DNA Fingerprinting
•Descargar como PPTX, PDF•
19 recomendaciones•2,186 vistas
Define DNA fingerprint and DNA fingerprinting. Explain some terms related to DNA fingerprinting. Describe the method of collection and preservation of biological samples. Describe the uses of DNA fingerprinting. Describe the types of DNA fingerprinting. Describe the steps of DNA fingerprinting. Presented by, Dr. Md. Mohiuddin Masum Resident, MS Anatomy PAY2B6 Guided by, Prof. Dr. Shahara Khatun
Recomendados
Más contenido relacionado
La actualidad más candente
La actualidad más candente (20)
Destacado
Destacado (12)
Similar a DNA Fingerprinting
Similar a DNA Fingerprinting (20)
Más de Rayhan Shahrear
Más de Rayhan Shahrear (20)
Último
Último (20)
DNA Fingerprinting
- 3. DNA Fingerprinting Presented by, Dr. Md. Mohiuddin Masum Resident, MS Anatomy PAY2B6 Guided by, Prof. Dr. Shahara Khatun
- 4. Define DNA fingerprint and DNA fingerprinting Explain some terms related to DNA fingerprinting Describe the method of collection and preservation of biological samples Describe the uses of DNA fingerprinting Describe the types of DNA fingerprinting Describe the steps of DNA fingerprinting Objectives
- 6. A small set of DNA variation that is very likely to be different in all unrelated individuals, thereby being as unique to individuals as are fingerprint DNA Fingerprint
- 7. A method used to identify an individual from a sample of DNA by looking at unique patterns in their DNA sequence DNA Fingerprinting www.yourgenome.org
- 8. Also known as, DNA Fingerprinting DNA profiling DNA testing DNA typing Genetic fingerprinting
- 10. The beginning
- 11. The beginning
- 12. Reference sample https://quizlet.com/chapter-2-the-crime-scene-definitions/ Terms related to DNA fingerprinting
- 13. Terms related to DNA fingerprinting Polymorphism http://groups.molbiosci.northwestern.edu//DNA_polymorphism
- 14. Terms related to DNA fingerprinting DNA Polymorphism http://groups.molbiosci.northwestern.edu//DNA_polymorphism Single nucleotide polymorphism (SNP) Minisatellite or variable number of tandem repeat (VNTR) Microsatellite or short tandem repeat (STR)
- 15. Terms related to DNA fingerprinting Junk DNA Proteomics & Genomics/Dr. Vikash Kumar Dubey 95%
- 16. Terms related to DNA fingerprinting Tandem repeat www.bio.miami.edu/dana/dox/vntr.html
- 17. Terms related to DNA fingerprinting Tandem repeat
- 18. Terms related to DNA fingerprinting Minisatellite or VNTR AGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGA https://en.wikipedia.org/wiki/Variable_number_tandem_repeat
- 19. Terms related to DNA fingerprinting Microsatellite or STR ATGCCATGCCATGCCATGCCATGCC https://en.wikipedia.org/wiki/Microsatellite
- 20. Terms related to DNA fingerprinting Restriction endonuclease Escheria coli EcoRI 5’ GAATTC 3’ 3’ CTTAAG 5’ 5’ G AATTC 3’ 3’ CTTAA G 5’ https://en.wikipedia.org/wiki/Restriction_enzyme
- 21. Blood Saliva Semen Tissue from personal item From stored sample Hair follicle Sources of DNA evidence
- 22. Sources of DNA evidence
- 23. Collection & preservation of biological samples
- 24. Forensic science Paternity and maternity determination Personal identification Use of DNA fingerprinting
- 25. We all are different! Rayhan’s DNA Zobayer’s DNA DNA fingerprinting overview
- 26. So…. How do we tell people apart just by their DNA anyways? DNA fingerprinting overview
- 27. The DNA gets cut up by special scissors DNA fingerprinting overview
- 28. The scissors can only cut the same colour DNA fingerprinting overview
- 29. All of the cut up pieces of DNA are different sizes DNA fingerprinting overview
- 30. A special machine sorts the DNA by size DNA fingerprinting overview
- 31. Our DNA has different sizes of pieces so it makes a different pattern when it’s all cut up DNA fingerprinting overview Rayhan’s DNA Zobayer’s DNA
- 32. DNA fingerprinting overview Rayhan’s DNA Zobayer’s DNA
- 33. Restriction fragment length polymorphism (RFLP) Polymerase chain reaction amplification of short tandem repeat (PCR/STR) Types of DNA fingerprinting
- 34. RFLP Types of DNA fingerprinting DNA extraction Restriction digestion Electrophoresis Transfer of DNA to membrane Hybridization of DNA X-ray
- 35. Southern blotting Types of DNA fingerprinting: RPLP
- 36. PCR/SRT Types of DNA fingerprinting
- 37. Multiplex PCR Types of DNA fingerprinting
- 38. 13 CODIS core STR loci with chromosomal position Types of DNA fingerprinting
- 39. Types of DNA fingerprinting Restriction fragment length polymorphism (RFLP) Polymerase chain reaction amplification of short tandem repeats (PCR/SRT) More sample needed Less sample needed Fresh DNA sample needed Fresh DNA sample not always mandatory No chance of amplification of contamination Chance amplification of contamination Require more time Require less time Analysis is costly Analysis is cheaper than RFLP
- 40. Single cell DNA fingerprint
- 41. DNA database http://www.investigativegenetics.com/content/4/1/2 1995 National DNA Database (NDNAD) 6 millions Combined DNA Index System (CODIS) 10 millions National DNA Database 16 millions
- 42. Future of DNA fingerprinting
- 43. DIY
- 44. goo.gl/4Gqgfb
Notas del editor
- Conventional fingerprint of an individual comes from finger tip and unique for an individual. This is used for identification of a person in forensic lab, police station etc. However, the major drawback of the conventional fingerprints is that it can be changed by surgery. There is another type of fingerprint unique to an individual called DNA fingerprint. This remains same in all body parts, tissues and cells as well as cannot be altered by any known methods. Thus, DNA fingerprint method is becoming primary method for identifying an individual.
- Conventional fingerprint of an individual comes from finger tip and unique for an individual. This is used for identification of a person in forensic lab, police station etc. However, the major drawback of the conventional fingerprints is that it can be changed by surgery. There is another type of fingerprint unique to an individual called DNA fingerprint. This remains same in all body parts, tissues and cells as well as cannot be altered by any known methods. Thus, DNA fingerprint method is becoming primary method for identifying an individual.
- The process of DNA fingerprinting was invented by Sir Alec Jeffrey at the University of Leicester in 1984
- the first case (March 1985) was not strictly a forensic case but one of immigration. The first application of DNA fingerprinting saved a young boy from deportation.
- Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He was arrested in 1986 for the rape and murder of two girls and was sentenced in 1988.
- To compare the victim’s or suspect’s DNA profile to the recovered crime-scene DNA, the laboratory will need to have their known biological samples available for a side-by-side comparison. These known samples are called reference samples.
- The DNA profiling of each individual is unique because of the diverse in polymorphic regions present in genome of every individual. These polymorphic regions used for identification are the non-coding regions of the genome. The polymorphic regions of the DNA do not code for proteins and which make-up 95% of our genetic DNA. Hence these regions are therefore called the ―junk DNA‖. Although these ―junk DNA‖ regions do not code for proteins, they are involved in regulating gene expression, they help in reading of other genes that code for protein and are a large portion of the chromosome structure.
- Best sample to take from a dead body for DNA testing: Blood, tissue or hair roots can be collected from a body. If the body is decomposed, the best samples are long bones such as the humerus or femur. However, we can also work with teeth.
- METHODS OF COLLECTION: · Whole blood Sample: Sterile needle should be used while withdrawing or collecting blood. · Blood stain: Should be picked up preferably on sterile cotton gauge using sterile forceps and blade. · Seminal stain: Should not be touched by hand especially the stain portion. Should be picked up with sterile forceps. · Hard Tissues: Bones-- bones should be picked up using gloves, Kept at a place where there are no chances of environmental contamination. It should be allowed to dry completely. · Soft Tissues: Body organs should be collected using forces and wearing gloves. It should be kept in a sterile container. · Hair: Hair roots are preferred for the analysis. Hair roots should be picked up using sterile forceps.
- Can you guess which one is Sara and which one is Miss Ellis?
- Dr Ian Findlay at the Australian Genome Research Facility, the University of Queensland, developed the now patented technique which has the same level of accuracy achieved by traditional DNA fingerprinting methods.