Recomendados
Más contenido relacionado
La actualidad más candente
La actualidad más candente (20)
Similar a Types of mutations
Similar a Types of mutations (20)
Último
Último (20)
Types of mutations
- 3. Presented by: Muzhar Ali 4028 Ali raza 4029
- 5. ¤ Introduction of mutations ¤ Types of mutations ¤ Chromosomal mutation ¤ Point mutation ¤ Types of point mutations ¤ Causes of mutations Contents
- 6. What Are Mutations? • Changes in the nucleotide sequence of DNA • May occur in somatic cells (aren’t passed to offspring) • May occur in gametes (eggs & sperm) and be passed to offspring
- 8. Chromosome Mutations • May Involve: • Changing in the number of chromosomes Lose or se gain of chromosomes e.g. • Down’s syndrome . • Change in the structure of chromosomes –gfgfgfggfgfgfgfghgfgvggfff
- 9. Chromosome Mutations • Down Syndrome – Chromosome 21 does not separate correctly. – They have 47 chromosomes in stead of 46. – Children with Down Syndrome develop slower, may have heart and stomach illnesses and vary greatly in their degree of inteligence.
- 10. Chromosome Mutations • Due to change in structure. –Deletion –Inversion –Translocation –Nondisjunction –Duplication
- 13. Point Mutation • Change of a single nucleotide • Includes the deletion, insertion, or substitution of ONE nucleotide in a gene
- 14. –Point Mutations – Base Substitution –Silent mutation – Sense mutation –Nonsense mutation
- 15. Mutations: Substitutions Substitution mutation GGTCACCTCACGCCA ↓ CCAGUGGAGUGCGGU ↓ Pro-Arg-Glu-Cys-Gly Substitutions will only affect a single codon Their effects may not be serious unless they affect an amino acid that is essential for the structure and function of the finished protein molecule (e.g. sickle cell anaemia) Normal gene GGTCTCCTCACGCCA ↓ CCAGAGGAGUGCGGU Codons ↓ Pro-Glu-Glu-Cys-Gly Amino acids © 2010 Paul Billiet ODWS
- 17. Point Mutations • Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop
- 19. Point Mutation • Sickle Cell disease is the result of one nucleotide substitution • Occurs in the hemoglobin gene
- 21. Fig 4.4
- 22. Point Mutations • Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop
- 23. Sickle cell anemia • Hemoglobin protein in red blood cells – strikes 1 out of 400 African Americans – limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
- 24. Point Mutations • Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop Really destroyed that protein!
- 26. Frameshift Mutations • Add or delete one or more bases – changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!
- 27. Frameshift Mutations • Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA
- 28. Frameshift Mutations • Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA
- 30. Causes of Mutations • Chemical cause the mutations are called Mutagens. like • Ionizing radiation • Alpha, beta, gamma and cosmic rays. • Nonionizing radiation • Uv light, • Chemical mutagens • Nitrous acid, Hydroxylamine
- 31. Example of chemical mutations 30/10/2015 Mrs Smith: Ch13: Mutations an Chromosomal Abnormalities 31