SlideShare una empresa de Scribd logo
1 de 29
Descargar para leer sin conexión
Sample to Insight
QIAGEN Locked Nucleic Acid (LNA®) Tools
Experience truly exceptional RNA research
The Power of LNA & QIAGEN‘s LNA Enhanced Portfolio
Sample to Insight
Content
2Successfully Detect miRNAs Using qPCR with LNA Technology
The power of LNA
LNA enhanced portfolio
1
2
Sample to Insight
LNA (Locked nucleic acids) are a class of high affinity
RNA analogs with the ribose ring locked in the ideal
conformation for Watson-Crick binding
• LNA increase the strength of base pairing
• LNA increase the binding affinity compared to
conventional DNA and RNA oligos
3
LNA® - making oligos with unprecedented characteristics
• Increased Tm (2 - 8ºC per base)
• Improved mismatch discrimination
• High sensitivity and specificity in probes and assays
• Increased oligo stability and potency in cells
The power of LNA
Sample to Insight
QIAGEN the new home for Locked Nucleic Acid
4
Taking advantage of LNA requires sufficient experience:
o Knowledge of optimal LNA positioning in the oligo
o Understanding of RNA
o Understanding of the application and its purpose
EXIQON (a QIAGEN company) optimized application designs over many years
• Patented designs
• Sophisticated design algorithms behind every LNA-enhanced product
• 30-60 parameters in play when designing LNA oligo-based products:
• Tm, length, secondary structure/accessibility, mis-match discrimination/off-target binding,
binding specificity, self-complementarity, LNA -positioning
• Online design tools for custom products – now at QIAGEN
20 years
experience in
designing LNA
oligos
“Exiqon reagents stand out in front of
other platforms from a technological
standpoint”.
Dr Parker Antin, University of Arizona
Sample to Insight
LNA is used to adjust the Tm of oligonucleotides
5
Tm adjustments enables:
• Increased affinity towards DNA and RNA targets
• Increased specificity (shorter sequences)
• Increased flexibility in oligo design
• Sequence independence (GC content less important)
Same length, higher Tm Shorter length, similar Tm
Sample to Insight
LNA enables detection of all microRNAs - even the AT-rich
6
LNA ™
DNA
98% of these
microRNAs
have under
50% GC
66% of these
microRNAs
have under 50% GC
30% of these microRNAs
have under 50% GC
Increasing GC content
Sample to Insight
LNA enables oligo Tm normalization
7
IncreasingGCcontent
Power of Tm-normalization:
• Overall narrower Tm interval (red)
• Highly increased Tm of AT-rich assays
• Shift to higher median Tm (x-axis)
• Higher stringency and potency
Benefits of LNA & Tm-normalization
• Higher sensitivity and specificity
• Ability to address targets of low Tm e.g.
miRNA low in GC content
• Inhibitors: higher potency of all
inhibitors
• Detection probes: Uniform hybridization
of all miRNA at the same Thyb for ISH
(enables automation)
• qPCR: uniform amplification of all miRNA
targets
Sample to Insight
LNA enhances the discriminatory power of oligonucleotides
8
LNA enhances specificity of oligonucleotides for complementary RNA and DNA
targets
40% Form.
LNA DNA
THJ200
²rip 42 C 20‘
KD200
THJ202
THJ201
LNA DNA
50% Form.
B
40% Form.
LNA DNA
THJ200
²r
KD200
THJ202
THJ201
LNA
50% Form
B
mRNA SSA4 in situ hybridization,
fixed yeast cells.
Thomsen et al., 2005, RNA
Target
Probe
Perfect match
DNA
Single mismatch
3’ccaggaaggaaccac-5’
∆Tm
DNA 15mer
5’ggtccttacttggtg3’ Tm = 59.4°C Tm = 55.7°C 3.7°C
DNA/LNA 15mer
5’ggtccttActtggtg3’ Tm = 60.9°C Tm= 52.7°C 8.2°C
Sample to Insight
LNA
DNA
RNA
OME
LNA ™ vs. competing technology
ISH using DIG-labeled probes (miR-122)
Discriminating miR-1 in heart of chicken embryo
Pictures kindly provided by D. Sweetman, University of East Anglia, Norwich, UK
Unique sensitivity Unique specificity
gga-miR-1a UGGAAUGUAAGGAAGUGUGUGG
gga-miR-206 UGGAAUGUAAAGAAGUAUGU
LNA enables RNA detection – the ONLY technology which works!
“Basically no other technology has been demonstrated to work for microRNA detection
in situ.”
Dr. Dylan Sweetman, University of East Anglia
Sample to Insight
Exceptional specificity – single–nucleotide mismatch discrimination
10
The signal obtained from perfectly matched LNA
oligos (100%) is compared to signal from LNA
oligos with a single nucleotide mismatch.
Perfect match
Single nucleotide mismatch
Sample to Insight
Effective RNA silencing - with the robustness and stability for in vivo
11
Sample to Insight
Content
12
The power of LNA
LNA enhanced portfolio
1
2
Sample to Insight
A solution for every step of your RNA workflow
13
NGS PCR
Data
analysis
&
Interpret
ation
Function
al
analysis
Instruments
• QIAcube/QIAcube HT
• QIAsymphony® SP/AS
• QIAxcel Advanced
• QIAxpert (for QC)
• QIAxpert
• QIAxcel Advanced
• QIAgility
• Rotor-Gene® Q
• QIAsymphony SP/AS
Kits and Reagents
• RNeasy Plus Kits
• RNeasy Kits for all
sample types
• exoRNeasy Kits for
exosomal RNA
• PAXgene Blood/Tissue
RNA Systems for
stabilization and
purification
• Custom LNA®
Detection Probes for
mRNA and lncRNA
• QIAseq® UPX 3'
Transcriptome Kits
• QIAseq UPX 3' Targeted
RNA Panel
• QIAseq Stranded RNA
Library Kits
• QIAseq Targeted RNA
Panels
• QIAseq Targeted RNAscan
Panels
• QIAseq FX Single Cell RNA
Library Kit
• QIAseq Immune Repertoire
RNA Library Kits
• RT2 Profiler PCR Arrays
Predesigned assays and
pathway panels for
mRNA and lncRNA
• QuantiNova qPCR Kits
Combined with self-
designed primers or
QuantiTect® Primer
Assays
• Ingenuity® Pathway
Analysis (IPA®)
• CLC Genomics
Workbench
• Biomedical Genomics
Workbench
• GeneGlobe® Data
Analysis Center
• Antisense LNA
GapmeRs
For mRNA and lncRNA
silencing in vitro and in
vivo
• miRNeasy Kits for all
sample types
• PAXgene Blood/Tissue
miRNA Systems for
stabilization and
purification
• miRCURY LNA miRNA
Detection Probes
• QIAseq miRNA Library Kit
• QIAseq miRNA Library QC
PCR Panel and Assays
• miRCURY LNA miRNA
PCR System
Predesigned or custom
PCR assays and panels
• miRCURY LNA miRNA
Mimics, Inhibitors and
Target Site Blockers
For function analysis in
vitro and in vivo
QIAGEN Genomic Services: Sample preparation, NGS analysis, qPCR analysis, Data analysis and biological
interpretation
RNA
preparation
Localization
ISH
Northern
mRNAlncRNAmiRNA
Sample to Insight
A solution for every step of your RNA workflow – LNA enhanced
14
NGS PCR
Data
analysis
&
Interpret
ation
Function
al
analysis
Instruments
• QIAcube/QIAcube HT
• QIAsymphony® SP/AS
• QIAxcel Advanced
• QIAxpert (for QC)
• QIAxpert
• QIAxcel Advanced
• QIAgility
• Rotor-Gene® Q
• QIAsymphony SP/AS
Kits and Reagents
• RNeasy Plus Kits
• RNeasy Kits for all
sample types
• exoRNeasy Kits for
exosomal RNA
• PAXgene Blood/Tissue
RNA Systems for
stabilization and
purification
• Custom LNA®
Detection Probes for
mRNA and lncRNA
• QIAseq® UPX 3'
Transcriptome Kits
• QIAseq UPX 3' Targeted
RNA Panel
• QIAseq Stranded RNA
Library Kits
• QIAseq Targeted RNA
Panels
• QIAseq Targeted RNAscan
Panels
• QIAseq FX Single Cell RNA
Library Kit
• QIAseq Immune Repertoire
RNA Library Kits
• RT2 Profiler PCR Arrays
Predesigned assays and
pathway panels for
mRNA and lncRNA
• QuantiNova qPCR Kits
Combined with self-
designed primers or
QuantiTect® Primer
Assays
• Ingenuity® Pathway
Analysis (IPA®)
• CLC Genomics
Workbench
• Biomedical Genomics
Workbench
• GeneGlobe® Data
Analysis Center
• Antisense LNA
GapmeRs
For mRNA and lncRNA
silencing in vitro and in
vivo
• miRNeasy Kits for all
sample types
• PAXgene Blood/Tissue
miRNA Systems for
stabilization and
purification
• miRCURY LNA miRNA
Detection Probes
• QIAseq miRNA Library Kit
• QIAseq miRNA Library QC
PCR Panel and Assays
• miRCURY LNA miRNA
PCR System
Predesigned or custom
PCR assays and panels
• miRCURY LNA miRNA
Mimics, Inhibitors and
Target Site Blockers
For function analysis in
vitro and in vivo
QIAGEN Genomic Services: Sample preparation, NGS analysis, qPCR analysis, Data analysis and biological
interpretation
RNA
preparation
Localization
ISH
Northern
mRNAlncRNAmiRNA
Sample to Insight
QIAseq® miRNA Library Kits
The QIAseq miRNA Library Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease 15
miRNA / piRNA sequencing, gel-free & LNA-enhanced
• Utilizes Unique Molecular Indices (UMI) technology
• No more gels – gel-free, bead-based workflow starting
with only 1 ng RNA
• For miRNA, piRNA and small RNA expression analysis
and novel small RNA discovery
• Data analysis included through cloud-based GeneGlobe
Data Analysis Site
QIAseq miRNA Library Kit (96), Cat. no. 331505
QIAseq miRNA Library Kit (12), Cat. no. 331502
QIAseq miRNA NGS 12 Index IL (12), Cat. no. 331592
QIAseq miRNA NGS 48 Index IL (96), Cat. no. 331595
Sample to Insight
QIAseq miRNA Library QC PCR Panel and Assays
16
For evaluating RNA sample quality and for assessing
NGS performance post-sequencing
• Unique qPCR-based sample QC of miRNA/small RNA
samples prior to NGS
• Essential for challenging samples with low RNA content,
such as biofluids
• LNA miRNA PCR Assays in ready-to-use PCR panels
• Compatible with all major qPCR instruments
• Comprehensive set of 52 RNA spike-ins, spanning a wide
range of concentrations
• Thorough post-sequencing assessment of NGS linearity
and reproducibility
QIAseq miRNA Library QC PCR Array Kit, Product no. 331541
QIAseq miRNA Library QC PCR Assay, Product no. 331551
QIAseq miRNA Library QC Spike-ins, Product no. 331535
The QIAseq UPX Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
Sample to Insight
QIAseq UPX 3' Transcriptome Kit
17
High-throughput 3’-transcriptome NGS from ultralow
amounts of RNA
• Sample input from 1 to 100 cells or 10 pg to 1 ng isolated
RNA
• LNA -enhanced chemistry for increased accuracy,
specificity and sensitivity
• Integrated unique molecular indexing (UMI) removes
amplification bias
• Cell tagging and sample indexing enables simultaneous
sequencing of up to 18,432 transcriptomes
• Data analysis with the GeneGlobe Data Analysis Center
QIAseq UPX 3' Transcriptome Kit (96), Cat.no. 333088
QIAseq UPX 3' Transcriptome Kit (384), Cat.no. 333090
QIAseq UPX 3' Trans. 12-Index (48), Cat.no. 333074
QIAseq UPX 3' Trans. 48-Index (192), Cat.no. 333075
The QIAseq UPX Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
Sample to Insight
QIAseq UPX 3' Targeted RNA Panel
18
High-throughput, targeted gene expression using
3’-targeted NGS
• Target up to 1000 genes using a cost-effective, time-
saving single-tube library prep
• LNA-enhanced chemistry for increased accuracy,
specificity and sensitivity
• Integrated unique molecular indexing (UMI) removes
amplification bias
• Cell tagging and sample indexing enables simultaneous
sequencing of up to 147,456 targeted libraries
• Cloud-based data analysis with the GeneGlobe Data
Analysis Center
QIAseq UPX 3' Targeted RNA Panel (96), Cat.no. 333041
QIAseq UPX 3' Targeted RNA Panel (384), Cat.no. 333043
QIAseq UPX 3' Targeted RNA 12 index (48), Cat.no. 333044
QIAseq UPX 3' Targeted 96 index A (384), Cat.no. 333051
QIAseq UPX 3' Targeted 96 index B (384), Cat.no. 333052
QIAseq UPX 3' Targeted 96 index C (384), Cat.no. 333053
QIAseq UPX 3' Targeted 96 index D (384), Cat.no. 333054
The QIAseq UPX Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
Sample to Insight
miRCURY LNA miRNA PCR System
19
Unique miRNA qPCR system of universal RT combined with two miRNA-specific qPCR primers
Accurate and reliable quantification
• Accurate and reliable quantification of individual
miRNAs from as little as 1pg total RNA
Distinguish between miRNA sequences
• Distinguish between miRNA sequences that differ by a
single nucleotide
Thoroughly validated
• LNA-enhanced and Tm normalized primers,
Easy & Quick protocol
• 3-hour, easy-to-follow protocol that minimizes pipetting
Various control options
• Controls available for RNA isolation, RT and PCR
efficiency control
Data analysis
• GeneGlobe Data Analysis Center
One cDNA reaction for all miRNAs
Two LNA®-enhanced miRNA-
specific qPCR primers
The miRCURY LNA® miRNA PCR System is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a
disease
Sample to Insight
miRCURY LNA miRNA PCR System
20Successfully Detect miRNAs Using qPCR with LNA Technology
Universal cDNA
synthesis
3 hour workflow
Individual or custom
Assays and
Ready-to-use panels
+
high performance miRNA
SYBR Green PCR Kit
Easy and free of
charge data
analysis
miRNA
isolation
cDNA
synthesis
PCR
Data
analysis
miRCURY LNA RT Kit miRCURY LNA miRNA PCR Assays
miRCURY LNA miRNA Custom PCR Assays
miRCURY LNA miRNA miRNome Panels
miRCURY LNA miRNA Focus Panels
miRCURY LNA miRNA QC Panels
miRCURY LNA SYBR Green PCR Kit
GeneGlobe Data Analysis
Center
Easy start with miRCURY LNA miRNA PCR Starter Kit + Optional RNA Spike-in Kit
for QC
Sample to Insight
Antisense LNA GapmeRs
21
Potent antisense oligonucleotides for highly efficient knockdown of mRNA and lncRNA
• Efficient RNase H dependent degradation of
complementary RNA targets
• Active in vivo and in vitro – enabling the
analysis RNA function in a wide range of
model systems
• Excellent alternative to siRNA for knockdown
of mRNA and lncRNA
• Taken up by cells by transfection or
unassisted delivery
• Designed with a sophisticated and
empirically developed algorithm for potent
and specific knockdown of target RNAs
Sample to Insight
Antisense LNA GapmeRs
22
Potent antisense oligonucleotides for highly efficient knockdown of mRNA and lncRNA
• 15 - 16mer LNA / DNA antisense oligonucleotide
• LNA at extremities enhances affinity for the target
• RNase H activity requires a certain distance (”gap”) between
LNAs
• Phosphorothioate modified backbone
• Online design tool
• Empirically derived design algorithm evaluates thousands of LNA
GapmeRs with more than 30 design parameters
Antisense LNA GapmeRs Standard, Product no. varies
Antisense LNA GapmeRs Custom Plate, Product no. 339530
The Antisense LNA GapmeRs is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
Sample to Insight
miRCURY LNA miRNA Inhibitors
23
Inhibitors for miRNA loss-of-function studies
• Tm-normalized inhibitors with unmatched potency against
any miRNA, regardless of GC content
• Power Inhibitors so potent that they work by unassisted
uptake with no need for transfection reagents
• Superior specificity and biological stability for long-lasting
antisense activity
• Available in 1-, 5- and 15 nmol quantities
• Fluorescent labels for convenient monitoring of
transfection efficiency
miRCURY LNA miRNA Inhibitors, Product no. varies
miRCURY LNA miRNA Power Inhibitors, Product no. varies
Custom miRCURY LNA miRNA Inhibitors, Product no. varies
miRCURY LNA miRNA Family Power Inhibitors, Product no. varies
miRCURY LNA miRNA Inhibitor Libraries, Product no. varies
miRCURY LNA miRNA Inhibitors are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of
a disease
Sample to Insight
miRCURY LNA miRNA Mimics
24
For studies on miRNA function and gene regulation using synthetic miRNA
• Highly potent, mature miRNA mimics with
unique triple RNA strand design
• No miRNA-star activity from bisected LNA
-enhanced passenger strand
• miRNA strand sequence matches
miRBase annotation
• Available with fluorescent label to assess
transfection efficiency
• Available with biotinylated miRNA strand
to isolate targets by RNA pull-down
miRCURY LNA miRNA Mimic (5 nmol) / (20 nmol),
Product no. 339173 / 339174
miRCURY LNA Premium miRNA Mimic (5 nmol) /
(20 nmol), Product no. 339178 / 339179
miRCURY LNA miRNA Mimics are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a
disease
Sample to Insight
miRCURY LNA miRNA Power Target Site Blockers
25
For studying the effects of an individual miRNA on a single target site
• Custom-designed target site blockers for specific inhibition of
miRNA targets
• Sophisticated design and superior high affinity, regardless of
target sequence
• Unmatched high efficacy in vitro and in vivo
• Unrivaled performance and high protein expression due to
lack of RNase H-dependent mRNA degradation
• Efficient at very low concentrations, outcompeting miRNAs for
their target sites
• Superior biological stability for long-lasting antisense activity
miRCURY LNA miRNA Power Target Site Blockers (5 nmol) / (15 nmol),
Product no. 339194 / 339195
miRCURY LNA miRNA Power Target Site Blockers, in vivo Ready (5 nmol) /
(15 nmol), Product no. 339199 / 339200
TSB
miRCURY LNA miRNA Power Target Site Blockers are intended for molecular biology applications. These products are not intended for the diagnosis,
prevention, or treatment of a disease
Sample to Insight
miRCURY LNA miRNA Detection Probes
26
For ultra-sensitive & specific miRNA detection by in situ hybridization (ISH) or Northern blotting
• Superior sensitivity and specificity for detecting low-abundance
miRNAs
• Predesigned probes available for all miRNA species or
Custom-designed probes for targeting novel miRNA
sequences
• A wide selection of available labels enables multiplexing and
co-localization
• Ideal for standardized protocols for automated, high-
throughput ISH
• Fast and easy workflow using the One-day miRNA ISH
protocol
miRCURY LNA miRNA ISH Buffer Set (FFPE), Product no. 339450
miRCURY LNA miRNA ISH Optimization Kit (FFPE) 1-9, Product no. varies
miRCURY LNA miRNA ISH Buffer and Controls, Product no. 339459
miRCURY LNA miRNA ISH Optimization Kits (FFPE) are intended for molecular biology applications. These products are not intended for the diagnosis,
prevention, or treatment of a disease
Sample to Insight
Custom LNA mRNA Detection Probes
miRCURY LNA miRNA ISH Optimization Kits (FFPE) are intended for molecular biology applications. These products are not intended for the diagnosis,
prevention, or treatment of a disease
27
For ultra-sensitive detection and discrimination by highly similar mRNA and lncRNA
by in situ hybridization and Northern blotting
• Sensitivity and specificity superior to DNA probes and
riboprobes
• Short probes ideal for discriminating highly similar sequences -
e.g. splice variants and isoforms
• Online tools provide optimally designed LNA -enhanced
probes in minutes
• Available with a wide selection of labels
• No cloning expertise required
• Excellent tissue penetration
Sample to Insight
Custom LNA ™ Oligonucleotides
28
For experiments requiring custom-designed, LNA -enhanced oligonucleotides
QIAGEN offers synthesis of custom LNA oligonucleotides with a
wide variety of modifications, labels, synthesis scales, purification
scale options
• Create or improve any RNA or DNA application with LNA –
ONLY with QIAGEN
• Order any LNA -enhanced oligo of interest
• your own design with the LNA spiking pattern of your choice
• Use the online LNA oligo help tools to for Tm prediction and
LNA optimization
• LNA oligos are available in small scale (nmol-µmol) for in vitro
applications and in large scale (mg) for in vivo use in animal
models
Alternatively, have QIAGEN experts in LNA oligo design assist in
designing the most optimal LNA oligo for their application (design
fee applicable)
Custom LNA mRNA Detection Probes are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or
treatment of a disease.
Sample to Insight
Website link
29
For detailed information about LNA products please visit us: www.qiagen.com/LNA

Más contenido relacionado

La actualidad más candente

Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRQIAGEN
 
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...QIAGEN
 
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...Integrated DNA Technologies
 
DNA FIngerprinting.ppt
DNA FIngerprinting.pptDNA FIngerprinting.ppt
DNA FIngerprinting.pptSainathKamble4
 
Q pcr introduction 2013
Q pcr introduction 2013Q pcr introduction 2013
Q pcr introduction 2013Elsa von Licy
 
Process development guidance for AAV and lentivirus manufacturing based on co...
Process development guidance for AAV and lentivirus manufacturing based on co...Process development guidance for AAV and lentivirus manufacturing based on co...
Process development guidance for AAV and lentivirus manufacturing based on co...MilliporeSigma
 
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...QIAGEN
 
qPCR Design Strategies for Specific Applications
qPCR Design Strategies for Specific ApplicationsqPCR Design Strategies for Specific Applications
qPCR Design Strategies for Specific ApplicationsIntegrated DNA Technologies
 
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3QIAGEN
 
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesIntroduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesQIAGEN
 
Biology DNA Analysis
Biology DNA AnalysisBiology DNA Analysis
Biology DNA AnalysiseLearningJa
 
Real Time P C R
Real  Time  P C RReal  Time  P C R
Real Time P C Relmayestro
 
Types of pcr
Types of pcr Types of pcr
Types of pcr Asma Gul
 

La actualidad más candente (20)

Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCR
 
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
 
qRT-PCR.pdf
qRT-PCR.pdfqRT-PCR.pdf
qRT-PCR.pdf
 
Real time PCR practical training
Real time PCR practical training Real time PCR practical training
Real time PCR practical training
 
Real time pcr
Real time pcrReal time pcr
Real time pcr
 
Real Time PCR
Real Time PCRReal Time PCR
Real Time PCR
 
Real Time PCR
Real Time PCRReal Time PCR
Real Time PCR
 
Real Time PCR
Real Time PCRReal Time PCR
Real Time PCR
 
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
SNP genotyping on qPCR platforms: Troubleshooting for amplification and clust...
 
DNA FIngerprinting.ppt
DNA FIngerprinting.pptDNA FIngerprinting.ppt
DNA FIngerprinting.ppt
 
Q pcr introduction 2013
Q pcr introduction 2013Q pcr introduction 2013
Q pcr introduction 2013
 
Process development guidance for AAV and lentivirus manufacturing based on co...
Process development guidance for AAV and lentivirus manufacturing based on co...Process development guidance for AAV and lentivirus manufacturing based on co...
Process development guidance for AAV and lentivirus manufacturing based on co...
 
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...
Introduction to Real Time PCR (Q-PCR/qPCR/qrt-PCR): qPCR Technology Webinar S...
 
qPCR Design Strategies for Specific Applications
qPCR Design Strategies for Specific ApplicationsqPCR Design Strategies for Specific Applications
qPCR Design Strategies for Specific Applications
 
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
 
Polymerase Chain Reaction
Polymerase Chain ReactionPolymerase Chain Reaction
Polymerase Chain Reaction
 
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slidesIntroduction to real-Time Quantitative PCR (qPCR) - Download the slides
Introduction to real-Time Quantitative PCR (qPCR) - Download the slides
 
Biology DNA Analysis
Biology DNA AnalysisBiology DNA Analysis
Biology DNA Analysis
 
Real Time P C R
Real  Time  P C RReal  Time  P C R
Real Time P C R
 
Types of pcr
Types of pcr Types of pcr
Types of pcr
 

Similar a QIAGEN LNA Tools - Experience truly exceptional RNA Research

Take your RNA research to the next level with QIAGEN LNA tools!
Take your RNA research to the next level with QIAGEN LNA tools!Take your RNA research to the next level with QIAGEN LNA tools!
Take your RNA research to the next level with QIAGEN LNA tools!QIAGEN
 
Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideQIAGEN
 
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotypingrhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotypingIntegrated DNA Technologies
 
Practical Hints for Successful PCR
Practical Hints for Successful PCRPractical Hints for Successful PCR
Practical Hints for Successful PCRQIAGEN
 
RNA Sequencing from Single Cell
RNA Sequencing from Single CellRNA Sequencing from Single Cell
RNA Sequencing from Single CellQIAGEN
 
Applications of transcriptomice s in modern biotechnology 2
Applications of transcriptomice s in modern biotechnology 2Applications of transcriptomice s in modern biotechnology 2
Applications of transcriptomice s in modern biotechnology 2Pakeeza Rubab
 
Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2
Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2
Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2QIAGEN
 
Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014LutzFr
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...QIAGEN
 
Enabling RNA-Seq With Limited RNA Using Whole Transcriptome Amplification
Enabling RNA-Seq With Limited RNA Using Whole Transcriptome AmplificationEnabling RNA-Seq With Limited RNA Using Whole Transcriptome Amplification
Enabling RNA-Seq With Limited RNA Using Whole Transcriptome AmplificationQIAGEN
 
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllThe QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllQIAGEN
 
NGS for liquid biopsy research
NGS for liquid biopsy researchNGS for liquid biopsy research
NGS for liquid biopsy researchQIAGEN
 
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1QIAGEN
 
MCNext Sybr qPCR quantification Kit
MCNext Sybr qPCR quantification KitMCNext Sybr qPCR quantification Kit
MCNext Sybr qPCR quantification KitRui Wang
 
Reporter assay and q pcr application 2012
Reporter assay and q pcr application 2012Reporter assay and q pcr application 2012
Reporter assay and q pcr application 2012Elsa von Licy
 
Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...
Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...
Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...QIAGEN
 

Similar a QIAGEN LNA Tools - Experience truly exceptional RNA Research (20)

Pcrarray
PcrarrayPcrarray
Pcrarray
 
Take your RNA research to the next level with QIAGEN LNA tools!
Take your RNA research to the next level with QIAGEN LNA tools!Take your RNA research to the next level with QIAGEN LNA tools!
Take your RNA research to the next level with QIAGEN LNA tools!
 
Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the Guide
 
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotypingrhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
rhAmp™ SNP Genotyping: A novel approach for improving PCR-based SNP genotyping
 
Practical Hints for Successful PCR
Practical Hints for Successful PCRPractical Hints for Successful PCR
Practical Hints for Successful PCR
 
Ffpe pcr array
Ffpe pcr arrayFfpe pcr array
Ffpe pcr array
 
Pcr array 2013
Pcr array 2013Pcr array 2013
Pcr array 2013
 
RNA Sequencing from Single Cell
RNA Sequencing from Single CellRNA Sequencing from Single Cell
RNA Sequencing from Single Cell
 
Applications of transcriptomice s in modern biotechnology 2
Applications of transcriptomice s in modern biotechnology 2Applications of transcriptomice s in modern biotechnology 2
Applications of transcriptomice s in modern biotechnology 2
 
Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2
Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2
Digital RNAseq for Gene Expression Profiling: Digital RNAseq Webinar Part 2
 
Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
 
Enabling RNA-Seq With Limited RNA Using Whole Transcriptome Amplification
Enabling RNA-Seq With Limited RNA Using Whole Transcriptome AmplificationEnabling RNA-Seq With Limited RNA Using Whole Transcriptome Amplification
Enabling RNA-Seq With Limited RNA Using Whole Transcriptome Amplification
 
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for AllThe QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
The QIAseq NGS Portfolio for Cancer Research: Sample-to-Insight for All
 
NGS for liquid biopsy research
NGS for liquid biopsy researchNGS for liquid biopsy research
NGS for liquid biopsy research
 
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
Digital RNAseq Technology Introduction: Digital RNAseq Webinar Part 1
 
MCNext Sybr qPCR quantification Kit
MCNext Sybr qPCR quantification KitMCNext Sybr qPCR quantification Kit
MCNext Sybr qPCR quantification Kit
 
TYPES_OF_PCR.pptx
TYPES_OF_PCR.pptxTYPES_OF_PCR.pptx
TYPES_OF_PCR.pptx
 
Reporter assay and q pcr application 2012
Reporter assay and q pcr application 2012Reporter assay and q pcr application 2012
Reporter assay and q pcr application 2012
 
Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...
Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...
Targeted RNAseq for Gene Expression Using Unique Molecular Indexes (UMIs): In...
 

Más de QIAGEN

Using methylation patterns to determine origin of biological material and age
Using methylation patterns to determine origin of biological material and ageUsing methylation patterns to determine origin of biological material and age
Using methylation patterns to determine origin of biological material and ageQIAGEN
 
Take lung cancer research to a new molecular dimension
Take lung cancer research to a new molecular dimensionTake lung cancer research to a new molecular dimension
Take lung cancer research to a new molecular dimensionQIAGEN
 
The power of a splice
The power of a spliceThe power of a splice
The power of a spliceQIAGEN
 
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!
An Approach to De-convolution of Mixtures in Touch DNA Samples.   Download now!An Approach to De-convolution of Mixtures in Touch DNA Samples.   Download now!
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!QIAGEN
 
Assessment of Y chromosome degradation level using the Investigator® Quantipl...
Assessment of Y chromosome degradation level using the Investigator® Quantipl...Assessment of Y chromosome degradation level using the Investigator® Quantipl...
Assessment of Y chromosome degradation level using the Investigator® Quantipl...QIAGEN
 
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.QIAGEN
 
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...QIAGEN
 
Cancer Research & the Challenges of FFPE Samples – An Introduction
Cancer Research & the Challenges of FFPE Samples – An IntroductionCancer Research & the Challenges of FFPE Samples – An Introduction
Cancer Research & the Challenges of FFPE Samples – An IntroductionQIAGEN
 
The Microbiome of Research Animals : Implications for Reproducibility, Transl...
The Microbiome of Research Animals : Implications for Reproducibility, Transl...The Microbiome of Research Animals : Implications for Reproducibility, Transl...
The Microbiome of Research Animals : Implications for Reproducibility, Transl...QIAGEN
 
Building a large-scale missing persons ID SNP panel - Download the study
Building a large-scale missing persons ID SNP panel - Download the studyBuilding a large-scale missing persons ID SNP panel - Download the study
Building a large-scale missing persons ID SNP panel - Download the studyQIAGEN
 
Rapid DNA isolation from diverse plant material for use in Next Generation Se...
Rapid DNA isolation from diverse plant material for use in Next Generation Se...Rapid DNA isolation from diverse plant material for use in Next Generation Se...
Rapid DNA isolation from diverse plant material for use in Next Generation Se...QIAGEN
 
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...QIAGEN
 
Practical hints and new solutions for successful real-time PCR studies
Practical hints and new solutions for successful real-time PCR studies Practical hints and new solutions for successful real-time PCR studies
Practical hints and new solutions for successful real-time PCR studies QIAGEN
 
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...QIAGEN
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...QIAGEN
 
Reproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationReproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationQIAGEN
 
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...Automated Nucleic Acid Purification from Diverse Sample types using dedicated...
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...QIAGEN
 
Dna Methylation Analysis in a Single Day - Download the Slides
Dna Methylation Analysis in a Single Day - Download the SlidesDna Methylation Analysis in a Single Day - Download the Slides
Dna Methylation Analysis in a Single Day - Download the SlidesQIAGEN
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleQIAGEN
 
DNA Analysis - Basic Research : A Case Study
DNA Analysis - Basic Research : A Case StudyDNA Analysis - Basic Research : A Case Study
DNA Analysis - Basic Research : A Case StudyQIAGEN
 

Más de QIAGEN (20)

Using methylation patterns to determine origin of biological material and age
Using methylation patterns to determine origin of biological material and ageUsing methylation patterns to determine origin of biological material and age
Using methylation patterns to determine origin of biological material and age
 
Take lung cancer research to a new molecular dimension
Take lung cancer research to a new molecular dimensionTake lung cancer research to a new molecular dimension
Take lung cancer research to a new molecular dimension
 
The power of a splice
The power of a spliceThe power of a splice
The power of a splice
 
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!
An Approach to De-convolution of Mixtures in Touch DNA Samples.   Download now!An Approach to De-convolution of Mixtures in Touch DNA Samples.   Download now!
An Approach to De-convolution of Mixtures in Touch DNA Samples. Download now!
 
Assessment of Y chromosome degradation level using the Investigator® Quantipl...
Assessment of Y chromosome degradation level using the Investigator® Quantipl...Assessment of Y chromosome degradation level using the Investigator® Quantipl...
Assessment of Y chromosome degradation level using the Investigator® Quantipl...
 
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
ICMP MPS SNP Panel for Missing Persons - Michelle Peck et al.
 
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
Exploring the Temperate Leaf Microbiome: From Natural Forests to Controlled E...
 
Cancer Research & the Challenges of FFPE Samples – An Introduction
Cancer Research & the Challenges of FFPE Samples – An IntroductionCancer Research & the Challenges of FFPE Samples – An Introduction
Cancer Research & the Challenges of FFPE Samples – An Introduction
 
The Microbiome of Research Animals : Implications for Reproducibility, Transl...
The Microbiome of Research Animals : Implications for Reproducibility, Transl...The Microbiome of Research Animals : Implications for Reproducibility, Transl...
The Microbiome of Research Animals : Implications for Reproducibility, Transl...
 
Building a large-scale missing persons ID SNP panel - Download the study
Building a large-scale missing persons ID SNP panel - Download the studyBuilding a large-scale missing persons ID SNP panel - Download the study
Building a large-scale missing persons ID SNP panel - Download the study
 
Rapid DNA isolation from diverse plant material for use in Next Generation Se...
Rapid DNA isolation from diverse plant material for use in Next Generation Se...Rapid DNA isolation from diverse plant material for use in Next Generation Se...
Rapid DNA isolation from diverse plant material for use in Next Generation Se...
 
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
Rapid extraction of high yield, high quality DNA from tissue samples - Downlo...
 
Practical hints and new solutions for successful real-time PCR studies
Practical hints and new solutions for successful real-time PCR studies Practical hints and new solutions for successful real-time PCR studies
Practical hints and new solutions for successful real-time PCR studies
 
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
Overcome the challenges of Nucleic acid isolation from PCR inhibitor-rich mic...
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...RotorGene Q  A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
 
Reproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationReproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of Automation
 
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...Automated Nucleic Acid Purification from Diverse Sample types using dedicated...
Automated Nucleic Acid Purification from Diverse Sample types using dedicated...
 
Dna Methylation Analysis in a Single Day - Download the Slides
Dna Methylation Analysis in a Single Day - Download the SlidesDna Methylation Analysis in a Single Day - Download the Slides
Dna Methylation Analysis in a Single Day - Download the Slides
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE Sample
 
DNA Analysis - Basic Research : A Case Study
DNA Analysis - Basic Research : A Case StudyDNA Analysis - Basic Research : A Case Study
DNA Analysis - Basic Research : A Case Study
 

Último

Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...Sheetaleventcompany
 
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...Sheetaleventcompany
 
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan CytotecJual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotecjualobat34
 
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...Sheetaleventcompany
 
🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...
🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...
🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...soniya pandit
 
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...gragneelam30
 
Shazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdfShazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdfTrustlife
 
Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...
Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...
Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...dishamehta3332
 
Most Beautiful Call Girl in Chennai 7427069034 Contact on WhatsApp
Most Beautiful Call Girl in Chennai 7427069034 Contact on WhatsAppMost Beautiful Call Girl in Chennai 7427069034 Contact on WhatsApp
Most Beautiful Call Girl in Chennai 7427069034 Contact on WhatsAppjimmihoslasi
 
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...Namrata Singh
 
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...Sheetaleventcompany
 
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Sheetaleventcompany
 
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Angel
 
Electrocardiogram (ECG) physiological basis .pdf
Electrocardiogram (ECG) physiological basis .pdfElectrocardiogram (ECG) physiological basis .pdf
Electrocardiogram (ECG) physiological basis .pdfMedicoseAcademics
 
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Sheetaleventcompany
 
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Sheetaleventcompany
 
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...Sheetaleventcompany
 
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...rajnisinghkjn
 
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryJyoti singh
 
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...Sheetaleventcompany
 

Último (20)

Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
 
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
Jaipur Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Jaipur No💰...
 
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan CytotecJual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
Jual Obat Aborsi Di Dubai UAE Wa 0838-4800-7379 Obat Penggugur Kandungan Cytotec
 
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
Pune Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Pune No💰Adva...
 
🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...
🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...
🚺LEELA JOSHI WhatsApp Number +91-9930245274 ✔ Unsatisfied Bhabhi Call Girls T...
 
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
 
Shazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdfShazia Iqbal 2024 - Bioorganic Chemistry.pdf
Shazia Iqbal 2024 - Bioorganic Chemistry.pdf
 
Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...
Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...
Whitefield { Call Girl in Bangalore ₹7.5k Pick Up & Drop With Cash Payment 63...
 
Most Beautiful Call Girl in Chennai 7427069034 Contact on WhatsApp
Most Beautiful Call Girl in Chennai 7427069034 Contact on WhatsAppMost Beautiful Call Girl in Chennai 7427069034 Contact on WhatsApp
Most Beautiful Call Girl in Chennai 7427069034 Contact on WhatsApp
 
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...Kolkata Call Girls Naktala  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Girl Se...
Kolkata Call Girls Naktala 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
 
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
 
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
 
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
Bandra East [ best call girls in Mumbai Get 50% Off On VIP Escorts Service 90...
 
Electrocardiogram (ECG) physiological basis .pdf
Electrocardiogram (ECG) physiological basis .pdfElectrocardiogram (ECG) physiological basis .pdf
Electrocardiogram (ECG) physiological basis .pdf
 
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
Goa Call Girl Service 📞9xx000xx09📞Just Call Divya📲 Call Girl In Goa No💰Advanc...
 
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
Chandigarh Call Girls Service ❤️🍑 9809698092 👄🫦Independent Escort Service Cha...
 
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
 
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
 
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
 
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
❤️Call Girl Service In Chandigarh☎️9814379184☎️ Call Girl in Chandigarh☎️ Cha...
 

QIAGEN LNA Tools - Experience truly exceptional RNA Research

  • 1. Sample to Insight QIAGEN Locked Nucleic Acid (LNA®) Tools Experience truly exceptional RNA research The Power of LNA & QIAGEN‘s LNA Enhanced Portfolio
  • 2. Sample to Insight Content 2Successfully Detect miRNAs Using qPCR with LNA Technology The power of LNA LNA enhanced portfolio 1 2
  • 3. Sample to Insight LNA (Locked nucleic acids) are a class of high affinity RNA analogs with the ribose ring locked in the ideal conformation for Watson-Crick binding • LNA increase the strength of base pairing • LNA increase the binding affinity compared to conventional DNA and RNA oligos 3 LNA® - making oligos with unprecedented characteristics • Increased Tm (2 - 8ºC per base) • Improved mismatch discrimination • High sensitivity and specificity in probes and assays • Increased oligo stability and potency in cells The power of LNA
  • 4. Sample to Insight QIAGEN the new home for Locked Nucleic Acid 4 Taking advantage of LNA requires sufficient experience: o Knowledge of optimal LNA positioning in the oligo o Understanding of RNA o Understanding of the application and its purpose EXIQON (a QIAGEN company) optimized application designs over many years • Patented designs • Sophisticated design algorithms behind every LNA-enhanced product • 30-60 parameters in play when designing LNA oligo-based products: • Tm, length, secondary structure/accessibility, mis-match discrimination/off-target binding, binding specificity, self-complementarity, LNA -positioning • Online design tools for custom products – now at QIAGEN 20 years experience in designing LNA oligos “Exiqon reagents stand out in front of other platforms from a technological standpoint”. Dr Parker Antin, University of Arizona
  • 5. Sample to Insight LNA is used to adjust the Tm of oligonucleotides 5 Tm adjustments enables: • Increased affinity towards DNA and RNA targets • Increased specificity (shorter sequences) • Increased flexibility in oligo design • Sequence independence (GC content less important) Same length, higher Tm Shorter length, similar Tm
  • 6. Sample to Insight LNA enables detection of all microRNAs - even the AT-rich 6 LNA ™ DNA 98% of these microRNAs have under 50% GC 66% of these microRNAs have under 50% GC 30% of these microRNAs have under 50% GC Increasing GC content
  • 7. Sample to Insight LNA enables oligo Tm normalization 7 IncreasingGCcontent Power of Tm-normalization: • Overall narrower Tm interval (red) • Highly increased Tm of AT-rich assays • Shift to higher median Tm (x-axis) • Higher stringency and potency Benefits of LNA & Tm-normalization • Higher sensitivity and specificity • Ability to address targets of low Tm e.g. miRNA low in GC content • Inhibitors: higher potency of all inhibitors • Detection probes: Uniform hybridization of all miRNA at the same Thyb for ISH (enables automation) • qPCR: uniform amplification of all miRNA targets
  • 8. Sample to Insight LNA enhances the discriminatory power of oligonucleotides 8 LNA enhances specificity of oligonucleotides for complementary RNA and DNA targets 40% Form. LNA DNA THJ200 ²rip 42 C 20‘ KD200 THJ202 THJ201 LNA DNA 50% Form. B 40% Form. LNA DNA THJ200 ²r KD200 THJ202 THJ201 LNA 50% Form B mRNA SSA4 in situ hybridization, fixed yeast cells. Thomsen et al., 2005, RNA Target Probe Perfect match DNA Single mismatch 3’ccaggaaggaaccac-5’ ∆Tm DNA 15mer 5’ggtccttacttggtg3’ Tm = 59.4°C Tm = 55.7°C 3.7°C DNA/LNA 15mer 5’ggtccttActtggtg3’ Tm = 60.9°C Tm= 52.7°C 8.2°C
  • 9. Sample to Insight LNA DNA RNA OME LNA ™ vs. competing technology ISH using DIG-labeled probes (miR-122) Discriminating miR-1 in heart of chicken embryo Pictures kindly provided by D. Sweetman, University of East Anglia, Norwich, UK Unique sensitivity Unique specificity gga-miR-1a UGGAAUGUAAGGAAGUGUGUGG gga-miR-206 UGGAAUGUAAAGAAGUAUGU LNA enables RNA detection – the ONLY technology which works! “Basically no other technology has been demonstrated to work for microRNA detection in situ.” Dr. Dylan Sweetman, University of East Anglia
  • 10. Sample to Insight Exceptional specificity – single–nucleotide mismatch discrimination 10 The signal obtained from perfectly matched LNA oligos (100%) is compared to signal from LNA oligos with a single nucleotide mismatch. Perfect match Single nucleotide mismatch
  • 11. Sample to Insight Effective RNA silencing - with the robustness and stability for in vivo 11
  • 12. Sample to Insight Content 12 The power of LNA LNA enhanced portfolio 1 2
  • 13. Sample to Insight A solution for every step of your RNA workflow 13 NGS PCR Data analysis & Interpret ation Function al analysis Instruments • QIAcube/QIAcube HT • QIAsymphony® SP/AS • QIAxcel Advanced • QIAxpert (for QC) • QIAxpert • QIAxcel Advanced • QIAgility • Rotor-Gene® Q • QIAsymphony SP/AS Kits and Reagents • RNeasy Plus Kits • RNeasy Kits for all sample types • exoRNeasy Kits for exosomal RNA • PAXgene Blood/Tissue RNA Systems for stabilization and purification • Custom LNA® Detection Probes for mRNA and lncRNA • QIAseq® UPX 3' Transcriptome Kits • QIAseq UPX 3' Targeted RNA Panel • QIAseq Stranded RNA Library Kits • QIAseq Targeted RNA Panels • QIAseq Targeted RNAscan Panels • QIAseq FX Single Cell RNA Library Kit • QIAseq Immune Repertoire RNA Library Kits • RT2 Profiler PCR Arrays Predesigned assays and pathway panels for mRNA and lncRNA • QuantiNova qPCR Kits Combined with self- designed primers or QuantiTect® Primer Assays • Ingenuity® Pathway Analysis (IPA®) • CLC Genomics Workbench • Biomedical Genomics Workbench • GeneGlobe® Data Analysis Center • Antisense LNA GapmeRs For mRNA and lncRNA silencing in vitro and in vivo • miRNeasy Kits for all sample types • PAXgene Blood/Tissue miRNA Systems for stabilization and purification • miRCURY LNA miRNA Detection Probes • QIAseq miRNA Library Kit • QIAseq miRNA Library QC PCR Panel and Assays • miRCURY LNA miRNA PCR System Predesigned or custom PCR assays and panels • miRCURY LNA miRNA Mimics, Inhibitors and Target Site Blockers For function analysis in vitro and in vivo QIAGEN Genomic Services: Sample preparation, NGS analysis, qPCR analysis, Data analysis and biological interpretation RNA preparation Localization ISH Northern mRNAlncRNAmiRNA
  • 14. Sample to Insight A solution for every step of your RNA workflow – LNA enhanced 14 NGS PCR Data analysis & Interpret ation Function al analysis Instruments • QIAcube/QIAcube HT • QIAsymphony® SP/AS • QIAxcel Advanced • QIAxpert (for QC) • QIAxpert • QIAxcel Advanced • QIAgility • Rotor-Gene® Q • QIAsymphony SP/AS Kits and Reagents • RNeasy Plus Kits • RNeasy Kits for all sample types • exoRNeasy Kits for exosomal RNA • PAXgene Blood/Tissue RNA Systems for stabilization and purification • Custom LNA® Detection Probes for mRNA and lncRNA • QIAseq® UPX 3' Transcriptome Kits • QIAseq UPX 3' Targeted RNA Panel • QIAseq Stranded RNA Library Kits • QIAseq Targeted RNA Panels • QIAseq Targeted RNAscan Panels • QIAseq FX Single Cell RNA Library Kit • QIAseq Immune Repertoire RNA Library Kits • RT2 Profiler PCR Arrays Predesigned assays and pathway panels for mRNA and lncRNA • QuantiNova qPCR Kits Combined with self- designed primers or QuantiTect® Primer Assays • Ingenuity® Pathway Analysis (IPA®) • CLC Genomics Workbench • Biomedical Genomics Workbench • GeneGlobe® Data Analysis Center • Antisense LNA GapmeRs For mRNA and lncRNA silencing in vitro and in vivo • miRNeasy Kits for all sample types • PAXgene Blood/Tissue miRNA Systems for stabilization and purification • miRCURY LNA miRNA Detection Probes • QIAseq miRNA Library Kit • QIAseq miRNA Library QC PCR Panel and Assays • miRCURY LNA miRNA PCR System Predesigned or custom PCR assays and panels • miRCURY LNA miRNA Mimics, Inhibitors and Target Site Blockers For function analysis in vitro and in vivo QIAGEN Genomic Services: Sample preparation, NGS analysis, qPCR analysis, Data analysis and biological interpretation RNA preparation Localization ISH Northern mRNAlncRNAmiRNA
  • 15. Sample to Insight QIAseq® miRNA Library Kits The QIAseq miRNA Library Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease 15 miRNA / piRNA sequencing, gel-free & LNA-enhanced • Utilizes Unique Molecular Indices (UMI) technology • No more gels – gel-free, bead-based workflow starting with only 1 ng RNA • For miRNA, piRNA and small RNA expression analysis and novel small RNA discovery • Data analysis included through cloud-based GeneGlobe Data Analysis Site QIAseq miRNA Library Kit (96), Cat. no. 331505 QIAseq miRNA Library Kit (12), Cat. no. 331502 QIAseq miRNA NGS 12 Index IL (12), Cat. no. 331592 QIAseq miRNA NGS 48 Index IL (96), Cat. no. 331595
  • 16. Sample to Insight QIAseq miRNA Library QC PCR Panel and Assays 16 For evaluating RNA sample quality and for assessing NGS performance post-sequencing • Unique qPCR-based sample QC of miRNA/small RNA samples prior to NGS • Essential for challenging samples with low RNA content, such as biofluids • LNA miRNA PCR Assays in ready-to-use PCR panels • Compatible with all major qPCR instruments • Comprehensive set of 52 RNA spike-ins, spanning a wide range of concentrations • Thorough post-sequencing assessment of NGS linearity and reproducibility QIAseq miRNA Library QC PCR Array Kit, Product no. 331541 QIAseq miRNA Library QC PCR Assay, Product no. 331551 QIAseq miRNA Library QC Spike-ins, Product no. 331535 The QIAseq UPX Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
  • 17. Sample to Insight QIAseq UPX 3' Transcriptome Kit 17 High-throughput 3’-transcriptome NGS from ultralow amounts of RNA • Sample input from 1 to 100 cells or 10 pg to 1 ng isolated RNA • LNA -enhanced chemistry for increased accuracy, specificity and sensitivity • Integrated unique molecular indexing (UMI) removes amplification bias • Cell tagging and sample indexing enables simultaneous sequencing of up to 18,432 transcriptomes • Data analysis with the GeneGlobe Data Analysis Center QIAseq UPX 3' Transcriptome Kit (96), Cat.no. 333088 QIAseq UPX 3' Transcriptome Kit (384), Cat.no. 333090 QIAseq UPX 3' Trans. 12-Index (48), Cat.no. 333074 QIAseq UPX 3' Trans. 48-Index (192), Cat.no. 333075 The QIAseq UPX Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
  • 18. Sample to Insight QIAseq UPX 3' Targeted RNA Panel 18 High-throughput, targeted gene expression using 3’-targeted NGS • Target up to 1000 genes using a cost-effective, time- saving single-tube library prep • LNA-enhanced chemistry for increased accuracy, specificity and sensitivity • Integrated unique molecular indexing (UMI) removes amplification bias • Cell tagging and sample indexing enables simultaneous sequencing of up to 147,456 targeted libraries • Cloud-based data analysis with the GeneGlobe Data Analysis Center QIAseq UPX 3' Targeted RNA Panel (96), Cat.no. 333041 QIAseq UPX 3' Targeted RNA Panel (384), Cat.no. 333043 QIAseq UPX 3' Targeted RNA 12 index (48), Cat.no. 333044 QIAseq UPX 3' Targeted 96 index A (384), Cat.no. 333051 QIAseq UPX 3' Targeted 96 index B (384), Cat.no. 333052 QIAseq UPX 3' Targeted 96 index C (384), Cat.no. 333053 QIAseq UPX 3' Targeted 96 index D (384), Cat.no. 333054 The QIAseq UPX Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
  • 19. Sample to Insight miRCURY LNA miRNA PCR System 19 Unique miRNA qPCR system of universal RT combined with two miRNA-specific qPCR primers Accurate and reliable quantification • Accurate and reliable quantification of individual miRNAs from as little as 1pg total RNA Distinguish between miRNA sequences • Distinguish between miRNA sequences that differ by a single nucleotide Thoroughly validated • LNA-enhanced and Tm normalized primers, Easy & Quick protocol • 3-hour, easy-to-follow protocol that minimizes pipetting Various control options • Controls available for RNA isolation, RT and PCR efficiency control Data analysis • GeneGlobe Data Analysis Center One cDNA reaction for all miRNAs Two LNA®-enhanced miRNA- specific qPCR primers The miRCURY LNA® miRNA PCR System is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
  • 20. Sample to Insight miRCURY LNA miRNA PCR System 20Successfully Detect miRNAs Using qPCR with LNA Technology Universal cDNA synthesis 3 hour workflow Individual or custom Assays and Ready-to-use panels + high performance miRNA SYBR Green PCR Kit Easy and free of charge data analysis miRNA isolation cDNA synthesis PCR Data analysis miRCURY LNA RT Kit miRCURY LNA miRNA PCR Assays miRCURY LNA miRNA Custom PCR Assays miRCURY LNA miRNA miRNome Panels miRCURY LNA miRNA Focus Panels miRCURY LNA miRNA QC Panels miRCURY LNA SYBR Green PCR Kit GeneGlobe Data Analysis Center Easy start with miRCURY LNA miRNA PCR Starter Kit + Optional RNA Spike-in Kit for QC
  • 21. Sample to Insight Antisense LNA GapmeRs 21 Potent antisense oligonucleotides for highly efficient knockdown of mRNA and lncRNA • Efficient RNase H dependent degradation of complementary RNA targets • Active in vivo and in vitro – enabling the analysis RNA function in a wide range of model systems • Excellent alternative to siRNA for knockdown of mRNA and lncRNA • Taken up by cells by transfection or unassisted delivery • Designed with a sophisticated and empirically developed algorithm for potent and specific knockdown of target RNAs
  • 22. Sample to Insight Antisense LNA GapmeRs 22 Potent antisense oligonucleotides for highly efficient knockdown of mRNA and lncRNA • 15 - 16mer LNA / DNA antisense oligonucleotide • LNA at extremities enhances affinity for the target • RNase H activity requires a certain distance (”gap”) between LNAs • Phosphorothioate modified backbone • Online design tool • Empirically derived design algorithm evaluates thousands of LNA GapmeRs with more than 30 design parameters Antisense LNA GapmeRs Standard, Product no. varies Antisense LNA GapmeRs Custom Plate, Product no. 339530 The Antisense LNA GapmeRs is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease
  • 23. Sample to Insight miRCURY LNA miRNA Inhibitors 23 Inhibitors for miRNA loss-of-function studies • Tm-normalized inhibitors with unmatched potency against any miRNA, regardless of GC content • Power Inhibitors so potent that they work by unassisted uptake with no need for transfection reagents • Superior specificity and biological stability for long-lasting antisense activity • Available in 1-, 5- and 15 nmol quantities • Fluorescent labels for convenient monitoring of transfection efficiency miRCURY LNA miRNA Inhibitors, Product no. varies miRCURY LNA miRNA Power Inhibitors, Product no. varies Custom miRCURY LNA miRNA Inhibitors, Product no. varies miRCURY LNA miRNA Family Power Inhibitors, Product no. varies miRCURY LNA miRNA Inhibitor Libraries, Product no. varies miRCURY LNA miRNA Inhibitors are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease
  • 24. Sample to Insight miRCURY LNA miRNA Mimics 24 For studies on miRNA function and gene regulation using synthetic miRNA • Highly potent, mature miRNA mimics with unique triple RNA strand design • No miRNA-star activity from bisected LNA -enhanced passenger strand • miRNA strand sequence matches miRBase annotation • Available with fluorescent label to assess transfection efficiency • Available with biotinylated miRNA strand to isolate targets by RNA pull-down miRCURY LNA miRNA Mimic (5 nmol) / (20 nmol), Product no. 339173 / 339174 miRCURY LNA Premium miRNA Mimic (5 nmol) / (20 nmol), Product no. 339178 / 339179 miRCURY LNA miRNA Mimics are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease
  • 25. Sample to Insight miRCURY LNA miRNA Power Target Site Blockers 25 For studying the effects of an individual miRNA on a single target site • Custom-designed target site blockers for specific inhibition of miRNA targets • Sophisticated design and superior high affinity, regardless of target sequence • Unmatched high efficacy in vitro and in vivo • Unrivaled performance and high protein expression due to lack of RNase H-dependent mRNA degradation • Efficient at very low concentrations, outcompeting miRNAs for their target sites • Superior biological stability for long-lasting antisense activity miRCURY LNA miRNA Power Target Site Blockers (5 nmol) / (15 nmol), Product no. 339194 / 339195 miRCURY LNA miRNA Power Target Site Blockers, in vivo Ready (5 nmol) / (15 nmol), Product no. 339199 / 339200 TSB miRCURY LNA miRNA Power Target Site Blockers are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease
  • 26. Sample to Insight miRCURY LNA miRNA Detection Probes 26 For ultra-sensitive & specific miRNA detection by in situ hybridization (ISH) or Northern blotting • Superior sensitivity and specificity for detecting low-abundance miRNAs • Predesigned probes available for all miRNA species or Custom-designed probes for targeting novel miRNA sequences • A wide selection of available labels enables multiplexing and co-localization • Ideal for standardized protocols for automated, high- throughput ISH • Fast and easy workflow using the One-day miRNA ISH protocol miRCURY LNA miRNA ISH Buffer Set (FFPE), Product no. 339450 miRCURY LNA miRNA ISH Optimization Kit (FFPE) 1-9, Product no. varies miRCURY LNA miRNA ISH Buffer and Controls, Product no. 339459 miRCURY LNA miRNA ISH Optimization Kits (FFPE) are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease
  • 27. Sample to Insight Custom LNA mRNA Detection Probes miRCURY LNA miRNA ISH Optimization Kits (FFPE) are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease 27 For ultra-sensitive detection and discrimination by highly similar mRNA and lncRNA by in situ hybridization and Northern blotting • Sensitivity and specificity superior to DNA probes and riboprobes • Short probes ideal for discriminating highly similar sequences - e.g. splice variants and isoforms • Online tools provide optimally designed LNA -enhanced probes in minutes • Available with a wide selection of labels • No cloning expertise required • Excellent tissue penetration
  • 28. Sample to Insight Custom LNA ™ Oligonucleotides 28 For experiments requiring custom-designed, LNA -enhanced oligonucleotides QIAGEN offers synthesis of custom LNA oligonucleotides with a wide variety of modifications, labels, synthesis scales, purification scale options • Create or improve any RNA or DNA application with LNA – ONLY with QIAGEN • Order any LNA -enhanced oligo of interest • your own design with the LNA spiking pattern of your choice • Use the online LNA oligo help tools to for Tm prediction and LNA optimization • LNA oligos are available in small scale (nmol-µmol) for in vitro applications and in large scale (mg) for in vivo use in animal models Alternatively, have QIAGEN experts in LNA oligo design assist in designing the most optimal LNA oligo for their application (design fee applicable) Custom LNA mRNA Detection Probes are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease.
  • 29. Sample to Insight Website link 29 For detailed information about LNA products please visit us: www.qiagen.com/LNA