Darwin didn’t know what we know in science today. He didn’t know science on a cellular level, … biochemistry & electron microscopes weren’t available to him. For example, in Darwin’s day, people referred to the amazing cell as a “simple” cell, and thought cells were just blobs of jelly-like material. People also still believed in spontaneous generation; that means that they believed that decaying meat generated maggots and that stale bread generated mold……. In fact, spontaneous generation is the basis for the evolutionary theory that life erupted from a pre-historic chemical soup. So, just as we know today that meat does not produce maggots and bread doesn’t produce mold, we have a better understanding of the truly miraculous single cell. True science has proven that spontaneous generation is impossible. ....

1. WHAT DARWIN DIDN’T KNOW

3. “I had no intent to write atheistically.”

4. “False facts are highly injurious to the progress of science, for they often endure long.”

5. “If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.”

6. If it could be demonstrated that any complex organ existed which could not possibly have been formed by numerous, successive, slight modifications my theory would absolutely break down.

7. Irreducible Complexity

8. “The human eye, to this day, gives me a cold shudder.” --- Darwin PROBLEM: IRREDUCIBLE COMPLEXITY

9. WHOLE PACKAGE PHENOMENON

10. “to suppose that the eye, … could have been formed by natural selection, seems, I freely confess, absurd in the highest possible degree.”

12. “the human eye to this day gives me a cold shudder” Darwin to Asa Gray

13. PROBLEM: MUTATIONS

15. Darwin’s “Beneficial” Mutations Loss of winged flight Loss of eyes / vision

16. “The hearing ear and the seeing eye, the Lord has made them both” Proverbs 20:12

17. 100,000,000,000,000 CELLS PROBLEM: THE CELL

18. Darwin’s “simple” cell “A simple little lump of albuminous carbon.” Haeckel Extremely complex cell

22. ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC 3,750,000,000 LETTERS = 1 DNA molecule

23. 108,000,000,000,000 miles of DNA in your body

25. Darwin Was Right “Natural selection” means that organisms that are best suited to their environment survive and pass on their genetic characteristics to succeeding generations while organisms that are less adapted tend to be eliminated.”

26. PROBLEM: NATURAL SELECTION

27. 193 species of monkeys & apes Only one needs clothes

28. 95-98% 92% The Problem of Genetics I’m a banana!! 99%

29. WOLF PROBLEM: INTERMEDIATE SPECIES WHALE

30. ‘’The number of intermediate varieties which have formerly existed on the Earth must be enormous….

31. …Why then is not every geological formation and every stratum full of such intermediate links? ...

32. The Problem of Fossils Geology assuredly does not reveal any such finely graduated.. chain (such as the chain from bear, pig, or wolf to whale): and this, perhaps, is the most obvious and gravest objection which can be urged against my theory.”

33. Stephen Jay Gould Paleontologist /& Evolutionary Biologist (1941-2002) "The absence of fossil evidence for intermediary stages ….. indeed our inability, even in our imagination, to construct functional intermediates …., has been a persistent and nagging problem for ….evolution.“ "The extreme rarity of transitional forms in the fossil record persists as the trade secret of paleontology.” “Paleontologists have paid an exorbitant price for Darwin's argument.…we never see the very process we profess to study.“

34. PROBLEM: GIFTS

35. What Darwin Didn’t Know....

36. Mt. 5:18For truly, I say to you, until heaven and earth pass away, not an iota, not a dot, will pass from the Law until all is accomplished. In the Gospels: 11x – “Have you not read…..” 30x – “It is written……..”

37. ROMANS 1:18-24 ….suppress the truth …. clearly perceived..since creation ….without excuse ….did not honor Him or give thanks ….foolish hearts darkened ….claiming to be wise (their theories) ….exchanged the glory of God (for evolution)

38. “For You formed my inward parts;You wove me in my mother’s womb. I will give thanks to You, for I am fearfully and wonderfully made;Wonderful are Your works,And my soul knows it very well.”Psalm 139:13-14