SlideShare una empresa de Scribd logo

Simulated CpG frequency from lab07 Markov model

•
•
A
aggarwalenterprisesf

The document provides the sequence from the file "lab07.fasta". It then asks to simulate 100 sequences of the same length using a Markov model generated from the sequence, and report the mean and standard deviation of the number of "CpG" occurrences in the simulated sequences. This would indicate if the Markov model adequately simulates the observed CpG frequency.

Educación
1 de 1
Descargar para leer sin conexión
Inside lab07.fasta, here is the sequence: >lab07 ttatgtactctaaggaaagaaataaacatttaaaaaaatgttgaaaaaattttaaataaaactgcatacc aatagcctgatgagtatgtatgcCGaaattctcattaaaataccttcaaattaaagtcaacaatacatta atagaatcatttaccataatcaagtgggatatatccctggcttcaagggtggtaccacattcacagatca atcaacatgatgcaccacagtaatagaagaaaggataagaacaatatgatgctttcaacagatgcaggaa aaccatttgacaaaatgtcacatccattcatgataaaaaCGctcagcaaagtacattgagactcaaccta cctgcacataataaaagtcatctaggaaaaacccacagctaatctcatcctcaatggggaaaaattgaaa gttgttcctccaaggtcagggacaagacagggatgacccctctcaccactgttattcacatagtaCGgga aatcctagccacagcaatcagacaacaaaaagaaataagaggcatccaaatcagcaaggaagaagtagca cattttctatttggaactgacatgatgtgctctataagaaacatgaaagactcccttaaaaattgctaga attgatatatgaattCGacaagtcacaatacacagaaatcaatgtacataaatgtattgcatttctatac aCGaatcatgaattaacagagagagaaagtaagggatcaaacccatttacaggttcacaaataccacaag ataccaggaatatacctaaccaaagaagtcaaagacctgtactctaaaggctatgaaatgatgatgaaaa aaatggaagaggacacaaagaaatggaaatacatttcatgttcatggatggcaagaacaaaatactgtta aaatgtctacagtcctcaaaacaatctacacatgtaatgaaatccctatcacactaacaaaaacatttgt cacagaaatggaacaaataatctcaaaatgtgtatggaatgacaaaagtccccaaacagccaaaacaaac ttgaagaagaaaagcaaagctggagacatcacaatcccagactttaggttatattacaaagctgtactga tcagaacagtatggtactggcaaaacaacaacaacaacaacaacaacacacagaggcagagatcaataga atagaaacccagaaatgaactcacacctgtatggtcaattaattctcaacaaagcaggaaagaatatcca atggaaaaaaaaaaaaaaagatagtcttgggacacatggatgtctcagtcaccaaagtgtgtgattgtgg attcagctcaggtcatgatctcagggcagtgcagagcatgCGtgggattctctctctccatttctctctg cccctcttttgcatgctctctctctctcaaaaataaacacataaacctaaaaaaaaaaacctcctcaaca tatggttttgaaaaaactggacagcaacctgcaagacaaaacaacaaCGgaccactttcttacaacatac acaaaaataaatccaacatggataaagacctatgtgtgaaacctgaaagcataaaaatcccagaggataa Simulate 100 sequences with the same length as lab07.fasta using your Markov model generated from lab07.fasta. What is the mean and standard deviation of the number of occurrences of 'CpG' in the simulated sequences. They should be very similar to the observed values, which would indicate the model adequately simulates the observed CpG frequency.

Recomendados

it must give every word aloneand Root disables it Stemming is th.pdf
it must give every word aloneand Root disables it Stemming is th.pdfit must give every word aloneand Root disables it Stemming is th.pdf
it must give every word aloneand Root disables it Stemming is th.pdfaggarwalenterprisesf
 
Introducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdf
Introducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdfIntroducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdf
Introducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdfaggarwalenterprisesf
 
Insert the correct words into the blanks in the textThe protein.pdf
Insert the correct words into the blanks in the textThe protein.pdfInsert the correct words into the blanks in the textThe protein.pdf
Insert the correct words into the blanks in the textThe protein.pdfaggarwalenterprisesf
 
It is currently January 2011 and the futures price for June WTI cru.pdf
It is currently January 2011 and the futures price for June WTI cru.pdfIt is currently January 2011 and the futures price for June WTI cru.pdf
It is currently January 2011 and the futures price for June WTI cru.pdfaggarwalenterprisesf
 
It has been estimated that only about 30 of California residents ha.pdf
It has been estimated that only about 30 of California residents ha.pdfIt has been estimated that only about 30 of California residents ha.pdf
It has been estimated that only about 30 of California residents ha.pdfaggarwalenterprisesf
 
Irkanias aggregate Irkanias aggregate expenditures function is sho.pdf
Irkanias aggregate Irkanias aggregate expenditures function is sho.pdfIrkanias aggregate Irkanias aggregate expenditures function is sho.pdf
Irkanias aggregate Irkanias aggregate expenditures function is sho.pdfaggarwalenterprisesf
 
Irene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdf
Irene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdfIrene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdf
Irene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdfaggarwalenterprisesf
 
Issue the commandscript BackupCommandsThis command will record .pdf
Issue the commandscript BackupCommandsThis command will record .pdfIssue the commandscript BackupCommandsThis command will record .pdf
Issue the commandscript BackupCommandsThis command will record .pdfaggarwalenterprisesf
 

Recomendados

it must give every word aloneand Root disables it Stemming is th.pdf
it must give every word aloneand Root disables it Stemming is th.pdfit must give every word aloneand Root disables it Stemming is th.pdf
it must give every word aloneand Root disables it Stemming is th.pdfaggarwalenterprisesf
 
Introducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdf
Introducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdfIntroducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdf
Introducci�n al paciente Eva Madison es una ni�a cauc�sica de 5 .pdfaggarwalenterprisesf
 
Insert the correct words into the blanks in the textThe protein.pdf
Insert the correct words into the blanks in the textThe protein.pdfInsert the correct words into the blanks in the textThe protein.pdf
Insert the correct words into the blanks in the textThe protein.pdfaggarwalenterprisesf
 
It is currently January 2011 and the futures price for June WTI cru.pdf
It is currently January 2011 and the futures price for June WTI cru.pdfIt is currently January 2011 and the futures price for June WTI cru.pdf
It is currently January 2011 and the futures price for June WTI cru.pdfaggarwalenterprisesf
 
It has been estimated that only about 30 of California residents ha.pdf
It has been estimated that only about 30 of California residents ha.pdfIt has been estimated that only about 30 of California residents ha.pdf
It has been estimated that only about 30 of California residents ha.pdfaggarwalenterprisesf
 
Irkanias aggregate Irkanias aggregate expenditures function is sho.pdf
Irkanias aggregate Irkanias aggregate expenditures function is sho.pdfIrkanias aggregate Irkanias aggregate expenditures function is sho.pdf
Irkanias aggregate Irkanias aggregate expenditures function is sho.pdfaggarwalenterprisesf
 
Irene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdf
Irene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdfIrene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdf
Irene, yerel bir kolejdeki �renciler hakknda bilgi topluyor. te topl.pdfaggarwalenterprisesf
 
Issue the commandscript BackupCommandsThis command will record .pdf
Issue the commandscript BackupCommandsThis command will record .pdfIssue the commandscript BackupCommandsThis command will record .pdf
Issue the commandscript BackupCommandsThis command will record .pdfaggarwalenterprisesf
 
irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdf
irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdfirket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdf
irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdfaggarwalenterprisesf
 
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdf
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdfInvestigue Halcones de cola roja usando la enciclopedia en l�nea All.pdf
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdfaggarwalenterprisesf
 
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdf
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdfIntroducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdf
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdfaggarwalenterprisesf
 
Introducci�n El vocabulario, como una de las �reas de conocimient.pdf
Introducci�n El vocabulario, como una de las �reas de conocimient.pdfIntroducci�n El vocabulario, como una de las �reas de conocimient.pdf
Introducci�n El vocabulario, como una de las �reas de conocimient.pdfaggarwalenterprisesf
 
Internet providers can be considered a monopoly where consumers have.pdf
Internet providers can be considered a monopoly where consumers have.pdfInternet providers can be considered a monopoly where consumers have.pdf
Internet providers can be considered a monopoly where consumers have.pdfaggarwalenterprisesf
 
Instructions The paper should be in APA format with 3-4 pages doubl.pdf
Instructions The paper should be in APA format with 3-4 pages doubl.pdfInstructions The paper should be in APA format with 3-4 pages doubl.pdf
Instructions The paper should be in APA format with 3-4 pages doubl.pdfaggarwalenterprisesf
 
InstructionsAssume that your class group has been selected and hir.pdf
InstructionsAssume that your class group has been selected and hir.pdfInstructionsAssume that your class group has been selected and hir.pdf
InstructionsAssume that your class group has been selected and hir.pdfaggarwalenterprisesf
 
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdf
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdfInstrucciones Imagine que forma parte de un equipo de investigaci�.pdf
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdfaggarwalenterprisesf
 
In what way are the emerging trends of working couples, lower birthr.pdf
In what way are the emerging trends of working couples, lower birthr.pdfIn what way are the emerging trends of working couples, lower birthr.pdf
In what way are the emerging trends of working couples, lower birthr.pdfaggarwalenterprisesf
 
In this assignment, you examine the Supreme Court case of Terry v. O.pdf
In this assignment, you examine the Supreme Court case of Terry v. O.pdfIn this assignment, you examine the Supreme Court case of Terry v. O.pdf
In this assignment, you examine the Supreme Court case of Terry v. O.pdfaggarwalenterprisesf
 
In the SS partnership (to which Fozzie seeks admittance), the capita.pdf
In the SS partnership (to which Fozzie seeks admittance), the capita.pdfIn the SS partnership (to which Fozzie seeks admittance), the capita.pdf
In the SS partnership (to which Fozzie seeks admittance), the capita.pdfaggarwalenterprisesf
 
IN PYTHONCreate your own list of random integers, do not use r.pdf
IN PYTHONCreate your own list of random integers, do not use r.pdfIN PYTHONCreate your own list of random integers, do not use r.pdf
IN PYTHONCreate your own list of random integers, do not use r.pdfaggarwalenterprisesf
 
In relation to your focal organization� the company is Apple.Apply.pdf
In relation to your focal organization� the company is Apple.Apply.pdfIn relation to your focal organization� the company is Apple.Apply.pdf
In relation to your focal organization� the company is Apple.Apply.pdfaggarwalenterprisesf
 
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdf
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdfIn 2022, Jasmine and Thomas, a married couple, had taxable income of.pdf
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdfaggarwalenterprisesf
 
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdf
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdfIn 2020, Caterpillar Incorporated had about 540 million shares outst.pdf
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdfaggarwalenterprisesf
 
In essay format and integrating evidence from the course readings, d.pdf
In essay format and integrating evidence from the course readings, d.pdfIn essay format and integrating evidence from the course readings, d.pdf
In essay format and integrating evidence from the course readings, d.pdfaggarwalenterprisesf
 
In his book The Age of Turbluence, Alan Greenspan explained the con.pdf
In his book The Age of Turbluence, Alan Greenspan explained the con.pdfIn his book The Age of Turbluence, Alan Greenspan explained the con.pdf
In his book The Age of Turbluence, Alan Greenspan explained the con.pdfaggarwalenterprisesf
 
In C#, visual studio, I want no more text boxes added, I have button.pdf
In C#, visual studio, I want no more text boxes added, I have button.pdfIn C#, visual studio, I want no more text boxes added, I have button.pdf
In C#, visual studio, I want no more text boxes added, I have button.pdfaggarwalenterprisesf
 
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdf
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdfIn 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdf
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdfaggarwalenterprisesf
 
In Bangladesh, where labor is relatively abundant, bricks are produ.pdf
In Bangladesh, where labor is relatively abundant, bricks are produ.pdfIn Bangladesh, where labor is relatively abundant, bricks are produ.pdf
In Bangladesh, where labor is relatively abundant, bricks are produ.pdfaggarwalenterprisesf
 
PSYCHIATRIC History collection FORMAT.pptx
PSYCHIATRIC History collection FORMAT.pptxPSYCHIATRIC History collection FORMAT.pptx
PSYCHIATRIC History collection FORMAT.pptxPoojaSen20
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Sapana Sha
 

Más contenido relacionado

Más de aggarwalenterprisesf

irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdf
irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdfirket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdf
irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdfaggarwalenterprisesf
 
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdf
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdfInvestigue Halcones de cola roja usando la enciclopedia en l�nea All.pdf
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdfaggarwalenterprisesf
 
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdf
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdfIntroducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdf
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdfaggarwalenterprisesf
 
Introducci�n El vocabulario, como una de las �reas de conocimient.pdf
Introducci�n El vocabulario, como una de las �reas de conocimient.pdfIntroducci�n El vocabulario, como una de las �reas de conocimient.pdf
Introducci�n El vocabulario, como una de las �reas de conocimient.pdfaggarwalenterprisesf
 
Internet providers can be considered a monopoly where consumers have.pdf
Internet providers can be considered a monopoly where consumers have.pdfInternet providers can be considered a monopoly where consumers have.pdf
Internet providers can be considered a monopoly where consumers have.pdfaggarwalenterprisesf
 
Instructions The paper should be in APA format with 3-4 pages doubl.pdf
Instructions The paper should be in APA format with 3-4 pages doubl.pdfInstructions The paper should be in APA format with 3-4 pages doubl.pdf
Instructions The paper should be in APA format with 3-4 pages doubl.pdfaggarwalenterprisesf
 
InstructionsAssume that your class group has been selected and hir.pdf
InstructionsAssume that your class group has been selected and hir.pdfInstructionsAssume that your class group has been selected and hir.pdf
InstructionsAssume that your class group has been selected and hir.pdfaggarwalenterprisesf
 
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdf
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdfInstrucciones Imagine que forma parte de un equipo de investigaci�.pdf
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdfaggarwalenterprisesf
 
In what way are the emerging trends of working couples, lower birthr.pdf
In what way are the emerging trends of working couples, lower birthr.pdfIn what way are the emerging trends of working couples, lower birthr.pdf
In what way are the emerging trends of working couples, lower birthr.pdfaggarwalenterprisesf
 
In this assignment, you examine the Supreme Court case of Terry v. O.pdf
In this assignment, you examine the Supreme Court case of Terry v. O.pdfIn this assignment, you examine the Supreme Court case of Terry v. O.pdf
In this assignment, you examine the Supreme Court case of Terry v. O.pdfaggarwalenterprisesf
 
In the SS partnership (to which Fozzie seeks admittance), the capita.pdf
In the SS partnership (to which Fozzie seeks admittance), the capita.pdfIn the SS partnership (to which Fozzie seeks admittance), the capita.pdf
In the SS partnership (to which Fozzie seeks admittance), the capita.pdfaggarwalenterprisesf
 
IN PYTHONCreate your own list of random integers, do not use r.pdf
IN PYTHONCreate your own list of random integers, do not use r.pdfIN PYTHONCreate your own list of random integers, do not use r.pdf
IN PYTHONCreate your own list of random integers, do not use r.pdfaggarwalenterprisesf
 
In relation to your focal organization� the company is Apple.Apply.pdf
In relation to your focal organization� the company is Apple.Apply.pdfIn relation to your focal organization� the company is Apple.Apply.pdf
In relation to your focal organization� the company is Apple.Apply.pdfaggarwalenterprisesf
 
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdf
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdfIn 2022, Jasmine and Thomas, a married couple, had taxable income of.pdf
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdfaggarwalenterprisesf
 
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdf
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdfIn 2020, Caterpillar Incorporated had about 540 million shares outst.pdf
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdfaggarwalenterprisesf
 
In essay format and integrating evidence from the course readings, d.pdf
In essay format and integrating evidence from the course readings, d.pdfIn essay format and integrating evidence from the course readings, d.pdf
In essay format and integrating evidence from the course readings, d.pdfaggarwalenterprisesf
 
In his book The Age of Turbluence, Alan Greenspan explained the con.pdf
In his book The Age of Turbluence, Alan Greenspan explained the con.pdfIn his book The Age of Turbluence, Alan Greenspan explained the con.pdf
In his book The Age of Turbluence, Alan Greenspan explained the con.pdfaggarwalenterprisesf
 
In C#, visual studio, I want no more text boxes added, I have button.pdf
In C#, visual studio, I want no more text boxes added, I have button.pdfIn C#, visual studio, I want no more text boxes added, I have button.pdf
In C#, visual studio, I want no more text boxes added, I have button.pdfaggarwalenterprisesf
 
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdf
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdfIn 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdf
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdfaggarwalenterprisesf
 
In Bangladesh, where labor is relatively abundant, bricks are produ.pdf
In Bangladesh, where labor is relatively abundant, bricks are produ.pdfIn Bangladesh, where labor is relatively abundant, bricks are produ.pdf
In Bangladesh, where labor is relatively abundant, bricks are produ.pdfaggarwalenterprisesf
 

Más de aggarwalenterprisesf (20)

irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdf
irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdfirket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdf
irket bakan, �ou posta yoluyla ve dierleri irketin intraneti araclyl.pdf
 
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdf
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdfInvestigue Halcones de cola roja usando la enciclopedia en l�nea All.pdf
Investigue Halcones de cola roja usando la enciclopedia en l�nea All.pdf
 
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdf
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdfIntroducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdf
Introducci�nCochinillas En el ejercicio de hoy, utilizaremos el.pdf
 
Introducci�n El vocabulario, como una de las �reas de conocimient.pdf
Introducci�n El vocabulario, como una de las �reas de conocimient.pdfIntroducci�n El vocabulario, como una de las �reas de conocimient.pdf
Introducci�n El vocabulario, como una de las �reas de conocimient.pdf
 
Internet providers can be considered a monopoly where consumers have.pdf
Internet providers can be considered a monopoly where consumers have.pdfInternet providers can be considered a monopoly where consumers have.pdf
Internet providers can be considered a monopoly where consumers have.pdf
 
Instructions The paper should be in APA format with 3-4 pages doubl.pdf
Instructions The paper should be in APA format with 3-4 pages doubl.pdfInstructions The paper should be in APA format with 3-4 pages doubl.pdf
Instructions The paper should be in APA format with 3-4 pages doubl.pdf
 
InstructionsAssume that your class group has been selected and hir.pdf
InstructionsAssume that your class group has been selected and hir.pdfInstructionsAssume that your class group has been selected and hir.pdf
InstructionsAssume that your class group has been selected and hir.pdf
 
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdf
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdfInstrucciones Imagine que forma parte de un equipo de investigaci�.pdf
Instrucciones Imagine que forma parte de un equipo de investigaci�.pdf
 
In what way are the emerging trends of working couples, lower birthr.pdf
In what way are the emerging trends of working couples, lower birthr.pdfIn what way are the emerging trends of working couples, lower birthr.pdf
In what way are the emerging trends of working couples, lower birthr.pdf
 
In this assignment, you examine the Supreme Court case of Terry v. O.pdf
In this assignment, you examine the Supreme Court case of Terry v. O.pdfIn this assignment, you examine the Supreme Court case of Terry v. O.pdf
In this assignment, you examine the Supreme Court case of Terry v. O.pdf
 
In the SS partnership (to which Fozzie seeks admittance), the capita.pdf
In the SS partnership (to which Fozzie seeks admittance), the capita.pdfIn the SS partnership (to which Fozzie seeks admittance), the capita.pdf
In the SS partnership (to which Fozzie seeks admittance), the capita.pdf
 
IN PYTHONCreate your own list of random integers, do not use r.pdf
IN PYTHONCreate your own list of random integers, do not use r.pdfIN PYTHONCreate your own list of random integers, do not use r.pdf
IN PYTHONCreate your own list of random integers, do not use r.pdf
 
In relation to your focal organization� the company is Apple.Apply.pdf
In relation to your focal organization� the company is Apple.Apply.pdfIn relation to your focal organization� the company is Apple.Apply.pdf
In relation to your focal organization� the company is Apple.Apply.pdf
 
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdf
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdfIn 2022, Jasmine and Thomas, a married couple, had taxable income of.pdf
In 2022, Jasmine and Thomas, a married couple, had taxable income of.pdf
 
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdf
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdfIn 2020, Caterpillar Incorporated had about 540 million shares outst.pdf
In 2020, Caterpillar Incorporated had about 540 million shares outst.pdf
 
In essay format and integrating evidence from the course readings, d.pdf
In essay format and integrating evidence from the course readings, d.pdfIn essay format and integrating evidence from the course readings, d.pdf
In essay format and integrating evidence from the course readings, d.pdf
 
In his book The Age of Turbluence, Alan Greenspan explained the con.pdf
In his book The Age of Turbluence, Alan Greenspan explained the con.pdfIn his book The Age of Turbluence, Alan Greenspan explained the con.pdf
In his book The Age of Turbluence, Alan Greenspan explained the con.pdf
 
In C#, visual studio, I want no more text boxes added, I have button.pdf
In C#, visual studio, I want no more text boxes added, I have button.pdfIn C#, visual studio, I want no more text boxes added, I have button.pdf
In C#, visual studio, I want no more text boxes added, I have button.pdf
 
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdf
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdfIn 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdf
In 2016, the Pew Research Center conducted a survey of 1,004 Canadia.pdf
 
In Bangladesh, where labor is relatively abundant, bricks are produ.pdf
In Bangladesh, where labor is relatively abundant, bricks are produ.pdfIn Bangladesh, where labor is relatively abundant, bricks are produ.pdf
In Bangladesh, where labor is relatively abundant, bricks are produ.pdf
 

Último

PSYCHIATRIC History collection FORMAT.pptx
PSYCHIATRIC History collection FORMAT.pptxPSYCHIATRIC History collection FORMAT.pptx
PSYCHIATRIC History collection FORMAT.pptxPoojaSen20
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Sapana Sha
 
Micromeritics - Fundamental and Derived Properties of Powders
Micromeritics - Fundamental and Derived Properties of PowdersMicromeritics - Fundamental and Derived Properties of Powders
Micromeritics - Fundamental and Derived Properties of PowdersChitralekhaTherkar
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxiammrhaywood
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introductionMaksud Ahmed
 
Mastering the Unannounced Regulatory Inspection
Mastering the Unannounced Regulatory InspectionMastering the Unannounced Regulatory Inspection
Mastering the Unannounced Regulatory InspectionSafetyChain Software
 
The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13Steve Thomason
 
CARE OF CHILD IN INCUBATOR..........pptx
CARE OF CHILD IN INCUBATOR..........pptxCARE OF CHILD IN INCUBATOR..........pptx
CARE OF CHILD IN INCUBATOR..........pptxGaneshChakor2
 
Introduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptxIntroduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptxpboyjonauth
 
How to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptxHow to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptxmanuelaromero2013
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformChameera Dedduwage
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Krashi Coaching
 
Introduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher EducationIntroduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher Educationpboyjonauth
 
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17Celine George
 
Crayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon ACrayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon AUnboundStockton
 
Solving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxSolving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxOH TEIK BIN
 
_Math 4-Q4 Week 5.pptx Steps in Collecting Data
_Math 4-Q4 Week 5.pptx Steps in Collecting Data_Math 4-Q4 Week 5.pptx Steps in Collecting Data
_Math 4-Q4 Week 5.pptx Steps in Collecting DataJhengPantaleon
 

Último (20)

PSYCHIATRIC History collection FORMAT.pptx
PSYCHIATRIC History collection FORMAT.pptxPSYCHIATRIC History collection FORMAT.pptx
PSYCHIATRIC History collection FORMAT.pptx
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
 
Micromeritics - Fundamental and Derived Properties of Powders
Micromeritics - Fundamental and Derived Properties of PowdersMicromeritics - Fundamental and Derived Properties of Powders
Micromeritics - Fundamental and Derived Properties of Powders
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introduction
 
Mastering the Unannounced Regulatory Inspection
Mastering the Unannounced Regulatory InspectionMastering the Unannounced Regulatory Inspection
Mastering the Unannounced Regulatory Inspection
 
The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13The Most Excellent Way | 1 Corinthians 13
The Most Excellent Way | 1 Corinthians 13
 
CARE OF CHILD IN INCUBATOR..........pptx
CARE OF CHILD IN INCUBATOR..........pptxCARE OF CHILD IN INCUBATOR..........pptx
CARE OF CHILD IN INCUBATOR..........pptx
 
Introduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptxIntroduction to AI in Higher Education_draft.pptx
Introduction to AI in Higher Education_draft.pptx
 
How to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptxHow to Make a Pirate ship Primary Education.pptx
How to Make a Pirate ship Primary Education.pptx
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy Reform
 
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
Model Call Girl in Bikash Puri Delhi reach out to us at 🔝9953056974🔝
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
 
Introduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher EducationIntroduction to ArtificiaI Intelligence in Higher Education
Introduction to ArtificiaI Intelligence in Higher Education
 
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
Incoming and Outgoing Shipments in 1 STEP Using Odoo 17
 
Crayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon ACrayon Activity Handout For the Crayon A
Crayon Activity Handout For the Crayon A
 
Solving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptxSolving Puzzles Benefits Everyone (English).pptx
Solving Puzzles Benefits Everyone (English).pptx
 
_Math 4-Q4 Week 5.pptx Steps in Collecting Data
_Math 4-Q4 Week 5.pptx Steps in Collecting Data_Math 4-Q4 Week 5.pptx Steps in Collecting Data
_Math 4-Q4 Week 5.pptx Steps in Collecting Data
 

Simulated CpG frequency from lab07 Markov model

  • 1. Inside lab07.fasta, here is the sequence: >lab07 ttatgtactctaaggaaagaaataaacatttaaaaaaatgttgaaaaaattttaaataaaactgcatacc aatagcctgatgagtatgtatgcCGaaattctcattaaaataccttcaaattaaagtcaacaatacatta atagaatcatttaccataatcaagtgggatatatccctggcttcaagggtggtaccacattcacagatca atcaacatgatgcaccacagtaatagaagaaaggataagaacaatatgatgctttcaacagatgcaggaa aaccatttgacaaaatgtcacatccattcatgataaaaaCGctcagcaaagtacattgagactcaaccta cctgcacataataaaagtcatctaggaaaaacccacagctaatctcatcctcaatggggaaaaattgaaa gttgttcctccaaggtcagggacaagacagggatgacccctctcaccactgttattcacatagtaCGgga aatcctagccacagcaatcagacaacaaaaagaaataagaggcatccaaatcagcaaggaagaagtagca cattttctatttggaactgacatgatgtgctctataagaaacatgaaagactcccttaaaaattgctaga attgatatatgaattCGacaagtcacaatacacagaaatcaatgtacataaatgtattgcatttctatac aCGaatcatgaattaacagagagagaaagtaagggatcaaacccatttacaggttcacaaataccacaag ataccaggaatatacctaaccaaagaagtcaaagacctgtactctaaaggctatgaaatgatgatgaaaa aaatggaagaggacacaaagaaatggaaatacatttcatgttcatggatggcaagaacaaaatactgtta aaatgtctacagtcctcaaaacaatctacacatgtaatgaaatccctatcacactaacaaaaacatttgt cacagaaatggaacaaataatctcaaaatgtgtatggaatgacaaaagtccccaaacagccaaaacaaac ttgaagaagaaaagcaaagctggagacatcacaatcccagactttaggttatattacaaagctgtactga tcagaacagtatggtactggcaaaacaacaacaacaacaacaacaacacacagaggcagagatcaataga atagaaacccagaaatgaactcacacctgtatggtcaattaattctcaacaaagcaggaaagaatatcca atggaaaaaaaaaaaaaaagatagtcttgggacacatggatgtctcagtcaccaaagtgtgtgattgtgg attcagctcaggtcatgatctcagggcagtgcagagcatgCGtgggattctctctctccatttctctctg cccctcttttgcatgctctctctctctcaaaaataaacacataaacctaaaaaaaaaaacctcctcaaca tatggttttgaaaaaactggacagcaacctgcaagacaaaacaacaaCGgaccactttcttacaacatac acaaaaataaatccaacatggataaagacctatgtgtgaaacctgaaagcataaaaatcccagaggataa Simulate 100 sequences with the same length as lab07.fasta using your Markov model generated from lab07.fasta. What is the mean and standard deviation of the number of occurrences of 'CpG' in the simulated sequences. They should be very similar to the observed values, which would indicate the model adequately simulates the observed CpG frequency.