1. University of Debrecen
Centre for Agricultural and Applied
Economics Science
Faculty of Agricultural and Food Sciences and
Environmental Management
Effect of Stearoyl-COA desaturase gene
polymorphism on milk production traits of
Hungarian Holstein Friesian cows
By :
 Tegegn Gudeta, Jaleta (MSc thesis)
Debrecen , Hungary,
May 2012

2. Introduction
Marker Assisted selection in modern dairy
Number of studies conducted in large scale on
candidate genes in dairy breeding
SCD is hypothesiszed candidate gene
 It catalyze Cis∆-9 desaturation
 Mapped to chromosome 26 in bovine
 SCD 1 and SCD5
 Associated with milk fatty acid composition
Studies of SCD gene not conducted in HHF

3. Objectives of the study
To estimating allele and genotype frequencies of
SCD gene polymorphism(878 C/T)
To determining the effect of SCD gene
polymorphism on cows milk production traits

4. Materials and Methods
1) Animals and Milk data
 Hair root samples (8-10) were collected from 277 HHF
in Tedej Dairy Farm located 15 km north of Debrecen
 One lactation milk record data were collected for 277
HHF cows-305 day average milk yield (kg), fat yield
(kg), fat percentage(%), protein yield (kg), protein
percentage (%) and SCC (10,000 cell/ml)

5. 2) Study Methods
 Molecular Laboratory of UD
 DNA isolation from Hair root
 3-5 hair root+ 100 µL Lysis buffer+1.5 ProteinK
 Water bath for 60 min at 60 0c , for 20 min at 95 oc water
bath, stored at -20 oc
 Spectrophotometrical Analysis-Nanodrop
Spectrophotometer
RT-PCR 7300

6. 3) DNA Amplification and Sequencing
 7300 RT-PCR machine (Applied Biosystem)
 Reaction mix(10µL): 1µl DNA, 5µl 1xTaqMan
MasterMix (PN 4371355, USA), 0.25µl 1xSNP probe and
3.75µl dH2O.
 TaqMan probe sequence:
The fluorescent probe VIC: ACTTACCCACAGCTCC
The fluorescent probe FAM: TTACCCGCAGCTCC
 SCD Primers (625µl 40x mix, Warington, UK,
WA37PB):
Forward Primer: CCCCGAGAGAATATTCTGGTTTCC
Reverse primer : CCACTAGACGTGGTCTTGCT

7.  Amplification and Sequencing protocol
 Initial steps: Activation at 950C for 10 minutes
(AmpliTaq Gold DNA polymerase), Melting for 15
sec at 920C, Annealing/Extension at 600C for 1
minute (40 cycles).
 The SNP 878 C/T was used in this study and the
nucleotide substitution was identified according to
Tanguichi et al., (2004).

8. 4.) Data Analysis
a)Descriptive Statistics using R software (Version: R-
2.14.2)
b)Hardy-Weinberg Equation
c) Analysis of Variance (ANOVA) using R software
(Version: R-2.14.2)

9. Results and Discussion
1. Genotypes and Allele Frequencies of SCD gene
Polymorphisms
 Amplification curve for CC(left) and CT(right)
genotypes

10. Result of amplification curve for TT genotype
(Green line)

11. Allelic discrimination of SCD genotypes (Blue-CC,
Green-CT, and Red-TT)

12. Genotype and allele frequencyy of the SCD gene in the investigated
Hungarian Holsteins cow population
No of Animals (Genotype SCD P value X2
Frequencies in %) Allele %
CC CT TT
0.04695 3.947
Observed 94(34) 148(53) 35(13) C(0.61)
Expected 102(37) 132(48) 43(15) T(0.39)

13. 2. Effects of SCD Genotypes on Recorded Milk Production Traits
Parameter Genotype
CC CT TT P value
Fat (%) 3.76±0.41 3.8±0.43 3.7±0.38 0.2272
Protein (%) 3.22±0.178 3.22±0.178 3.23±0.14 0.998
SCC(X103 cell/ml) 136±106.4 116±70.2 119±72.7 0.2264
305 MY (kg) 8277.5±1301 8468.5±1542 8463.4±1294 0.5805
305 FY (kg) 310.6±52.4 321.9±55.2 313±50.6 0.2505
305 PY (kg) 266.1±38.5 272.1±45.8 272.3±36.2 0.5315
Mean and standard deviation of milk production traits and its association with
SCD genotypes.

14. Conclussions
 Higher C allele(0.61) frequency and lower T allele
(0.39) frequency was reported in this study
 The SCD genotypes frequency in HHF herds under this
study were not in Hardy-Weinberg equilibrium, the
possible reason for this result may be small numbers of
animals included in this study and indicating the herds
were not in a random mating system
 SCD-878 C/T locus cannot be considered as candidate
gene in milk production traits
 Further studies will be necessary on large number of
animals to confirm the current result