SlideShare una empresa de Scribd logo

Remembering how base pairing occurs, and remembering that RNA can ba.pdf

•
•
A
alertshoeshingkimand

Remembering how base pairing occurs, and remembering that RNA can base pair, consider the following sequence of RNA. Do you expect it to adopt any preferred structure, and, if so, draw that structure. Hints: (1) Start by looking for long runs of bases to match up. (2) Stems require 6-8 base pairs of duplex structure to be stable. (3) There can be more than one stem-loop. 5- AUAUAGCCCGGGAUGCCCGCUGGGGGGCCCCCGUUAGGGGGCCCCCCAGACGGCA CCCGGGCUAGCG-3.

Educación
1 de 1
Descargar para leer sin conexión
Remembering how base pairing occurs, and remembering that RNA can base pair, consider the following sequence of RNA. Do you expect it to adopt any preferred structure, and, if so, draw that structure. Hints: (1) Start by looking for long runs of bases to match up. (2) Stems require 6-8 base pairs of duplex structure to be stable. (3) There can be more than one stem-loop. 5- AUAUAGCCCGGGAUGCCCGCUGGGGGGCCCCCGUUAGGGGGCCCCCCAGACGGCA CCCGGGCUAGCG-3

Recomendados

Ships provide maritime transport services but emit polluting gases s.pdf
Ships provide maritime transport services but emit polluting gases s.pdfShips provide maritime transport services but emit polluting gases s.pdf
Ships provide maritime transport services but emit polluting gases s.pdfalertshoeshingkimand
 
Short essayThe next step in effective argumentation is the ability.pdf
Short essayThe next step in effective argumentation is the ability.pdfShort essayThe next step in effective argumentation is the ability.pdf
Short essayThe next step in effective argumentation is the ability.pdfalertshoeshingkimand
 
Share your results from taking Organizational Culture Assessment Ins.pdf
Share your results from taking Organizational Culture Assessment Ins.pdfShare your results from taking Organizational Culture Assessment Ins.pdf
Share your results from taking Organizational Culture Assessment Ins.pdfalertshoeshingkimand
 
Seth named his wife, Monique, who is age 57, as the sole beneficiary.pdf
Seth named his wife, Monique, who is age 57, as the sole beneficiary.pdfSeth named his wife, Monique, who is age 57, as the sole beneficiary.pdf
Seth named his wife, Monique, who is age 57, as the sole beneficiary.pdfalertshoeshingkimand
 
se�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdf
se�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdfse�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdf
se�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdfalertshoeshingkimand
 
Sessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdf
Sessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdfSessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdf
Sessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdfalertshoeshingkimand
 
Set residents strategy to always defect and invaders strategy to t.pdf
Set residents strategy to always defect and invaders strategy to t.pdfSet residents strategy to always defect and invaders strategy to t.pdf
Set residents strategy to always defect and invaders strategy to t.pdfalertshoeshingkimand
 
SENDER It is a helmet that contains a sensor for gases, vital s.pdf
SENDER It is a helmet that contains a sensor for gases, vital s.pdfSENDER It is a helmet that contains a sensor for gases, vital s.pdf
SENDER It is a helmet that contains a sensor for gases, vital s.pdfalertshoeshingkimand
 

Recomendados

Ships provide maritime transport services but emit polluting gases s.pdf
Ships provide maritime transport services but emit polluting gases s.pdfShips provide maritime transport services but emit polluting gases s.pdf
Ships provide maritime transport services but emit polluting gases s.pdfalertshoeshingkimand
 
Short essayThe next step in effective argumentation is the ability.pdf
Short essayThe next step in effective argumentation is the ability.pdfShort essayThe next step in effective argumentation is the ability.pdf
Short essayThe next step in effective argumentation is the ability.pdfalertshoeshingkimand
 
Share your results from taking Organizational Culture Assessment Ins.pdf
Share your results from taking Organizational Culture Assessment Ins.pdfShare your results from taking Organizational Culture Assessment Ins.pdf
Share your results from taking Organizational Culture Assessment Ins.pdfalertshoeshingkimand
 
Seth named his wife, Monique, who is age 57, as the sole beneficiary.pdf
Seth named his wife, Monique, who is age 57, as the sole beneficiary.pdfSeth named his wife, Monique, who is age 57, as the sole beneficiary.pdf
Seth named his wife, Monique, who is age 57, as the sole beneficiary.pdfalertshoeshingkimand
 
se�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdf
se�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdfse�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdf
se�or. y se�ora Una vez que ambos tienen 62 a�os, presentan una decl.pdfalertshoeshingkimand
 
Sessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdf
Sessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdfSessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdf
Sessizlik, Damgalanma ve Akl Hastal Madeline Halpert ve Eva Rosenfel.pdfalertshoeshingkimand
 
Set residents strategy to always defect and invaders strategy to t.pdf
Set residents strategy to always defect and invaders strategy to t.pdfSet residents strategy to always defect and invaders strategy to t.pdf
Set residents strategy to always defect and invaders strategy to t.pdfalertshoeshingkimand
 
SENDER It is a helmet that contains a sensor for gases, vital s.pdf
SENDER It is a helmet that contains a sensor for gases, vital s.pdfSENDER It is a helmet that contains a sensor for gases, vital s.pdf
SENDER It is a helmet that contains a sensor for gases, vital s.pdfalertshoeshingkimand
 
Service Values1. I build strong relationships and create Ritz-Carl.pdf
Service Values1. I build strong relationships and create Ritz-Carl.pdfService Values1. I build strong relationships and create Ritz-Carl.pdf
Service Values1. I build strong relationships and create Ritz-Carl.pdfalertshoeshingkimand
 
send SERIALWISE with headings In F2021, the charity trained 19,591.pdf
send SERIALWISE with headings In F2021, the charity trained 19,591.pdfsend SERIALWISE with headings In F2021, the charity trained 19,591.pdf
send SERIALWISE with headings In F2021, the charity trained 19,591.pdfalertshoeshingkimand
 
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdf
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdfSeptember 21, 2022Russia�s war against Ukraine is causing tremendo.pdf
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdfalertshoeshingkimand
 
Self-awareness involves being aware of different aspects of the self.pdf
Self-awareness involves being aware of different aspects of the self.pdfSelf-awareness involves being aware of different aspects of the self.pdf
Self-awareness involves being aware of different aspects of the self.pdfalertshoeshingkimand
 
Select one theory from the following categories Sociological Syste.pdf
Select one theory from the following categories Sociological Syste.pdfSelect one theory from the following categories Sociological Syste.pdf
Select one theory from the following categories Sociological Syste.pdfalertshoeshingkimand
 
Select one of the scenarios below and address the following Describ.pdf
Select one of the scenarios below and address the following Describ.pdfSelect one of the scenarios below and address the following Describ.pdf
Select one of the scenarios below and address the following Describ.pdfalertshoeshingkimand
 
Select all correct statements related to the contribution of scienti.pdf
Select all correct statements related to the contribution of scienti.pdfSelect all correct statements related to the contribution of scienti.pdf
Select all correct statements related to the contribution of scienti.pdfalertshoeshingkimand
 
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdf
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdfSeleccione todas las afirmaciones que se aplican al proceso de pre.pdf
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdfalertshoeshingkimand
 
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdf
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdfSeleccione un tema de liderazgo relevante y de actualidad de los med.pdf
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdfalertshoeshingkimand
 
Seleccione el orden correcto para los siguientes eventos clave en la.pdf
Seleccione el orden correcto para los siguientes eventos clave en la.pdfSeleccione el orden correcto para los siguientes eventos clave en la.pdf
Seleccione el orden correcto para los siguientes eventos clave en la.pdfalertshoeshingkimand
 
Security analysis Perform security analysis on your proposed ransom.pdf
Security analysis Perform security analysis on your proposed ransom.pdfSecurity analysis Perform security analysis on your proposed ransom.pdf
Security analysis Perform security analysis on your proposed ransom.pdfalertshoeshingkimand
 
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdf
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdfSe realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdf
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdfalertshoeshingkimand
 
Sean Bedan a senior employee and was fired after he reported how a f.pdf
Sean Bedan a senior employee and was fired after he reported how a f.pdfSean Bedan a senior employee and was fired after he reported how a f.pdf
Sean Bedan a senior employee and was fired after he reported how a f.pdfalertshoeshingkimand
 
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdf
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdfScott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdf
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdfalertshoeshingkimand
 
Scientists in Scotland figured out a novel method to clone cells suc.pdf
Scientists in Scotland figured out a novel method to clone cells suc.pdfScientists in Scotland figured out a novel method to clone cells suc.pdf
Scientists in Scotland figured out a novel method to clone cells suc.pdfalertshoeshingkimand
 
Schedule 13D is filed Group of answer choicesa) by entities that a.pdf
Schedule 13D is filed Group of answer choicesa) by entities that a.pdfSchedule 13D is filed Group of answer choicesa) by entities that a.pdf
Schedule 13D is filed Group of answer choicesa) by entities that a.pdfalertshoeshingkimand
 
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdf
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdfSe aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdf
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdfalertshoeshingkimand
 
Sales during the year were 400 units. Beginning inventory was 150 .pdf
Sales during the year were 400 units. Beginning inventory was 150 .pdfSales during the year were 400 units. Beginning inventory was 150 .pdf
Sales during the year were 400 units. Beginning inventory was 150 .pdfalertshoeshingkimand
 
Saving is...A A sophisticated IOU that documents who owes how muc.pdf
Saving is...A A sophisticated IOU that documents who owes how muc.pdfSaving is...A A sophisticated IOU that documents who owes how muc.pdf
Saving is...A A sophisticated IOU that documents who owes how muc.pdfalertshoeshingkimand
 
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdf
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdfSave backAndForth3.py or backAndForth3Update.py to the new name back.pdf
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdfalertshoeshingkimand
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeThiyagu K
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.pptRamjanShidvankar
 

Más contenido relacionado

Más de alertshoeshingkimand

Service Values1. I build strong relationships and create Ritz-Carl.pdf
Service Values1. I build strong relationships and create Ritz-Carl.pdfService Values1. I build strong relationships and create Ritz-Carl.pdf
Service Values1. I build strong relationships and create Ritz-Carl.pdfalertshoeshingkimand
 
send SERIALWISE with headings In F2021, the charity trained 19,591.pdf
send SERIALWISE with headings In F2021, the charity trained 19,591.pdfsend SERIALWISE with headings In F2021, the charity trained 19,591.pdf
send SERIALWISE with headings In F2021, the charity trained 19,591.pdfalertshoeshingkimand
 
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdf
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdfSeptember 21, 2022Russia�s war against Ukraine is causing tremendo.pdf
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdfalertshoeshingkimand
 
Self-awareness involves being aware of different aspects of the self.pdf
Self-awareness involves being aware of different aspects of the self.pdfSelf-awareness involves being aware of different aspects of the self.pdf
Self-awareness involves being aware of different aspects of the self.pdfalertshoeshingkimand
 
Select one theory from the following categories Sociological Syste.pdf
Select one theory from the following categories Sociological Syste.pdfSelect one theory from the following categories Sociological Syste.pdf
Select one theory from the following categories Sociological Syste.pdfalertshoeshingkimand
 
Select one of the scenarios below and address the following Describ.pdf
Select one of the scenarios below and address the following Describ.pdfSelect one of the scenarios below and address the following Describ.pdf
Select one of the scenarios below and address the following Describ.pdfalertshoeshingkimand
 
Select all correct statements related to the contribution of scienti.pdf
Select all correct statements related to the contribution of scienti.pdfSelect all correct statements related to the contribution of scienti.pdf
Select all correct statements related to the contribution of scienti.pdfalertshoeshingkimand
 
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdf
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdfSeleccione todas las afirmaciones que se aplican al proceso de pre.pdf
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdfalertshoeshingkimand
 
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdf
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdfSeleccione un tema de liderazgo relevante y de actualidad de los med.pdf
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdfalertshoeshingkimand
 
Seleccione el orden correcto para los siguientes eventos clave en la.pdf
Seleccione el orden correcto para los siguientes eventos clave en la.pdfSeleccione el orden correcto para los siguientes eventos clave en la.pdf
Seleccione el orden correcto para los siguientes eventos clave en la.pdfalertshoeshingkimand
 
Security analysis Perform security analysis on your proposed ransom.pdf
Security analysis Perform security analysis on your proposed ransom.pdfSecurity analysis Perform security analysis on your proposed ransom.pdf
Security analysis Perform security analysis on your proposed ransom.pdfalertshoeshingkimand
 
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdf
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdfSe realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdf
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdfalertshoeshingkimand
 
Sean Bedan a senior employee and was fired after he reported how a f.pdf
Sean Bedan a senior employee and was fired after he reported how a f.pdfSean Bedan a senior employee and was fired after he reported how a f.pdf
Sean Bedan a senior employee and was fired after he reported how a f.pdfalertshoeshingkimand
 
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdf
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdfScott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdf
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdfalertshoeshingkimand
 
Scientists in Scotland figured out a novel method to clone cells suc.pdf
Scientists in Scotland figured out a novel method to clone cells suc.pdfScientists in Scotland figured out a novel method to clone cells suc.pdf
Scientists in Scotland figured out a novel method to clone cells suc.pdfalertshoeshingkimand
 
Schedule 13D is filed Group of answer choicesa) by entities that a.pdf
Schedule 13D is filed Group of answer choicesa) by entities that a.pdfSchedule 13D is filed Group of answer choicesa) by entities that a.pdf
Schedule 13D is filed Group of answer choicesa) by entities that a.pdfalertshoeshingkimand
 
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdf
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdfSe aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdf
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdfalertshoeshingkimand
 
Sales during the year were 400 units. Beginning inventory was 150 .pdf
Sales during the year were 400 units. Beginning inventory was 150 .pdfSales during the year were 400 units. Beginning inventory was 150 .pdf
Sales during the year were 400 units. Beginning inventory was 150 .pdfalertshoeshingkimand
 
Saving is...A A sophisticated IOU that documents who owes how muc.pdf
Saving is...A A sophisticated IOU that documents who owes how muc.pdfSaving is...A A sophisticated IOU that documents who owes how muc.pdf
Saving is...A A sophisticated IOU that documents who owes how muc.pdfalertshoeshingkimand
 
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdf
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdfSave backAndForth3.py or backAndForth3Update.py to the new name back.pdf
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdfalertshoeshingkimand
 

Más de alertshoeshingkimand (20)

Service Values1. I build strong relationships and create Ritz-Carl.pdf
Service Values1. I build strong relationships and create Ritz-Carl.pdfService Values1. I build strong relationships and create Ritz-Carl.pdf
Service Values1. I build strong relationships and create Ritz-Carl.pdf
 
send SERIALWISE with headings In F2021, the charity trained 19,591.pdf
send SERIALWISE with headings In F2021, the charity trained 19,591.pdfsend SERIALWISE with headings In F2021, the charity trained 19,591.pdf
send SERIALWISE with headings In F2021, the charity trained 19,591.pdf
 
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdf
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdfSeptember 21, 2022Russia�s war against Ukraine is causing tremendo.pdf
September 21, 2022Russia�s war against Ukraine is causing tremendo.pdf
 
Self-awareness involves being aware of different aspects of the self.pdf
Self-awareness involves being aware of different aspects of the self.pdfSelf-awareness involves being aware of different aspects of the self.pdf
Self-awareness involves being aware of different aspects of the self.pdf
 
Select one theory from the following categories Sociological Syste.pdf
Select one theory from the following categories Sociological Syste.pdfSelect one theory from the following categories Sociological Syste.pdf
Select one theory from the following categories Sociological Syste.pdf
 
Select one of the scenarios below and address the following Describ.pdf
Select one of the scenarios below and address the following Describ.pdfSelect one of the scenarios below and address the following Describ.pdf
Select one of the scenarios below and address the following Describ.pdf
 
Select all correct statements related to the contribution of scienti.pdf
Select all correct statements related to the contribution of scienti.pdfSelect all correct statements related to the contribution of scienti.pdf
Select all correct statements related to the contribution of scienti.pdf
 
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdf
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdfSeleccione todas las afirmaciones que se aplican al proceso de pre.pdf
Seleccione todas las afirmaciones que se aplican al proceso de pre.pdf
 
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdf
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdfSeleccione un tema de liderazgo relevante y de actualidad de los med.pdf
Seleccione un tema de liderazgo relevante y de actualidad de los med.pdf
 
Seleccione el orden correcto para los siguientes eventos clave en la.pdf
Seleccione el orden correcto para los siguientes eventos clave en la.pdfSeleccione el orden correcto para los siguientes eventos clave en la.pdf
Seleccione el orden correcto para los siguientes eventos clave en la.pdf
 
Security analysis Perform security analysis on your proposed ransom.pdf
Security analysis Perform security analysis on your proposed ransom.pdfSecurity analysis Perform security analysis on your proposed ransom.pdf
Security analysis Perform security analysis on your proposed ransom.pdf
 
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdf
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdfSe realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdf
Se realiz� un estudio que muestra que el politetrafluoroetileno (PFO.pdf
 
Sean Bedan a senior employee and was fired after he reported how a f.pdf
Sean Bedan a senior employee and was fired after he reported how a f.pdfSean Bedan a senior employee and was fired after he reported how a f.pdf
Sean Bedan a senior employee and was fired after he reported how a f.pdf
 
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdf
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdfScott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdf
Scott Weisberg siente que su trabajo en Wendys incluye todo lo sigu.pdf
 
Scientists in Scotland figured out a novel method to clone cells suc.pdf
Scientists in Scotland figured out a novel method to clone cells suc.pdfScientists in Scotland figured out a novel method to clone cells suc.pdf
Scientists in Scotland figured out a novel method to clone cells suc.pdf
 
Schedule 13D is filed Group of answer choicesa) by entities that a.pdf
Schedule 13D is filed Group of answer choicesa) by entities that a.pdfSchedule 13D is filed Group of answer choicesa) by entities that a.pdf
Schedule 13D is filed Group of answer choicesa) by entities that a.pdf
 
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdf
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdfSe aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdf
Se aisl� Enterococcus faecalis resistente a la vancomicina de una in.pdf
 
Sales during the year were 400 units. Beginning inventory was 150 .pdf
Sales during the year were 400 units. Beginning inventory was 150 .pdfSales during the year were 400 units. Beginning inventory was 150 .pdf
Sales during the year were 400 units. Beginning inventory was 150 .pdf
 
Saving is...A A sophisticated IOU that documents who owes how muc.pdf
Saving is...A A sophisticated IOU that documents who owes how muc.pdfSaving is...A A sophisticated IOU that documents who owes how muc.pdf
Saving is...A A sophisticated IOU that documents who owes how muc.pdf
 
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdf
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdfSave backAndForth3.py or backAndForth3Update.py to the new name back.pdf
Save backAndForth3.py or backAndForth3Update.py to the new name back.pdf
 

Último

Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeThiyagu K
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.pptRamjanShidvankar
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxAreebaZafar22
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docxpsychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docxPoojaSen20
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxnegromaestrong
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Celine George
 
Unit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptxUnit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptxVishalSingh1417
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
Gardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterGardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterMateoGardella
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxVishalSingh1417
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityGeoBlogs
 
APM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAPM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAssociation for Project Management
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxiammrhaywood
 

Último (20)

Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docxpsychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docx
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
Unit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptxUnit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptx
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Gardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterGardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch Letter
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Advance Mobile Application Development class 07
Advance Mobile Application Development class 07Advance Mobile Application Development class 07
Advance Mobile Application Development class 07
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptx
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activity
 
APM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAPM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across Sectors
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 

Remembering how base pairing occurs, and remembering that RNA can ba.pdf

  • 1. Remembering how base pairing occurs, and remembering that RNA can base pair, consider the following sequence of RNA. Do you expect it to adopt any preferred structure, and, if so, draw that structure. Hints: (1) Start by looking for long runs of bases to match up. (2) Stems require 6-8 base pairs of duplex structure to be stable. (3) There can be more than one stem-loop. 5- AUAUAGCCCGGGAUGCCCGCUGGGGGGCCCCCGUUAGGGGGCCCCCCAGACGGCA CCCGGGCUAGCG-3