SlideShare una empresa de Scribd logo
1 de 30
A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations Paul Fisher Dr. Robert Stevens Prof. Andrew Brass
[object Object],Genotype DNA ACTGCACTGACTGTACGTATATCT ACTGCACTG TG TGTACGTATATCT Mutations Genes
[object Object],[object Object],Phenotype vs. Brown White and Brown
Genotype  to  Phenotype
Genotype Phenotype ? Current Methods 200 What processes to investigate?
? 200 Microarray + QTL Genes captured in microarray experiment and present in QTL ( Quantitative Trait Loci  )  region Genotype Phenotype Metabolic pathways Phenotypic response investigated using microarray in form of expressed genes or evidence provided through QTL mapping
CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype
Issues with current approaches
Huge amounts of data 200+ Genes QTL region on chromosome Microarray 1000+ Genes How do I look at ALL the genes systematically?
Hypothesis-Driven Analyses 200 QTL genes Case: African Sleeping sickness - parasitic infection - Known immune response Pick the genes involved in immunological process 40 QTL genes Pick the genes that I am most familiar with 2 QTL genes Biased view ,[object Object],[object Object],[object Object],[object Object]
Manual Methods of data analysis Navigating through hyperlinks No explicit methods Human error Tedious and repetitive
Implicit methods
Issues with current approaches ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Two W’s ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Taverna Workflow Workbench http://taverna.sf.net
Hypothesis ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
Replicated original chain of data analysis
Trypanosomiasis in Africa http://www.genomics.liv.ac.uk/tryps/trypsindex.html Andy Brass Steve Kemp + many Others
Preliminary Results ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Shameless Plug! ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Recycling, Reuse, Repurposing ,[object Object],[object Object],[object Object],Here’s the  Science ! Here’s the  e-Science ! ,[object Object],[object Object],[object Object],Workflows now being run over  Colitis/ Inflammatory Bowel Disease in Mice   (without change)
Recycling, Reuse, Repurposing http://www.myexperiment.org/ ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
What next? ,[object Object],[object Object],[object Object],[object Object],[object Object]
Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype DONE MANUALLY
It can’t be that hard, right? ,[object Object],[object Object],[object Object],Computers can help with data gathering and information extraction – that’s their job !!!
Text Mining ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],NOT A REPLACEMENT FOR  DOMAIN EXPERTISE
To Sum Up …. ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Many thanks to: including: Joanne Pennock, EPSRC, OMII, myGrid, and lots more people

Más contenido relacionado

La actualidad más candente

100,000 Genomes Project.
100,000 Genomes Project.100,000 Genomes Project.
100,000 Genomes Project.David Montaner
 
Lecture 6 candidate gene association full
Lecture 6 candidate gene association fullLecture 6 candidate gene association full
Lecture 6 candidate gene association fullLekki Frazier-Wood
 
Bioinformatics
BioinformaticsBioinformatics
BioinformaticsAmna Jalil
 
COMPARATIVE GENOMICS.ppt
COMPARATIVE GENOMICS.pptCOMPARATIVE GENOMICS.ppt
COMPARATIVE GENOMICS.pptSilpa87
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingAmritha S R
 
Difference between genetic linkage and physical map
Difference between genetic  linkage and physical  mapDifference between genetic  linkage and physical  map
Difference between genetic linkage and physical mapKanimoli Mathivathana
 
Population genetics
Population geneticsPopulation genetics
Population geneticsJwalit93
 
Mapping and Applications of Linkage Disequilibrium and Association Mapping in...
Mapping and Applications of Linkage Disequilibrium and Association Mapping in...Mapping and Applications of Linkage Disequilibrium and Association Mapping in...
Mapping and Applications of Linkage Disequilibrium and Association Mapping in...FAO
 
Linkage analysis
Linkage analysisLinkage analysis
Linkage analysisUshaYadav24
 
Analysis of ChIP-Seq Data
Analysis of ChIP-Seq DataAnalysis of ChIP-Seq Data
Analysis of ChIP-Seq DataPhil Ewels
 
Allelic frequency
Allelic frequencyAllelic frequency
Allelic frequencysijiskariah
 

La actualidad más candente (20)

Pradeep.ii
Pradeep.iiPradeep.ii
Pradeep.ii
 
100,000 Genomes Project.
100,000 Genomes Project.100,000 Genomes Project.
100,000 Genomes Project.
 
Hardy weinberg supplement
Hardy weinberg supplementHardy weinberg supplement
Hardy weinberg supplement
 
Lecture 6 candidate gene association full
Lecture 6 candidate gene association fullLecture 6 candidate gene association full
Lecture 6 candidate gene association full
 
Genome origin
Genome originGenome origin
Genome origin
 
Genome Mapping
Genome MappingGenome Mapping
Genome Mapping
 
Genomics
GenomicsGenomics
Genomics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
COMPARATIVE GENOMICS.ppt
COMPARATIVE GENOMICS.pptCOMPARATIVE GENOMICS.ppt
COMPARATIVE GENOMICS.ppt
 
Homology
HomologyHomology
Homology
 
DNA Sequencing
DNA SequencingDNA Sequencing
DNA Sequencing
 
Genomics
GenomicsGenomics
Genomics
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
Difference between genetic linkage and physical map
Difference between genetic  linkage and physical  mapDifference between genetic  linkage and physical  map
Difference between genetic linkage and physical map
 
Population genetics
Population geneticsPopulation genetics
Population genetics
 
Mapping and Applications of Linkage Disequilibrium and Association Mapping in...
Mapping and Applications of Linkage Disequilibrium and Association Mapping in...Mapping and Applications of Linkage Disequilibrium and Association Mapping in...
Mapping and Applications of Linkage Disequilibrium and Association Mapping in...
 
Linkage analysis
Linkage analysisLinkage analysis
Linkage analysis
 
Analysis of ChIP-Seq Data
Analysis of ChIP-Seq DataAnalysis of ChIP-Seq Data
Analysis of ChIP-Seq Data
 
Genome mapping
Genome mapping Genome mapping
Genome mapping
 
Allelic frequency
Allelic frequencyAllelic frequency
Allelic frequency
 

Destacado

Genotypes and phenotypes
Genotypes and phenotypesGenotypes and phenotypes
Genotypes and phenotypesRosio DeLeon
 
Intro to genetics ppt
Intro to genetics pptIntro to genetics ppt
Intro to genetics pptmrimbiology
 
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Human Variome Project
 
Genetic Basis of Inheritance
Genetic Basis of InheritanceGenetic Basis of Inheritance
Genetic Basis of InheritanceKISHOR SAWAIKAR
 
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationJay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationVall d'Hebron Institute of Research (VHIR)
 
Functions of nucleus
Functions of nucleusFunctions of nucleus
Functions of nucleusMohsin Shad
 
Formal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural GenomesFormal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural Genomesmadalladam
 
UTB - Project Perigee Presentation
UTB - Project Perigee PresentationUTB - Project Perigee Presentation
UTB - Project Perigee Presentationtommygober
 
L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_MUBOSScz
 
Wireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerceWireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commercedesma abi
 
Incomplete and codominance
Incomplete and codominanceIncomplete and codominance
Incomplete and codominanceRosio DeLeon
 
Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis S'eclairer
 
Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)vanessawhitehawk
 

Destacado (20)

Genotypes and phenotypes
Genotypes and phenotypesGenotypes and phenotypes
Genotypes and phenotypes
 
Intro to genetics ppt
Intro to genetics pptIntro to genetics ppt
Intro to genetics ppt
 
Genotype
GenotypeGenotype
Genotype
 
Genotype and phenotype
Genotype and phenotypeGenotype and phenotype
Genotype and phenotype
 
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...Phenotype terminologies in use for genotype-phenotype databases: a common cor...
Phenotype terminologies in use for genotype-phenotype databases: a common cor...
 
Genetic Basis of Inheritance
Genetic Basis of InheritanceGenetic Basis of Inheritance
Genetic Basis of Inheritance
 
11 u mutations
11 u mutations11 u mutations
11 u mutations
 
B10vrv4133
B10vrv4133B10vrv4133
B10vrv4133
 
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
UTSpeaks: Raising babies (1 - Professor Maralyn Foureur)
 
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in TransplantationJay Fishman: indirect effects and viral infections: Infection in Transplantation
Jay Fishman: indirect effects and viral infections: Infection in Transplantation
 
Phyto-oils
Phyto-oilsPhyto-oils
Phyto-oils
 
Functions of nucleus
Functions of nucleusFunctions of nucleus
Functions of nucleus
 
Formal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural GenomesFormal languages to map Genotype to Phenotype in Natural Genomes
Formal languages to map Genotype to Phenotype in Natural Genomes
 
Inclination
InclinationInclination
Inclination
 
UTB - Project Perigee Presentation
UTB - Project Perigee PresentationUTB - Project Perigee Presentation
UTB - Project Perigee Presentation
 
L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_L06 from genotype_to_phenotype_
L06 from genotype_to_phenotype_
 
Wireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerceWireless, mobile computing and mobile commerce
Wireless, mobile computing and mobile commerce
 
Incomplete and codominance
Incomplete and codominanceIncomplete and codominance
Incomplete and codominance
 
Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis Educational Grand Rounds: Arthritis
Educational Grand Rounds: Arthritis
 
Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)Genetics chapter 4 part 2(1)
Genetics chapter 4 part 2(1)
 

Similar a A systematic approach to Genotype-Phenotype correlations

How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationJoaquin Dopazo
 
STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...Lars Juhl Jensen
 
PadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxPadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxDESMONDEZIEKE1
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision
 
Gene hunting strategies
Gene hunting strategiesGene hunting strategies
Gene hunting strategiesAshfaq Ahmad
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesAmos Watentena
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleLaurence Dawkins-Hall
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009Sean Davis
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Joaquin Dopazo
 
Introducción a la bioinformatica
Introducción a la bioinformaticaIntroducción a la bioinformatica
Introducción a la bioinformaticaMartín Arrieta
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple nadeem akhter
 
Transgenic animal models & their
Transgenic animal models & theirTransgenic animal models & their
Transgenic animal models & theirkalpanatiwari17
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingJoaquin Dopazo
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicJoaquin Dopazo
 
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Seattle DAML meetup
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingAamir Wahab
 
provenance of microarray experiments
provenance of microarray experimentsprovenance of microarray experiments
provenance of microarray experimentsHelena Deus
 
A systematic, data driven approach to the combined analysis of microarray and...
A systematic, data driven approach to the combined analysis of microarray and...A systematic, data driven approach to the combined analysis of microarray and...
A systematic, data driven approach to the combined analysis of microarray and...Laurence Dawkins-Hall
 

Similar a A systematic approach to Genotype-Phenotype correlations (20)

How to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical informationHow to transform genomic big data into valuable clinical information
How to transform genomic big data into valuable clinical information
 
STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...STRING - Prediction of a functional association network for the yeast mitocho...
STRING - Prediction of a functional association network for the yeast mitocho...
 
PadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptxPadminiNarayanan-Intro-2018.pptx
PadminiNarayanan-Intro-2018.pptx
 
INBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria LópezINBIOMEDvision Workshop at MIE 2011. Victoria López
INBIOMEDvision Workshop at MIE 2011. Victoria López
 
Gene hunting strategies
Gene hunting strategiesGene hunting strategies
Gene hunting strategies
 
BIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And ChallengesBIOINFORMATICS Applications And Challenges
BIOINFORMATICS Applications And Challenges
 
Genome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattleGenome responses of trypanosome infected cattle
Genome responses of trypanosome infected cattle
 
OKC Grand Rounds 2009
OKC Grand Rounds 2009OKC Grand Rounds 2009
OKC Grand Rounds 2009
 
Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...Digging into thousands of variants to find disease genes in Mendelian and com...
Digging into thousands of variants to find disease genes in Mendelian and com...
 
Introducción a la bioinformatica
Introducción a la bioinformaticaIntroducción a la bioinformatica
Introducción a la bioinformatica
 
bioinformatics simple
bioinformatics simple bioinformatics simple
bioinformatics simple
 
Transgenic animal models & their
Transgenic animal models & theirTransgenic animal models & their
Transgenic animal models & their
 
From reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene findingFrom reads to pathways for efficient disease gene finding
From reads to pathways for efficient disease gene finding
 
rheumatoid arthritis
rheumatoid arthritisrheumatoid arthritis
rheumatoid arthritis
 
A New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The ClinicA New Generation Of Mechanism-Based Biomarkers For The Clinic
A New Generation Of Mechanism-Based Biomarkers For The Clinic
 
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
Machine Learning in Biology and Why It Doesn't Make Sense - Theo Knijnenburg,...
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
provenance of microarray experiments
provenance of microarray experimentsprovenance of microarray experiments
provenance of microarray experiments
 
ASHG_2014_AP
ASHG_2014_APASHG_2014_AP
ASHG_2014_AP
 
A systematic, data driven approach to the combined analysis of microarray and...
A systematic, data driven approach to the combined analysis of microarray and...A systematic, data driven approach to the combined analysis of microarray and...
A systematic, data driven approach to the combined analysis of microarray and...
 

Último

Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Miguel Araújo
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...Neo4j
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsMaria Levchenko
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationSafe Software
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Enterprise Knowledge
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 
Tech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfTech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfhans926745
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsJoaquim Jorge
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...apidays
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)wesley chun
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...DianaGray10
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024The Digital Insurer
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 

Último (20)

Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed texts
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
Tech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfTech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdf
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 

A systematic approach to Genotype-Phenotype correlations

  • 1. A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations Paul Fisher Dr. Robert Stevens Prof. Andrew Brass
  • 2.
  • 3.
  • 4. Genotype to Phenotype
  • 5. Genotype Phenotype ? Current Methods 200 What processes to investigate?
  • 6. ? 200 Microarray + QTL Genes captured in microarray experiment and present in QTL ( Quantitative Trait Loci ) region Genotype Phenotype Metabolic pathways Phenotypic response investigated using microarray in form of expressed genes or evidence provided through QTL mapping
  • 7. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype
  • 8. Issues with current approaches
  • 9. Huge amounts of data 200+ Genes QTL region on chromosome Microarray 1000+ Genes How do I look at ALL the genes systematically?
  • 10.
  • 11. Manual Methods of data analysis Navigating through hyperlinks No explicit methods Human error Tedious and repetitive
  • 13.
  • 14.
  • 15. Taverna Workflow Workbench http://taverna.sf.net
  • 16.
  • 17. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
  • 18. Replicated original chain of data analysis
  • 19. Trypanosomiasis in Africa http://www.genomics.liv.ac.uk/tryps/trypsindex.html Andy Brass Steve Kemp + many Others
  • 20.
  • 21.
  • 22.
  • 23.
  • 24.
  • 25. Pathway Resource QTL mapping study Microarray gene expression study Identify genes in QTL regions Identify differentially expressed genes Wet Lab Literature Annotate genes with biological pathways Annotate genes with biological pathways Select common biological pathways Hypothesis generation and verification Statistical analysis Genomic Resource
  • 26. CHR QTL Gene A Gene B Pathway A Pathway B Pathway linked to phenotype – high priority Pathway not linked to phenotype – medium priority Pathway C Phenotype literature literature literature Gene C Pathway not linked to QTL – low priority Genotype DONE MANUALLY
  • 27.
  • 28.
  • 29.
  • 30. Many thanks to: including: Joanne Pennock, EPSRC, OMII, myGrid, and lots more people

Notas del editor

  1. Title slide A Systematic approach to large-scale analysis Genotype-Phenotype correlations