SlideShare una empresa de Scribd logo
1 de 35
Summer 2011 Cole Steber Knysnaand Monotropauniflora
Johannesburg, South Africa
Knysna, South Africa
Knysna Volunteer House
Two separate worlds
The People
Knysna Hospital
The “Theatre”
The Township
Sinetemba
Mad About Art
Tackle Africa
Fun Day
Exploring Knysna
Goodbye South Africa
Summer Research Project with monotropauniflora Microsatellite Primer Development Sampling trip Back in Danville…
Microsatellite(n): sequence composed of tandem repeat units usually two to five nucleotides in length (TC)12 CTAGGAGAGGTATATATGGGTCTTAAAATGTTTTAGATCATTATTTCAGATCTAAGTTCTCTCTCTCTCTCTCTCTCTCTCTCCACTTGAAGAACTCTAGACCTCTCTGTCCCTTCTCTTTTGATTTTGAGGTGGTTCCA
Microsatellite as a Tool Fine scale population analyses  Highly variable DNA Polymerase stutters Repeat units added or deleted DNA repair mechanisms not 100% effective http://studentreader.com/files/repeat_microsatellite.png
Monotropauniflora(Indian Pipe) Uniflora has large variation in color and in blooming periods Variation is evident across sympatric and allopatric populations
Characteristics Heterotrophic Grows 10-30 cm Predominantly underground Mycorrhizal Associates Russula Lactarius
Plant and Fungus Relationship 90% of plants have some association with mycorrhizal fungi Mutualism
Explanation for Variation Speciation Temporal reproductive isolation Cryptic speciation through mycorhizal fungal associate interactions Null hypothesis: No genetic differentiation among blooming periods
Final Progress Future Research:  Genotyping the populations of extracted DNA Study associations of mycorrhizal associates
Genetic Fingerprint Combine 10 different loci to get one fingerprint per individual.
Field Biology in New England
To the Coast
In Search of Beach Plum
Pristine Landscape
The G-Gnomes
Long Island, New York
A Perfect Sunset
Jersey Shore
Exploration of the Medical Field Assisted career decision making	 Exploration of Scientific Research Learned how scientific process works Gained an appreciation for conservation and nature Summer Enrichment
To the James Grahm Brown Foundation and all my mentors who assisted and made my summer experience possible A Sincere Thank You

Más contenido relacionado

Destacado

Frolicking in France by Brittany Hubert
Frolicking in France by Brittany HubertFrolicking in France by Brittany Hubert
Frolicking in France by Brittany Hubert
Brown Fellows Program
 
A Survey of Conservation Research by Joe LaCasse
A Survey of Conservation Research by Joe LaCasseA Survey of Conservation Research by Joe LaCasse
A Survey of Conservation Research by Joe LaCasse
Brown Fellows Program
 
Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks
Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks
Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks
Brown Fellows Program
 
Friends of the Children by Maddie Hooper
Friends of the Children by Maddie HooperFriends of the Children by Maddie Hooper
Friends of the Children by Maddie Hooper
Brown Fellows Program
 
Spanish Immersion and Volunteering in San Jose Costa Rica by Megan Durham
Spanish Immersion and Volunteering in San Jose Costa Rica by Megan DurhamSpanish Immersion and Volunteering in San Jose Costa Rica by Megan Durham
Spanish Immersion and Volunteering in San Jose Costa Rica by Megan Durham
Brown Fellows Program
 

Destacado (12)

From Panama To Uganda by Billy Menkhaus
From Panama To Uganda by Billy MenkhausFrom Panama To Uganda by Billy Menkhaus
From Panama To Uganda by Billy Menkhaus
 
Frolicking in France by Brittany Hubert
Frolicking in France by Brittany HubertFrolicking in France by Brittany Hubert
Frolicking in France by Brittany Hubert
 
A Summer in Wonderland: An Engineer’s Adventure Through the World of Student ...
A Summer in Wonderland: An Engineer’s Adventure Through the World of Student ...A Summer in Wonderland: An Engineer’s Adventure Through the World of Student ...
A Summer in Wonderland: An Engineer’s Adventure Through the World of Student ...
 
Summer 2012: Professional Development by Natalie Pope
Summer 2012: Professional Development by Natalie PopeSummer 2012: Professional Development by Natalie Pope
Summer 2012: Professional Development by Natalie Pope
 
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan DurhamHealth and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
Health and Outreach Across Latin Ammerica, Guatemala and Peru by Megan Durham
 
A Survey of Conservation Research by Joe LaCasse
A Survey of Conservation Research by Joe LaCasseA Survey of Conservation Research by Joe LaCasse
A Survey of Conservation Research by Joe LaCasse
 
Coach For College by Laura Patterson
Coach For College by Laura PattersonCoach For College by Laura Patterson
Coach For College by Laura Patterson
 
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
Looking Ahead – Governor’s Scholars Program and Baptist Health by Ethan Tomli...
 
Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks
Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks
Kyle Busch Motorsports Marketing and Accounting Internship by Catherine Parks
 
La Loi et Le Peuple: A Comparison of the French and American Legal Systems by...
La Loi et Le Peuple: A Comparison of the French and American Legal Systems by...La Loi et Le Peuple: A Comparison of the French and American Legal Systems by...
La Loi et Le Peuple: A Comparison of the French and American Legal Systems by...
 
Friends of the Children by Maddie Hooper
Friends of the Children by Maddie HooperFriends of the Children by Maddie Hooper
Friends of the Children by Maddie Hooper
 
Spanish Immersion and Volunteering in San Jose Costa Rica by Megan Durham
Spanish Immersion and Volunteering in San Jose Costa Rica by Megan DurhamSpanish Immersion and Volunteering in San Jose Costa Rica by Megan Durham
Spanish Immersion and Volunteering in San Jose Costa Rica by Megan Durham
 

Similar a Knysna and Monotropa uniflora by Cole Steber

Involvement Of Insects In The Transmission Of Banana Blood Disease
Involvement Of Insects In The Transmission Of Banana Blood DiseaseInvolvement Of Insects In The Transmission Of Banana Blood Disease
Involvement Of Insects In The Transmission Of Banana Blood Disease
IJRES Journal
 
Gil ecn2013 ppt
Gil ecn2013 pptGil ecn2013 ppt
Gil ecn2013 ppt
ECNOfficer
 
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
Sam Herniman
 
Cassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - CopyCassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - Copy
Jawwad Mirza
 

Similar a Knysna and Monotropa uniflora by Cole Steber (16)

Ruminations on the importance of vouchering, bycatch and accessibility
Ruminations on the importance of vouchering, bycatch and accessibilityRuminations on the importance of vouchering, bycatch and accessibility
Ruminations on the importance of vouchering, bycatch and accessibility
 
L37 gedrag van planten, kan dat wel theo elzenga
L37 gedrag van planten, kan dat wel   theo elzengaL37 gedrag van planten, kan dat wel   theo elzenga
L37 gedrag van planten, kan dat wel theo elzenga
 
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
 
Kunak2010MSc[1][1]
Kunak2010MSc[1][1]Kunak2010MSc[1][1]
Kunak2010MSc[1][1]
 
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
 
Involvement Of Insects In The Transmission Of Banana Blood Disease
Involvement Of Insects In The Transmission Of Banana Blood DiseaseInvolvement Of Insects In The Transmission Of Banana Blood Disease
Involvement Of Insects In The Transmission Of Banana Blood Disease
 
Rufus plant microbe interactions
Rufus plant microbe interactionsRufus plant microbe interactions
Rufus plant microbe interactions
 
Eight Primate Research
Eight Primate ResearchEight Primate Research
Eight Primate Research
 
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...Assessment of Endophytic Fungal Flora Responsible for Plant  Growth Promotion...
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...
 
Cassava green mite a case study of biological control
Cassava green mite   a case study of biological controlCassava green mite   a case study of biological control
Cassava green mite a case study of biological control
 
Gil ecn2013 ppt
Gil ecn2013 pptGil ecn2013 ppt
Gil ecn2013 ppt
 
1334007 monika
1334007 monika1334007 monika
1334007 monika
 
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
HernimanS_2016_AnthropogenicInfluencesOrchidsXishuangbannaChinaMAXENT_2016062...
 
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
Microsatellite and mt-DNA phylogenies of the chamois (genus Rupicapra) and ta...
 
Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...
 
Cassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - CopyCassava Green Mite - A case study of Biological Control - Copy
Cassava Green Mite - A case study of Biological Control - Copy
 

Más de Brown Fellows Program

Más de Brown Fellows Program (20)

When Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
When Truths Collide Ways of Approaching The Religious Other by Jeannie CorbittWhen Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
When Truths Collide Ways of Approaching The Religious Other by Jeannie Corbitt
 
Up, Up, and Away a Three Part Project by Kathryn Ashby
Up, Up, and Away a Three Part Project by Kathryn AshbyUp, Up, and Away a Three Part Project by Kathryn Ashby
Up, Up, and Away a Three Part Project by Kathryn Ashby
 
Understanding and Preventing the Obesity Epidemic by Albert Anastasio
Understanding and Preventing the Obesity Epidemic by Albert AnastasioUnderstanding and Preventing the Obesity Epidemic by Albert Anastasio
Understanding and Preventing the Obesity Epidemic by Albert Anastasio
 
Stochastic Modeling and Simulation of Football by David Newton
Stochastic Modeling and Simulation of Football by David NewtonStochastic Modeling and Simulation of Football by David Newton
Stochastic Modeling and Simulation of Football by David Newton
 
Selfless in South America by Rachel Geil
Selfless in South America by Rachel GeilSelfless in South America by Rachel Geil
Selfless in South America by Rachel Geil
 
Materials Research in Ljubljana, Slovenia by Luke Guhy
Materials Research in Ljubljana, Slovenia  by Luke GuhyMaterials Research in Ljubljana, Slovenia  by Luke Guhy
Materials Research in Ljubljana, Slovenia by Luke Guhy
 
Latin Epigraphy and Louisville by Matt Hughes
Latin Epigraphy and Louisville by Matt HughesLatin Epigraphy and Louisville by Matt Hughes
Latin Epigraphy and Louisville by Matt Hughes
 
Internship at the Rancho Santa Ana Botanic Garden by Katherine Roland
Internship at the Rancho Santa Ana Botanic Garden by Katherine RolandInternship at the Rancho Santa Ana Botanic Garden by Katherine Roland
Internship at the Rancho Santa Ana Botanic Garden by Katherine Roland
 
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
Internship at the Prichard Committee for Academic Excellence Can Charter Scho...
 
Internship at the Bureau of Labor Statistics by Ashley El Rady
Internship at the Bureau of Labor Statistics by Ashley El RadyInternship at the Bureau of Labor Statistics by Ashley El Rady
Internship at the Bureau of Labor Statistics by Ashley El Rady
 
Intensive Arabic at the University of Texas by Madeleine Loney
Intensive Arabic at the University of Texas by Madeleine LoneyIntensive Arabic at the University of Texas by Madeleine Loney
Intensive Arabic at the University of Texas by Madeleine Loney
 
IARC Takes on Cervical Cancer by Allison Grant
IARC Takes on Cervical Cancer by Allison GrantIARC Takes on Cervical Cancer by Allison Grant
IARC Takes on Cervical Cancer by Allison Grant
 
Government Policy in the World of Business by Jessica Cruzan
Government Policy in the World of Business by Jessica CruzanGovernment Policy in the World of Business by Jessica Cruzan
Government Policy in the World of Business by Jessica Cruzan
 
Editorial Intern by Sara Loy
Editorial Intern by Sara LoyEditorial Intern by Sara Loy
Editorial Intern by Sara Loy
 
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
Comparing the Performance of Arm Based and Traditional Computers For Drug Dis...
 
Choosing To Succeed A Guide To Smart Education Policy by Jillian Frost
Choosing To Succeed A Guide To Smart Education Policy by Jillian FrostChoosing To Succeed A Guide To Smart Education Policy by Jillian Frost
Choosing To Succeed A Guide To Smart Education Policy by Jillian Frost
 
American Makers Quantifying the Maker Movement in 2014 by Caleb Sheehan
American Makers Quantifying the Maker Movement in 2014 by Caleb SheehanAmerican Makers Quantifying the Maker Movement in 2014 by Caleb Sheehan
American Makers Quantifying the Maker Movement in 2014 by Caleb Sheehan
 
Alternative Energy Research and Exploration by Matt Nisbet
Alternative Energy Research and Exploration by Matt NisbetAlternative Energy Research and Exploration by Matt Nisbet
Alternative Energy Research and Exploration by Matt Nisbet
 
A Summer's Investigation of Biology Based Diagnostic Principles in Netherland...
A Summer's Investigation of Biology Based Diagnostic Principles in Netherland...A Summer's Investigation of Biology Based Diagnostic Principles in Netherland...
A Summer's Investigation of Biology Based Diagnostic Principles in Netherland...
 
A Quantum Summber by Jonathan Hunt
A Quantum Summber by Jonathan HuntA Quantum Summber by Jonathan Hunt
A Quantum Summber by Jonathan Hunt
 

Último

💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati
💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati
💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati
Apsara Of India
 
sample sample sample sample sample sample
sample sample sample sample sample samplesample sample sample sample sample sample
sample sample sample sample sample sample
Casey Keith
 
sample sample sample sample sample sample
sample sample sample sample sample samplesample sample sample sample sample sample
sample sample sample sample sample sample
Casey Keith
 

Último (20)

Night 7k to 12k Daman Call Girls 👉👉 8617697112⭐⭐ 100% Genuine Escort Service ...
Night 7k to 12k Daman Call Girls 👉👉 8617697112⭐⭐ 100% Genuine Escort Service ...Night 7k to 12k Daman Call Girls 👉👉 8617697112⭐⭐ 100% Genuine Escort Service ...
Night 7k to 12k Daman Call Girls 👉👉 8617697112⭐⭐ 100% Genuine Escort Service ...
 
Mathura Call Girls 8250077686 Service Offer VIP Hot Model
Mathura Call Girls 8250077686 Service Offer VIP Hot ModelMathura Call Girls 8250077686 Service Offer VIP Hot Model
Mathura Call Girls 8250077686 Service Offer VIP Hot Model
 
Genuine 9332606886 Hot and Beautiful 💕 Bilaspur Escorts call Girls
Genuine 9332606886 Hot and Beautiful 💕 Bilaspur Escorts call GirlsGenuine 9332606886 Hot and Beautiful 💕 Bilaspur Escorts call Girls
Genuine 9332606886 Hot and Beautiful 💕 Bilaspur Escorts call Girls
 
Are Vatican Museum Tickets and Private Tours Worth It
Are Vatican Museum Tickets and Private Tours Worth ItAre Vatican Museum Tickets and Private Tours Worth It
Are Vatican Museum Tickets and Private Tours Worth It
 
WhatsApp Chat: 📞 8617697112 Suri Call Girls available for hotel room package
WhatsApp Chat: 📞 8617697112 Suri Call Girls available for hotel room packageWhatsApp Chat: 📞 8617697112 Suri Call Girls available for hotel room package
WhatsApp Chat: 📞 8617697112 Suri Call Girls available for hotel room package
 
💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati
💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati
💕📲09602870969💓Girl Escort Services Udaipur Call Girls in Chittorgarh Haldighati
 
Varanasi Call Girls 8250077686 Service Offer VIP Hot Model
Varanasi Call Girls 8250077686 Service Offer VIP Hot ModelVaranasi Call Girls 8250077686 Service Offer VIP Hot Model
Varanasi Call Girls 8250077686 Service Offer VIP Hot Model
 
sample sample sample sample sample sample
sample sample sample sample sample samplesample sample sample sample sample sample
sample sample sample sample sample sample
 
Top places to visit, top tourist destinations
Top places to visit, top tourist destinationsTop places to visit, top tourist destinations
Top places to visit, top tourist destinations
 
Genuine 8250077686 Hot and Beautiful 💕 Visakhapatnam Escorts call Girls
Genuine 8250077686 Hot and Beautiful 💕 Visakhapatnam Escorts call GirlsGenuine 8250077686 Hot and Beautiful 💕 Visakhapatnam Escorts call Girls
Genuine 8250077686 Hot and Beautiful 💕 Visakhapatnam Escorts call Girls
 
Hire 💕 8617697112 Chamba Call Girls Service Call Girls Agency
Hire 💕 8617697112 Chamba Call Girls Service Call Girls AgencyHire 💕 8617697112 Chamba Call Girls Service Call Girls Agency
Hire 💕 8617697112 Chamba Call Girls Service Call Girls Agency
 
WhatsApp Chat: 📞 8617697112 Independent Call Girls in Darjeeling
WhatsApp Chat: 📞 8617697112 Independent Call Girls in DarjeelingWhatsApp Chat: 📞 8617697112 Independent Call Girls in Darjeeling
WhatsApp Chat: 📞 8617697112 Independent Call Girls in Darjeeling
 
Darjeeling Call Girls 8250077686 Service Offer VIP Hot Model
Darjeeling Call Girls 8250077686 Service Offer VIP Hot ModelDarjeeling Call Girls 8250077686 Service Offer VIP Hot Model
Darjeeling Call Girls 8250077686 Service Offer VIP Hot Model
 
❤Personal Contact Number Mcleodganj Call Girls 8617697112💦✅.
❤Personal Contact Number Mcleodganj Call Girls 8617697112💦✅.❤Personal Contact Number Mcleodganj Call Girls 8617697112💦✅.
❤Personal Contact Number Mcleodganj Call Girls 8617697112💦✅.
 
Bhubaneswar Call Girls 8250077686 Service Offer VIP Hot Model
Bhubaneswar Call Girls 8250077686 Service Offer VIP Hot ModelBhubaneswar Call Girls 8250077686 Service Offer VIP Hot Model
Bhubaneswar Call Girls 8250077686 Service Offer VIP Hot Model
 
Jhargram call girls 📞 8617697112 At Low Cost Cash Payment Booking
Jhargram call girls 📞 8617697112 At Low Cost Cash Payment BookingJhargram call girls 📞 8617697112 At Low Cost Cash Payment Booking
Jhargram call girls 📞 8617697112 At Low Cost Cash Payment Booking
 
WhatsApp Chat: 📞 8617697112 Hire Call Girls Cooch Behar For a Sensual Sex Exp...
WhatsApp Chat: 📞 8617697112 Hire Call Girls Cooch Behar For a Sensual Sex Exp...WhatsApp Chat: 📞 8617697112 Hire Call Girls Cooch Behar For a Sensual Sex Exp...
WhatsApp Chat: 📞 8617697112 Hire Call Girls Cooch Behar For a Sensual Sex Exp...
 
Kanpur Call Girls Service ☎ ️82500–77686 ☎️ Enjoy 24/7 Escort Service
Kanpur Call Girls Service ☎ ️82500–77686 ☎️ Enjoy 24/7 Escort ServiceKanpur Call Girls Service ☎ ️82500–77686 ☎️ Enjoy 24/7 Escort Service
Kanpur Call Girls Service ☎ ️82500–77686 ☎️ Enjoy 24/7 Escort Service
 
2k Shots ≽ 9205541914 ≼ Call Girls In Tagore Garden (Delhi)
2k Shots ≽ 9205541914 ≼ Call Girls In Tagore Garden (Delhi)2k Shots ≽ 9205541914 ≼ Call Girls In Tagore Garden (Delhi)
2k Shots ≽ 9205541914 ≼ Call Girls In Tagore Garden (Delhi)
 
sample sample sample sample sample sample
sample sample sample sample sample samplesample sample sample sample sample sample
sample sample sample sample sample sample
 

Knysna and Monotropa uniflora by Cole Steber