Powered by Ion Torrent™ semiconductor chip technology, the Ion Proton™ Sequencer is the first benchtop next-generation sequencer to offer fast, affordable human genome and human exome sequencing. Powered by the next generation of semiconductor sequencing technology and offering a similar single-day workflow to the Ion PGM™ Sequencer, the Ion Proton™ Sequencer promises to change the way scientists look at genomics.
For more information visit:
http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/Sequencing/Semiconductor-Sequencing/proton.html?CID=Protonbrochure-SS-12312
The First Benchtop Next-Generation Sequencer - Ion Proton™ Sequencer
1. Ion Proton™ System
y
January 2012
The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
2. Highly Disruptive Technologies
E
Empower E Everyone
Main Frame Mini Computer Personal Computer
Sanger Sequencing Next‐Gen Sequencing Ion Semiconductor Sequencing
Technology generations are defined by who can use them
2
4. Ion’s Semiconductor Chip Sees Chemistry
Biological Information Ion Semiconductor Chip Digital Information
Leverages $1 Trillion investment and $50 Billion annual spend
4
5. Ion PGM™ Sequencer:
The Fastest Selling Sequencer in the World
• Speed:1.5
Speed:1 5 hour runs
• Scalability:10 Mb to 1 Gb
• Simplicity: Automated
workflows, benchtop
convenience
• Affordable
Aff d bl
5
6. The Promise of Semiconductor Sequencing
First 100-Fold Scaling Delivered and More
100 Fold
Achieved i 2011
A hi d in
• 100-fold scaling and 200 bp kits,
Ion 318™
Chip*
525 base perfect reads achieved
• Breakthrough Ion AmpliSeq™ app,
microbial and RNA-seq apps
Ion 316™
Chip • 5,000 member Ion Community
Ion 314™ 2012 Roadmap
Chip
• 2 x 200 paired end kit, 400 bp kits
• Custom and fixed AmpliSeq™ panels
• FDA submission and CE-IVD
certification
6 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
7. Introducing Ion Proton™ Chips
The Next 100-Fold Scaling
100 Fold
7 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
8. $500 Exome and $1,000 Genome
Sequencing in a Few Hours on the Benchtop
Ion Proton™ I Chip Ion Proton™ II Chip
2 human exomes 1 human genome
165 million wells 660 million wells
$1,000 per run $1,000 per run
Highest Throughput
8 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
9. Introducing the Ion Proton™ Sequencer
The Benchtop Genome Center
9 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
10. Introducing the Ion Proton™ Sequencer
The Benchtop Genome Center
10 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
11. Introducing the Ion Proton™ Sequencer
The Benchtop Genome Center
11 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
12. Introducing the Ion Proton™ Sequencer
The Benchtop Genome Center
• Supports Ion Proton™ I and
Proton
Proton™ II chips
• $149K List Price (USD)
– $99K for Ion PGM™ owners
• State-of-the-art electronics to
support highest throughput
12 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
13. …and Rack-Mountable!
Broad, Baylor,
Broad Baylor and Yale have already
signed up for this configuration
13 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
14. Harnessing a Decade of Moore’s Law in
O L
One Leap…
Nature 475, 348 352 (21 July 2011)
475 348–352
Ion Proton™ I Chip: 165 million wells
(>100-fold
( 100 fold more wells than Ion 314™ Chip)
314
14 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
15. …While Seamlessly Scaling Ion’s PostLight™
Sequencing Ch i t
S i Chemistry
Ion 314™ Chip Signal Ion Proton™ I Chip Signal
Nucleotide Incorporation Signal
Signal,
Same Signal Same Speed
Internally generated R&D data shown
15 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
16. Maintaining 200 Base Read Lengths
200 Base Q20 Reads on Ion Proton™ I Chip
TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC
||||||||||||||||||||||||||||||||||||||||||||||||||
TCTTCTTCTGGCTGCCAGCACGCCGGTTGTAGTGGGATCTCTTCGCGATC
1 10 20 30 40 50
AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATGACCT
||||||||||||||||||||||||||||||||||||||||||||||+|||
AAACGCCAGATCACCCCCGTTAACCACTTCAGAACCGTGGGTGATG-CCT
51 60 70 80 90 100
TTGAAATCGAATCAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT
|||||||||||+||||||||||||||||||||||||||||||||||||||
TTGAAATCGAA CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT
TTGAAATCGAA-CAGGTTGGTATCGCACAGATGCGACGGCACCACATTCT
101 110 120 130 140 150
GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG
||||||||||||||||||||||||||||||||||||||||||||||||||
GCATCGCGCTGAACATCGTCTCGATACGCCCTGGATAACGTTTATCCCAG
151 160 170 180 190 200
TCA
|||
TCA
201
Internally generated R&D data shown
16 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
17. Single Day Workflow with Highest Throughput
Ion Kits Ion Proton™ Ion Proton™ Sequencer Proton™ Torrent Server
OneTouch S t
O T h System
17 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
18. Streamlined Bioinformatics Infrastructure
Server Room & Informaticists in a Box and in the Cloud
Ion Reporter™
Solution
Proton
Proton™ Torrent Server
and Torrent Suite Software
18 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
19. Overcoming Data Bottlenecks
Full Genomes in Ion Reporter™
p High Data
g
Hours vs. Weeks Solution Quality
More uniform coverage
Single genome Flexible cloud-based
enables higher quality
sequencing in hours solution to manage
manage,
variant calls with less raw
greatly eases analysis annotate, and archive
data. Longer reads
bottleneck (vs. batch- variants of interest for
enable better mappability
processing) future interpretation
with less raw data
19 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
20. Ion Proton™ System Availability
January 2012 Ion Proton System available for quotes
Proton™
Ion Proton™ I Chip to commence shipment
Mid-2012 (Ion Proton™ II Chip to be available 6 months later)
Early Access for 4-unit rack-mounted configuration
4 unit rack mounted
Unrestricted launch of Ion Proton™ Sequencer and
End of Q3:2012
standalone Proton Torrent™ Server to commence
20 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
21. Ion Semiconductor Sequencing
Rapid,
Rapid Benchtop Sequencing for All
1.25”
1”
Genes Genomes
Ion 3 Series Chips
3-Series Ion Proton™ Chips
Ion PGM™ Sequencer Ion Proton™ Sequencer
21 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
22. Unprecedented Scaling Every 6 Months
22 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
23. Enabling All Applications
23 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
24. 5500 Wildfire
24 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
25. Wildfire Offered to Existing 5500 Customers
Mid-2012 Delivery
Wildfire simplifies workflow and improves economics while
retaining ultra high accuracy and p y p
g g y pay-per-lane sequencing
q g
1.Simpler Workflow: 2 hour on flowchip template preparation
2.Lower Price / Gb: $25 / Gb guaranteed
3.Higher Throughput:
g g p > 20 Gb / day throughput
y g p
25 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
26. Purchasing Options for 5500 and
SOLiD C t
Customers
• Ion Proton™ Sequencer + Wildfire upgrade
q pg
(discounted package for 5500 customers)
• Ion Proton™ Sequencer + 5500 Wildfire
(discounted package for SOLiD customers)
• Ion Proton™ Sequencer
(discounted, standalone for 5500/SOLiD)
• Wildfire upgrade
(list price, standalone for 5500/SOLiD)
26 The content provided herein may relate to products that have not
been officially released and is subject to change without notice.
27. All products mentioned in this presentation are for Research Use Only,
not i t d d f any animal or h
t intended for i l human th therapeutic or di
ti diagnostic use.
ti
27 Confidential and Proprietary—DO NOT DUPLICATE