SlideShare una empresa de Scribd logo
1 de 7
Descargar para leer sin conexión
Department of Biochemistry and Molecular Biology
University of Dhaka
MS Practical
Bioinformatics Practical Note
Submitted by
Md. Atai rabby
MS
Biochemistry and Molecular Biology
Restriction Mapping
Tool : Restriction Mapper 3.0
Sequence : Pyruvate Kinase, Vibrio cholera O395
Name: Pyruvate Kinase
Conformation: linear
Overhang: five_prime, three_prime, blunt
Minimum Site Length: 4 bases
Maximum Number of Cuts: all
Included: all commercial, prototypes only
Noncutters: AarI, AatII, AbsI, AclI, AcyI, AflII, AjuI, AlfI, AloI, AlwNI, ApaI, AscI, AsuII, AvaI, BaeI,
BamHI, BarI, BbvCI, BdaI, BglI, BglII, BplI, Bpu10I, BsaXI, BsePI, BseRI, BsmI, Bsp1407I, BspHI,
BsrBI, BsrDI, BstEII, BstXI, BtgZI, ClaI, CspCI, DraII, DraIII, DrdI, Eam1105I, EciI, Eco31I, EcoNI,
EcoRI, EcoRV, FalI, FseI, FspAI, GsuI, HaeIV, Hin4I, HindIII, KpnI, MauBI, MfeI, MluI, NaeI, NarI,
NcoI, NdeI, NheI, NlaIV, NmeAIII, NotI, NruI, NspI, PacI, PasI, PflMI, PfoI, PmeI, PpiI, PpuMI, PsiI, PI-
PspI, PspXI, PsrI, PstI, PvuI, PvuII, RsrII, SacI, SacII, SalI, SanDI, SapI, PI-SceI, SexAI, SfiI, SgfI, SgrAI,
SgrDI, SmaI, SpeI, SphI, SrfI, Sse8387I, SspI, StuI, SwaI, TaqII, TauI, TstI, Tth111I, VspI, XbaI, XcmI,
XhoI, XmnI
Name Sequence
Site
Length
Overhang Frequency Cut Positions
BalI TGGCCA 6 blunt 1 263
Eco47III AGCGCT 6 blunt 1 506
SnaBI TACGTA 6 blunt 1 1057
AflIII ACRYGT 6 five_prime 1 1401
Hpy99I CGWCG 5 three_prime 3 382, 834, 892
MboII GAAGA 5 three_prime 3 762, 772, 987
ArsI GACNNNNNNTTYG 7 three_prime 4 28, 60, 520, 552
NlaIII CATG 4 three_prime 4 84, 723, 909, 984
TspGWI ACGGA 5 three_prime 4 139, 205, 571, 598
AluI AGCT 4 blunt 5 66, 228, 622, 705, 1219
AciI CCGC 4 five_prime 5 632, 883, 970, 1094, 1138
TspRI CASTG 5 three_prime 7 417, 423, 1068, 1121, 1281, 1370,
Name Sequence
Site
Length
Overhang Frequency Cut Positions
1395
FaiI YATR 4 blunt 8 21, 82, 91, 388, 721, 907, 982, 1074
GlaI GCGC 4 blunt 8
313, 450, 506, 876, 986, 1112, 1310,
1362
MaeII ACGT 4 five_prime 10
119, 353, 596, 729, 810, 864, 890,
1050, 1056, 1403
CviJI RGCY 4 blunt 12
32, 66, 228, 263, 622, 677, 705,
1046, 1069, 1180, 1219, 1322
SetI ASST 4 three_prime 28
68, 122, 207, 230, 350, 356, 471,
479, 533, 591, 599, 624, 707, 732,
740, 744, 813, 867, 893, 954, 1053,
1059, 1083, 1221, 1242, 1295, 1299,
1406
Discussion
From the analysis we can come to following analysis
1. There are many cutting sites for our sequence by commercially available Restriction enzyme
2. Some enzymes do not have any cutting site in the sequence
3. Many of the enzymes here are frequent cutter(4 cutter)
4. SetI have highest cutting sites in this sequence
5. BalI, Sna BI is not suitable for plasmis construction as they produce blunt overhang.
Finding Open Reading Frame
Tool : ORF finder
pyruvate kinase : Vibrio cholerae O395
Discussion
NCBI ORF finder produce six possible reading frames, we cheched each reading frames and blast
them with nr nucleotide database which ultimately proof that the first ORF with length 1413 is the
best match ORF
Multiple Sequence Alignment
Tool : Clustalw
Algorithm : Clustal W
Discussion
ClustalW alignment could be now use to find conseve regions, bulding phylogenetic analysis,
calculating conservancy or divergency, finding domains etc.
Making Phylogenetic tree from a Multiple Alignment
Tool : clustalW
Method: Neighbour Joining Method
Discussion
We used four strain of vibrio cholerae and their two type of Pyruvate Kinase Product in this
analysis.
The following decision could be made from the tree
1. The tree is devided into three clades
2. First clade contains only Pyruvate kinase II enzyme group of four Vibrio strain
3. The third clade contain only Pyruvate kinase enzyme group of four Vibrio strain
4. Pyruvate Kinase and Pyruvate kinase II evolve differently in vibrio cholerae srtarin
Primer Designing
Tool : Primer 3, IDT Olig Analyzer
Found Primer 1 LEFT PRIMER : GGTAACAAAGAGCGCGTAGC
RIGHT PRIMER: CGCTTCAGTTGCTACGATGA
PRODUCT SIZE: 84
2 LEFT PRIMER : CGGTGACTACGTTGAACACG
RIGHT PRIMER: GTCGCCGTGATAACCACTTT
PRODUCT SIZE: 723
3 LEFT PRIMER : ATGGAAGTACTGGCGACCAC
RIGHT PRIMER: TTCTTGTTGGTGGTGACTGC
PRODUCT SIZE: 818
4 LEFT PRIMER : TTGAACACGGCACTCGTATC
RIGHT PRIMER: GTCGCCGTGATAACCACTTT
PRODUCT SIZE: 712
Features of First Primer LENGTH:20
GC CONTENT:55.0
%MELT TEMP:56.4 ºC
MOLECULAR
WEIGHT:6200.1 g/mole
EXTINCTION COEFFICIENT:205600L/(mole·cm)
nmole/OD260:4.86
µg/OD260:30.16
Hairpin Ananlysis
[ Value of ΔG and Hairpin indicating
the primer as poor candidate ]
ΔG (kcal.mole-1
) : -1.16
Hetero dimer
[Value of ΔG indicating Low
possibility of Hetero dimer formation ]
ΔG = -8.35 kcal/mole, -6.75 kcal/mole, -4.74 kcal/mole

Más contenido relacionado

Destacado

Foursquare for business
Foursquare for businessFoursquare for business
Foursquare for business
David Rosen
 
Interpersonal Communication
Interpersonal CommunicationInterpersonal Communication
Interpersonal Communication
Sze Tan
 
A sneakzine called costumization
A sneakzine called costumizationA sneakzine called costumization
A sneakzine called costumization
MichelleAakerberg
 
Small Biz CEDC Orientation
Small Biz CEDC OrientationSmall Biz CEDC Orientation
Small Biz CEDC Orientation
Mary Phillips
 
Health keeping techniques at english lessons
Health keeping techniques at english lessonsHealth keeping techniques at english lessons
Health keeping techniques at english lessons
Kindergarten
 
One’s own self pr
One’s own self prOne’s own self pr
One’s own self pr
Jinwoo Jeong
 
Butlers model-simplified-1200482942556217-2[1]
Butlers model-simplified-1200482942556217-2[1]Butlers model-simplified-1200482942556217-2[1]
Butlers model-simplified-1200482942556217-2[1]
Ron Hekman
 
Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013
Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013
Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013
Mikko Järvilehto
 
Проект «открытка к 8 марта»
Проект «открытка к 8 марта»Проект «открытка к 8 марта»
Проект «открытка к 8 марта»
Марина Д
 

Destacado (18)

Foursquare for business
Foursquare for businessFoursquare for business
Foursquare for business
 
Interpersonal Communication
Interpersonal CommunicationInterpersonal Communication
Interpersonal Communication
 
A sneakzine called costumization
A sneakzine called costumizationA sneakzine called costumization
A sneakzine called costumization
 
Small biz expo & suit donation for the homeless
Small biz expo & suit donation for the homelessSmall biz expo & suit donation for the homeless
Small biz expo & suit donation for the homeless
 
Education, crime & employment forum
Education, crime & employment forumEducation, crime & employment forum
Education, crime & employment forum
 
Incremento arancelario
Incremento arancelarioIncremento arancelario
Incremento arancelario
 
The Future of Travel in 2020
The Future of Travel in 2020The Future of Travel in 2020
The Future of Travel in 2020
 
Higher marketing
Higher marketingHigher marketing
Higher marketing
 
グリッドレイアウトを簡単に行うJavaScript!Masonry.js
グリッドレイアウトを簡単に行うJavaScript!Masonry.jsグリッドレイアウトを簡単に行うJavaScript!Masonry.js
グリッドレイアウトを簡単に行うJavaScript!Masonry.js
 
Small Biz CEDC Orientation
Small Biz CEDC OrientationSmall Biz CEDC Orientation
Small Biz CEDC Orientation
 
Health keeping techniques at english lessons
Health keeping techniques at english lessonsHealth keeping techniques at english lessons
Health keeping techniques at english lessons
 
One’s own self pr
One’s own self prOne’s own self pr
One’s own self pr
 
Butlers model-simplified-1200482942556217-2[1]
Butlers model-simplified-1200482942556217-2[1]Butlers model-simplified-1200482942556217-2[1]
Butlers model-simplified-1200482942556217-2[1]
 
Moixonets
MoixonetsMoixonets
Moixonets
 
Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013
Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013
Imuryhmän esitys - Apps4sust-ohjelman valmistelu 10072013
 
Проект «открытка к 8 марта»
Проект «открытка к 8 марта»Проект «открытка к 8 марта»
Проект «открытка к 8 марта»
 
Logo moselectro concepts, 1-t version
Logo moselectro   concepts, 1-t versionLogo moselectro   concepts, 1-t version
Logo moselectro concepts, 1-t version
 
Small Biz CEDC Introduction
Small Biz CEDC IntroductionSmall Biz CEDC Introduction
Small Biz CEDC Introduction
 

Similar a Bioinformatics practical note

ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
CGIAR Generation Challenge Programme
 
Patent Cheminformatics: Identification of key compounds in patents
Patent Cheminformatics: Identification of key compounds in patentsPatent Cheminformatics: Identification of key compounds in patents
Patent Cheminformatics: Identification of key compounds in patents
Sorel Muresan
 
Next generation sequencing for snp discovery(final)
Next generation sequencing for snp discovery(final)Next generation sequencing for snp discovery(final)
Next generation sequencing for snp discovery(final)
UAS,GKVK<BANGALORE
 
Presentation for Phi Sigma Fall 2015
Presentation for Phi Sigma Fall 2015Presentation for Phi Sigma Fall 2015
Presentation for Phi Sigma Fall 2015
Caelie Kern
 

Similar a Bioinformatics practical note (20)

Ashg grc workshop2015_tg
Ashg grc workshop2015_tgAshg grc workshop2015_tg
Ashg grc workshop2015_tg
 
Dr. claude lambert challenges, solutions and innovations in modern flowcyto...
Dr. claude lambert   challenges, solutions and innovations in modern flowcyto...Dr. claude lambert   challenges, solutions and innovations in modern flowcyto...
Dr. claude lambert challenges, solutions and innovations in modern flowcyto...
 
Studies on 16 s rrna of f. columnare
Studies on 16 s rrna of f. columnareStudies on 16 s rrna of f. columnare
Studies on 16 s rrna of f. columnare
 
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
 
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
 
Patent Cheminformatics: Identification of key compounds in patents
Patent Cheminformatics: Identification of key compounds in patentsPatent Cheminformatics: Identification of key compounds in patents
Patent Cheminformatics: Identification of key compounds in patents
 
Ramorum2016 final
Ramorum2016 finalRamorum2016 final
Ramorum2016 final
 
Exome breast cancer-edu-tk-sb
Exome breast cancer-edu-tk-sbExome breast cancer-edu-tk-sb
Exome breast cancer-edu-tk-sb
 
SNP marker development in a QTL region associated with drought tolerance trai...
SNP marker development in a QTL region associated with drought tolerance trai...SNP marker development in a QTL region associated with drought tolerance trai...
SNP marker development in a QTL region associated with drought tolerance trai...
 
Bacterial Pathogen Genomics at NCBI
Bacterial Pathogen Genomics at NCBIBacterial Pathogen Genomics at NCBI
Bacterial Pathogen Genomics at NCBI
 
Next generation sequencing for snp discovery(final)
Next generation sequencing for snp discovery(final)Next generation sequencing for snp discovery(final)
Next generation sequencing for snp discovery(final)
 
Axiom® Genome-Wide CHB 1 & CHB 2 Array Plate Set
Axiom® Genome-Wide CHB 1 & CHB 2 Array Plate SetAxiom® Genome-Wide CHB 1 & CHB 2 Array Plate Set
Axiom® Genome-Wide CHB 1 & CHB 2 Array Plate Set
 
Presentation for Phi Sigma Fall 2015
Presentation for Phi Sigma Fall 2015Presentation for Phi Sigma Fall 2015
Presentation for Phi Sigma Fall 2015
 
EUGM 2014 - Ádám Andor Kelemen (Hungarian Academy of Sciences): Physicochemic...
EUGM 2014 - Ádám Andor Kelemen (Hungarian Academy of Sciences): Physicochemic...EUGM 2014 - Ádám Andor Kelemen (Hungarian Academy of Sciences): Physicochemic...
EUGM 2014 - Ádám Andor Kelemen (Hungarian Academy of Sciences): Physicochemic...
 
GPCR ORF Clones
GPCR ORF ClonesGPCR ORF Clones
GPCR ORF Clones
 
Robert Soler and Lluis Orozco. Regenerative Tissue Therapy Institute at the T...
Robert Soler and Lluis Orozco. Regenerative Tissue Therapy Institute at the T...Robert Soler and Lluis Orozco. Regenerative Tissue Therapy Institute at the T...
Robert Soler and Lluis Orozco. Regenerative Tissue Therapy Institute at the T...
 
19 aimradial2016 fri A Aminian
19 aimradial2016 fri A Aminian19 aimradial2016 fri A Aminian
19 aimradial2016 fri A Aminian
 
2009 bologna, af & chf congress, ablazione della fibrillazione atriale. obiet...
2009 bologna, af & chf congress, ablazione della fibrillazione atriale. obiet...2009 bologna, af & chf congress, ablazione della fibrillazione atriale. obiet...
2009 bologna, af & chf congress, ablazione della fibrillazione atriale. obiet...
 
2009 ferrara, congresso regionale, i tools da raggiungere nell'ablazione dell...
2009 ferrara, congresso regionale, i tools da raggiungere nell'ablazione dell...2009 ferrara, congresso regionale, i tools da raggiungere nell'ablazione dell...
2009 ferrara, congresso regionale, i tools da raggiungere nell'ablazione dell...
 
A beginner's guide to flow cytometry
A beginner's guide to flow cytometryA beginner's guide to flow cytometry
A beginner's guide to flow cytometry
 

Más de Atai Rabby

Identification of the positively selected genes governing host-pathogen arm r...
Identification of the positively selected genes governing host-pathogen arm r...Identification of the positively selected genes governing host-pathogen arm r...
Identification of the positively selected genes governing host-pathogen arm r...
Atai Rabby
 
Quantative Structure-Activity Relationships (QSAR)
Quantative Structure-Activity Relationships (QSAR)Quantative Structure-Activity Relationships (QSAR)
Quantative Structure-Activity Relationships (QSAR)
Atai Rabby
 
Fasta file extensions & meaning
Fasta file extensions & meaningFasta file extensions & meaning
Fasta file extensions & meaning
Atai Rabby
 

Más de Atai Rabby (20)

Immunoassay
ImmunoassayImmunoassay
Immunoassay
 
Identification of the positively selected genes governing host-pathogen arm r...
Identification of the positively selected genes governing host-pathogen arm r...Identification of the positively selected genes governing host-pathogen arm r...
Identification of the positively selected genes governing host-pathogen arm r...
 
D4476, a cell-permeant inhibitor of CK1, potentiates the action of Bromodeoxy...
D4476, a cell-permeant inhibitor of CK1, potentiates the action of Bromodeoxy...D4476, a cell-permeant inhibitor of CK1, potentiates the action of Bromodeoxy...
D4476, a cell-permeant inhibitor of CK1, potentiates the action of Bromodeoxy...
 
Identifying Antibiotics posing potential Health Risk: Microbial Resistance Sc...
Identifying Antibiotics posing potential Health Risk: Microbial Resistance Sc...Identifying Antibiotics posing potential Health Risk: Microbial Resistance Sc...
Identifying Antibiotics posing potential Health Risk: Microbial Resistance Sc...
 
Quantative Structure-Activity Relationships (QSAR)
Quantative Structure-Activity Relationships (QSAR)Quantative Structure-Activity Relationships (QSAR)
Quantative Structure-Activity Relationships (QSAR)
 
Antiviral drug
Antiviral drugAntiviral drug
Antiviral drug
 
Real-Time PCR
Real-Time PCRReal-Time PCR
Real-Time PCR
 
Actin, Myosin, and Cell Movement
Actin, Myosin, and Cell MovementActin, Myosin, and Cell Movement
Actin, Myosin, and Cell Movement
 
Thyroid hormone
Thyroid hormoneThyroid hormone
Thyroid hormone
 
Parathyroid hormone
Parathyroid hormoneParathyroid hormone
Parathyroid hormone
 
Gonadal hormone
Gonadal hormoneGonadal hormone
Gonadal hormone
 
Gi hormone
Gi hormoneGi hormone
Gi hormone
 
Adrenal hormone
Adrenal hormoneAdrenal hormone
Adrenal hormone
 
Rice dna extraction miniprep protocol
Rice dna extraction miniprep protocolRice dna extraction miniprep protocol
Rice dna extraction miniprep protocol
 
Restriction mapping of bacterial dna
Restriction mapping of bacterial dnaRestriction mapping of bacterial dna
Restriction mapping of bacterial dna
 
Mesurement of cretinine kinase from blood of a cardiac patient
Mesurement of cretinine kinase from blood of a cardiac patientMesurement of cretinine kinase from blood of a cardiac patient
Mesurement of cretinine kinase from blood of a cardiac patient
 
How the blast work
How the blast workHow the blast work
How the blast work
 
Fasta file extensions & meaning
Fasta file extensions & meaningFasta file extensions & meaning
Fasta file extensions & meaning
 
The biochemistry of memory
The biochemistry of memoryThe biochemistry of memory
The biochemistry of memory
 
Transmission of nerve impulses
Transmission of nerve impulsesTransmission of nerve impulses
Transmission of nerve impulses
 

Último

The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptx
heathfieldcps1
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
ciinovamais
 
An Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdfAn Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdf
SanaAli374401
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
QucHHunhnh
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
negromaestrong
 
Making and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdfMaking and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdf
Chris Hunter
 

Último (20)

Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptx
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writing
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
An Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdfAn Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdf
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Unit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptxUnit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptx
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 
How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
 
PROCESS RECORDING FORMAT.docx
PROCESS      RECORDING        FORMAT.docxPROCESS      RECORDING        FORMAT.docx
PROCESS RECORDING FORMAT.docx
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activity
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
Making and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdfMaking and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdf
 

Bioinformatics practical note

  • 1. Department of Biochemistry and Molecular Biology University of Dhaka MS Practical Bioinformatics Practical Note Submitted by Md. Atai rabby MS Biochemistry and Molecular Biology
  • 2. Restriction Mapping Tool : Restriction Mapper 3.0 Sequence : Pyruvate Kinase, Vibrio cholera O395 Name: Pyruvate Kinase Conformation: linear Overhang: five_prime, three_prime, blunt Minimum Site Length: 4 bases Maximum Number of Cuts: all Included: all commercial, prototypes only Noncutters: AarI, AatII, AbsI, AclI, AcyI, AflII, AjuI, AlfI, AloI, AlwNI, ApaI, AscI, AsuII, AvaI, BaeI, BamHI, BarI, BbvCI, BdaI, BglI, BglII, BplI, Bpu10I, BsaXI, BsePI, BseRI, BsmI, Bsp1407I, BspHI, BsrBI, BsrDI, BstEII, BstXI, BtgZI, ClaI, CspCI, DraII, DraIII, DrdI, Eam1105I, EciI, Eco31I, EcoNI, EcoRI, EcoRV, FalI, FseI, FspAI, GsuI, HaeIV, Hin4I, HindIII, KpnI, MauBI, MfeI, MluI, NaeI, NarI, NcoI, NdeI, NheI, NlaIV, NmeAIII, NotI, NruI, NspI, PacI, PasI, PflMI, PfoI, PmeI, PpiI, PpuMI, PsiI, PI- PspI, PspXI, PsrI, PstI, PvuI, PvuII, RsrII, SacI, SacII, SalI, SanDI, SapI, PI-SceI, SexAI, SfiI, SgfI, SgrAI, SgrDI, SmaI, SpeI, SphI, SrfI, Sse8387I, SspI, StuI, SwaI, TaqII, TauI, TstI, Tth111I, VspI, XbaI, XcmI, XhoI, XmnI Name Sequence Site Length Overhang Frequency Cut Positions BalI TGGCCA 6 blunt 1 263 Eco47III AGCGCT 6 blunt 1 506 SnaBI TACGTA 6 blunt 1 1057 AflIII ACRYGT 6 five_prime 1 1401 Hpy99I CGWCG 5 three_prime 3 382, 834, 892 MboII GAAGA 5 three_prime 3 762, 772, 987 ArsI GACNNNNNNTTYG 7 three_prime 4 28, 60, 520, 552 NlaIII CATG 4 three_prime 4 84, 723, 909, 984 TspGWI ACGGA 5 three_prime 4 139, 205, 571, 598 AluI AGCT 4 blunt 5 66, 228, 622, 705, 1219 AciI CCGC 4 five_prime 5 632, 883, 970, 1094, 1138 TspRI CASTG 5 three_prime 7 417, 423, 1068, 1121, 1281, 1370,
  • 3. Name Sequence Site Length Overhang Frequency Cut Positions 1395 FaiI YATR 4 blunt 8 21, 82, 91, 388, 721, 907, 982, 1074 GlaI GCGC 4 blunt 8 313, 450, 506, 876, 986, 1112, 1310, 1362 MaeII ACGT 4 five_prime 10 119, 353, 596, 729, 810, 864, 890, 1050, 1056, 1403 CviJI RGCY 4 blunt 12 32, 66, 228, 263, 622, 677, 705, 1046, 1069, 1180, 1219, 1322 SetI ASST 4 three_prime 28 68, 122, 207, 230, 350, 356, 471, 479, 533, 591, 599, 624, 707, 732, 740, 744, 813, 867, 893, 954, 1053, 1059, 1083, 1221, 1242, 1295, 1299, 1406 Discussion From the analysis we can come to following analysis 1. There are many cutting sites for our sequence by commercially available Restriction enzyme 2. Some enzymes do not have any cutting site in the sequence 3. Many of the enzymes here are frequent cutter(4 cutter) 4. SetI have highest cutting sites in this sequence 5. BalI, Sna BI is not suitable for plasmis construction as they produce blunt overhang.
  • 4. Finding Open Reading Frame Tool : ORF finder pyruvate kinase : Vibrio cholerae O395 Discussion NCBI ORF finder produce six possible reading frames, we cheched each reading frames and blast them with nr nucleotide database which ultimately proof that the first ORF with length 1413 is the best match ORF
  • 5. Multiple Sequence Alignment Tool : Clustalw Algorithm : Clustal W Discussion ClustalW alignment could be now use to find conseve regions, bulding phylogenetic analysis, calculating conservancy or divergency, finding domains etc.
  • 6. Making Phylogenetic tree from a Multiple Alignment Tool : clustalW Method: Neighbour Joining Method Discussion We used four strain of vibrio cholerae and their two type of Pyruvate Kinase Product in this analysis. The following decision could be made from the tree 1. The tree is devided into three clades 2. First clade contains only Pyruvate kinase II enzyme group of four Vibrio strain 3. The third clade contain only Pyruvate kinase enzyme group of four Vibrio strain 4. Pyruvate Kinase and Pyruvate kinase II evolve differently in vibrio cholerae srtarin
  • 7. Primer Designing Tool : Primer 3, IDT Olig Analyzer Found Primer 1 LEFT PRIMER : GGTAACAAAGAGCGCGTAGC RIGHT PRIMER: CGCTTCAGTTGCTACGATGA PRODUCT SIZE: 84 2 LEFT PRIMER : CGGTGACTACGTTGAACACG RIGHT PRIMER: GTCGCCGTGATAACCACTTT PRODUCT SIZE: 723 3 LEFT PRIMER : ATGGAAGTACTGGCGACCAC RIGHT PRIMER: TTCTTGTTGGTGGTGACTGC PRODUCT SIZE: 818 4 LEFT PRIMER : TTGAACACGGCACTCGTATC RIGHT PRIMER: GTCGCCGTGATAACCACTTT PRODUCT SIZE: 712 Features of First Primer LENGTH:20 GC CONTENT:55.0 %MELT TEMP:56.4 ºC MOLECULAR WEIGHT:6200.1 g/mole EXTINCTION COEFFICIENT:205600L/(mole·cm) nmole/OD260:4.86 µg/OD260:30.16 Hairpin Ananlysis [ Value of ΔG and Hairpin indicating the primer as poor candidate ] ΔG (kcal.mole-1 ) : -1.16 Hetero dimer [Value of ΔG indicating Low possibility of Hetero dimer formation ] ΔG = -8.35 kcal/mole, -6.75 kcal/mole, -4.74 kcal/mole