 Effectiveness of coat protein: affected by amount of coat protein
produced in transgenic plants and by concentration of virus inoculum.

38. Resistance is due to blocking of process of uncoating of virus particles, which
is necessary for viral genome replication as well as expression.
GM released for commercial cultivation using CPMR
• Tomato resistant to TMV
• Tomato mosaic virus (ToMV) and cucumber mosaic virus (CMV)
• Cucumber resistant to CMV ,Squash resistant to zucchini yellow mosaic virus
(ZYMV) & watermelon mosaic virus (WMV2).

39. Produced by inverting
cDNA copy of mRNA
with respect to
promoter in an
expression vector
Antisense RNA approach
• Yields full-length
complementary copy of m
RNA sequence
• Interact with mRNA
molecules by base-pairing
to form double stranded
RNA
• Tobacco: CMV
.Potato Quality
improvement
Antisense Approach

40. Ribozyme Mediated Approach
 RNA molecules that exhibit enzyme activities.
 Hybrid RNA consisting of tobacco ring spot virus (TobRV) satellite RNA
endoribonuclease catalytic sequences linked to antisense RNA specific of
specific genes against they are targeted.
Strategy consists of:
Producing ribozyme specific to part of target virus genome
To produce cDNA of this ribozyme
 To integrate it into host plant genome

41. Construction of expression vectors for potato transformation containing ribozyme
genes under the control of 35S promotor. R(−)D, mR(−)D, and R(+)D, tandem R(−),
mR(−), and R(+) ribozymes, respectively; nos-p, nos promotor; nos-t, nos
terminator; NPTII, neomycin phosphotransferase II; RB, right border; LB, left border.

42. References
Xicai Yang, Yin Yie, Feng Zhu, Yule Liu, Liangyi Kang, Xiaofeng Wang,
and Po Tien (1997); Ribozyme-mediated high resistance against potato
spindle tuber viroid in transgenic potatoes, jour. Proc Natl Acad Sci U S
A. 94(10): 4861–4865.doi: 10.1073/pnas.94.10.4861.
Andrian Slator, Nigel W. Scott and Mark R Fowler (2019); Plant
biotechnology the genetic manipulation of plants . Jr.Oxford, 2nd edition
pp123-285.