Presentation ccshau hisar

1. Overview and concept
Harsh Deep
2016A56M
Department of Genetics and Plant Breeding
CCSHAU, Hisar

2.  Introduction
 History
 Mechanism
 Experiments
 Case studies
 Implications
 Conclusion

3. /40
 Epigenetics literally means "above" or "on top of" genetics. It refers
to external modifications to DNA that turn genes "on" or "off."
These modifications do not change the DNA sequence, but instead,
they affect how cells "read" genes.
 The term epigenetics refers to heritable changes in gene expression
that does not involve changes to the underlying DNA sequence; a
change in phenotype without a change in genotype.
 Riggs et al. (1996) The study of mitotically or meiotically heritable
changes in gene function that cannot be explained by changes in
DNA sequence.

4. /40
A Lamarckian idea that the act of stretching one's neck
could lead to change in phenotype across generations.
Lamarck's mechanism for evolution is The inheritance of acquired traits.
He believed that traits altered or acquired over an individual's lifetime
could be transferred down to its offspring.

5. /40
 Conrad Waddington (1942) coined the
term, “epigenetic”. He is known as
father of epigenetics.
 Waddington’s attempted to explain how
a static set of DNA sequences could
dynamically give rise to a complex
organism.
 Pioneering work by Waddington also
demonstrated compelling evidence for
inheritance of a acquired characteristic
in drosophila fruit flies.
Conrad Hal Waddington
(1905 to 1975)

6. /40
cont…
How embryonic stem cells differentiate into nerve cell, brain cell ,heart
cell etc. with different functions, even though all cells contain same DNA?
John Gurdon
(1962)
He implied that the
factors influencing
cell fate decisions
are localized to the
nucleus.

7. /40

8. /40
 An epigenome consists of a record of the chemical changes to
the DNA and histone proteins of an organism.
 These changes can be passed down to an organism's offspring.
 Changes in the epigenome can result in changes to the structure
of chromatin and changes to the function of the genome.
 The epigenome is a multitude of chemical compounds that can
tell the genome what to do.
 Epialleles
Alleles of a locus which have identical DNA sequences but
display different epigenetic states and which have been
proposed to influence a variety of phenotypes in plants and
animals.

9. Molecular epigenetic mechanisms

10. /40
Matouk and Marsden, 2008.

11. /40
 DNA in chromatin is packaged around
histone proteins, in units referred to as
nucleosomes.
 A nucleosome has 147 bp of DNA
associated with an octameric core of
histone proteins, consisting of two H3-
H4 histone dimers surrounded by two
H2A-H2B dimers.
 N-terminal histone tails protrude from
nucleosomes into the nuclear lumen.
 Nucleosome spacing determines
chromatin structure which can be
broadly divided into heterochromatin
and euchromatin.

12. MECHANISMS
1. DNA methylation
2. Histone modifications
• Acetylation
• Methylation
• Phosphorylation,
3. RNA mediated
interference
Matouk and Marsden, 2008.

13. /40
 DNA methylation is an epigenetic
mechanism used by cells to control
gene expression.
 DNA methylation is the addition of a
methyl group to the 5th-carbon of
cytosine.
 In eukaryotic cells, this process is
carried out by a family of DNA
methyltransferases enzymes, which
transfers methyl groups from the
methyl donor S-Adenosyl methionine
(SAM) to the cytosine.
 The resulting 5-methyl cytosine (5mC)
is often repressive and can lead to gene
silencing (Cedar and Bergman, 2012).

14. /40
The repressive nature of 5mC is thought to inhibit the
binding of DNA by transcription factors or to recruit
additional chromatin proteins to form heterochromatic
state that is inaccessible for transcription
DNA methylation in mammals mainly occurs on the
cytosine nucleotide in a CpG site.
In plants the cytosine can be methylated at CpG, CpHpG,
and CpHpH sites, where H represents any nucleotide.
24 to 30% of cytosine base in plants genome is found to
be methylated.

15. Speed Bump?
EUKARYOTIC METHYLATION
cytosine
5-methylcytosine
3’GTCCGTTAGACGCGCGACTCGCGAGTGGTAC
5’CAGGCAATCTGCGCGCTGAGCGCTCACCATG
“CpG Island”
C
C
m
Promoter Region
Cytosine methyltransferase
mm
m m
m
Gene

16. /40
 Genome-wide sequencing has revealed that TEs and other
repetitive elements constitute a large proportion of most
eukaryotic genomes.
 Eukaryotic organisms have evolved mechanisms to silence and
immobilize TEs, such as RNA interference and epigenetic
DNA methylation.
 TEs and other repeat sequences are the main targets of cytosine
methylation and various studies have demonstrated that DNA
methylation primarily functions as a TE silencer.
 DNA methylation at CG, CHG and CHH sites in TEs is
conducted by MET1(methyltransferase1) and CMT3
(chromometylase3).

17. /40
 They are the chief protein components
of chromatin, acting as spools around
which DNA winds, and playing a role
in gene regulation.
 Histone modifications occur primarily
on histone tails by three methods-
 Methylation
 Acetylation
 Phosphorylation http://www.discoveryandinnovation.com/lecture18.html

18. /40
 Enzyme required
o Histone methytransferases (HMTs)
KMT- Lysine methyl transferase
 Methylation can result in activation
or repression of genes.
 Typically, H3K9me2 and H3K9me3
downregulate gene expression, while
H3K4me1, H3K36me3 upregulate
target gene expression.
Lysine methylation

19. /40
b. Histone Acetylation & Deacetylation
 Histone acetylation
– Histone acetyl transferases (HATs)
 Adds acetyl groups to histone tails.
 Reduces positive charge and weakens interaction of histones
with DNA
 Facilitates transcription by making DNA more accessible to
RNA polymerase II
 Histone deacetylation
– Histone deacetylases (HDACs)
 Removes acetyl groups from histone tails
 Increases interaction of
DNA and histones
 Represses transcription

20. /40
 Phosphorylation
 Enzyme required – Protein kinase
 Phosphorylation increase the negative charge on Heston as a result
less interaction between DNA and histones that leads to chromatin
de-condensation.
 Dephosphorylation
 Enzyme required - phosphatase
 increase positive charge followed by chromatin condensation.

21. /40
Determination of DNA methylation
Bisulfite treatment method-
• Unmethylated cytosine is converted to
uracil while methylcytosine remains
unaltered.
• In a polymerase chain reaction (PCR),
uracil is a template like thymidine and all
original cytosine residues are converted to
thymidine.
• PCR products are sequenced and mapped
onto genome data in order to locate
unchanged cytosine, which is the
methylcytosine.
Template A: 5'-GACCGTTCCAGGTCCAGCAGTGCGCT-3’
After BST: 5'-GATCGTTTTAGGTTTAGTAGTGCGTT-3'

22. /40
 Methylation Sensitive Amplified Polymorphism (MSAP)
 This technique needs some methylation-sensitive enzymes
such as HpaII and Msp1.
 In this technique, genomic DNA is first digested with a
methylation-sensitive restriction enzyme such as HpaII and
then a methylation insensitive isoschizomer MspI is used in
a parallel digestion reaction.
 Subsequently, these fragments are selectively amplified by
fluorescently labelled primers.
 PCR products from different individuals are compared and
once an polymorphic locus is recognized, the desired DNA
fragment can be isolated from a denaturing polyacrylamide
gel and sequenced to check methylation pattern.
Cont..

23. /40
 Also called post transcriptional gene
silencing (PTGS)
 Is a biological process in which RNA
molecules inhibit gene action.
 Andrew Fire and Craig C. Mello shared
the Nobel Prize in Physiology or Medicine
– 2006.
 RNAi involves small RNA molecules
called short interfering RNAs (si RNA)
and micro RNAs (mi RNA).
 These molecules are 21 to 28 base pairs
long and produced from larger dsRNA
molecules by enzyme called dicer.

24. /40
Jagtap et al., 2011

25. /40
 Function of both species is regulation of gene expression.
 Difference is in where they originated. siRNA originated from
dsRNA and miRNA originated with ssRNA that form hairpin
secondary structure.
 siRNA is most commonly a response to foreign RNA (usually
viral) and is often 100% complementary to the target.
 miRNA regulate post transcriptional gene expression and often
not 100% complementary to the target.

26. /40

27. /40
• :
o They showed that adult male rats
that had been reared by nurturing
mothers had low levels of
methylation of DNA associated with
the GR gene, while adults who had
been raised by low LG mothers
exhibited hyper methylation
of GR DNA..
o Animals with low methylation had
higher expression of the GR gene
and exhibited stress resilience.
o While animals with higher
methylation had lower gene
expression and increased anxiety-
like behavior under stress condition.

28. /40
Exp- Early Nutritional Effects on Epigenetic Gene Regulation (Waterland and
Randy, 2003):

29. 2003: Randy L Jirtle
Pregnant Agouti viable yellow (Avy) mice
were fed a diet high in methyl donors.
• folic acid
• choline
• vitamin B12
• betaine
Source: randyjirtle.com. 2016.
High
Me
Diet
Low
Me
Diet
X

30. CASE STUDIES

31.  Objective-
To investigated whether DNA methylation
plays a role in heterosis in plants or not.
 Material and methods-
• They compared methylation at single-
base-pair resolution in genome of
Arabidopsis thaliana ecotypes, Landsberg
and C24 parental lines and their reciprocal
F1 hybrids.
• Methylation is estimated by using bisulfite
sequencing method.
Fig.-Heterotic phenotypes of 35-d-old
Arabidopsis F1 hybrids (Flc and Fcl)
relative to their parents (Ler and C24).
1. Case study

32.  Result-
 Both reciprocal F1 hybrids exhibited
significant growth vigour in many
characters, including fresh weight,
leaf number, root length, and silique
number.
 Both hybrids displayed increased
DNA methylation across their entire
genomes.
 They found that 77 genes are
sensitive to methylome remodelling.
 These genes are transcriptionally
repressed in both reciprocal hybrids,
including genes involved in
flavonoid biosynthesis and late
elongation of hypocotyl.
Fig-Bulk methylation levels of Ler and C24 parental
lines and their reciprocal hybrids when 0 mismatch
mapping was allowed.

33.  Conformation-
• To obtain more evidence supporting
hypothesis they treated both reciprocal
hybrids and their parents with 5-aza-
deoxycytidine (59-Aza-dC), a DNA
methylation inhibitor.
• They confirmed that treatment with 59-Aza-
dC indeed caused demethylation of genomic
DNA in Arabidopsis seedlings.
• Moreover, 59-Aza-dC treatment also
inhibited the growth of both parents and
hybrids, and the hybrids were more sensitive
to 59-Aza-dC than their parents.
 Conclusion
• They concluded that DNA
methylation level is significantly
related to heterosis in Arabidopsis
thaliana .
Fig-Phenotypes of 15-d-old Flc and Fcl
seedlings treated with varying concentrations of
5’-Aza-dC.

34. /40
2. Case study
Objective –
To investigate change in genome wide methylation pattern for tolerant and
susceptible cultivars of rice, under drought stress condition.
Material and methods-
• Two varieties of rice DK151 (drought tolerant) and IR64 (drought
susceptible ) were used in the experiment.
• The DNA methylation changes in DK151 and IR64 under drought stress and
subsequent recovery were assessed using methylation-sensitive amplified
polymorphism technique (MASP).

35. /40
Drought stress
treatment
Irrigated control Recovery
Irrigation was held at
55 d after transplanting
The stress was
maintained until leaves
of the treated plants
rolled completely and
their leaf relative water
content reached 70–
75%.
Field was irrigated at
weekly intervals
Stressed plants were
recovered by
rewatering
• Tissue sample for DNA isolation: Root and Leaf tissue collected from the drought-
stressed, well-watered, and recovered plants.

36. /40
 Phenotyping results
 Under stress condition- IR64 suffered yield losses of 96.4%.
 DK151 yielded 3.1 times as much as IR64, indicating its good
level of drought tolerance.
 The better Drought tolerance of DK151 was associated with 7–
8 days of earlier heading and significantly improved fertility
and grain filling under drought.
 Under irrigated control conditions- DK151 (DT) suffered
significant yield penalty by 17.3% and its yield was 23.2%
lower than IR64 under the irrigated control conditions.

37. /40
DNA methylation changes in leaves and roots of DK 151 and IR 64

38. /40
 Drought induced genome-wide changes in DNA methylation
and demethylation patterns.
 Large difference in DNA methylation and demethylation sites
between drought tolerance and drought sensitive varieties.
 Resistant genotype is highly methylated and also retain
methylation under stress condition.
 Susceptible genotype is less methylated and lesser retention of
methylation under stress condition.

39.  Objective-
• To investigate effect of salt stress induced histone acetylation on expression of
cell wall related genes in roots of maize plant.
 Material-
• Maize variety huayu 5 was used.
 Treatment-
• Seedlings were grown in hydroponic cultures in buckets containing 1/2
Hoagland’s nutrient solution in a controlled environment.
• When the seedlings were on two leaves stage, 200 mM NaCl was added to
nutrient solution to initiate the saline treatment.
3. Case study

40. A). Effect of different salt concentrations on root growth.
B). growth in control and salt stress at different intervals.
 Phenotypic results
• After exposure to 200 mM
NaCl seedling growth was
inhibited as well as the
number of secondary roots
were reduced .
• Roots were swollen at the
elongation zone and the
length of the meristematic
zone was decreased.
• After 96 h the primary root
length was decreased by
27% and the plant height
was reduced by 26% as
compared with the control
group.

41. • Results-
• By using in situ chromatin
immunostaining technique they found
that the H3K9 and H4K5 acetylation
levels under normal growth conditions
were not significantly altered at the
indicated times but salt stress induced an
increase in global acetylation of H3K9
and H4K5 as the duration of exposure was
increased
• By using chip (Chromatin immune
precipitation)technique they found that
up-regulation of the ZmEXPB2 and
ZmXET1 genes was directly associated
with the elevated H3K9 acetylation levels.
• Conclusion-
Histone modification as a mediator
may contribute to rapid regulation of cell wall
related gene expression, which reduces the
damage of excess salinity on plants. H3K9 (A) and H4K5 (B).showing increased
acetylation level at the indicated times.
A
B

42. /40

43. /40
 Abiotic stress
Abiotic
stress
Crop Response References
Salt Wheat Lower methylation level in
tolerant cultivar
Wang et al., 2014
Heat Grapevine Transgenerational inheritance
of methylation after removal of
stress
Baranek et al., 2015
Cold Maize Increase in H3K9ac and
H4K5ac in promoter of cell
cycle genes
Zhao et al., 2014
Heavy metal Chickpea Hypomethylation in tolerant
upon prolonged exposure
Rakei et al., 2015

44. /40
 Biotic stress
 Example: Georg Jander (2007) exposed Arabidopsis plants to caterpillars
and tested what effect this had on the plants’ offspring.
 The second generation, he found that If attacked by caterpillars, offspring's
responded more strongly—reducing caterpillar growth by 40% compared to
caterpillars feeding on control plants.
From left to right, this image shows the successive generations in Jander’s experiment

45. /40
 Plant populations show phenotypic diversity, which may be
caused by genetic and epigenetic variation.
 It has recently been shown that new epigenetic variants are
generated at a higher rate than genetic variants.
 If an epigenetic variant or epiallele has a phenotypic effect and
is more or less stably inherited to the progeny, it is referred to
as an epimutant. Such epialleles contribute to the phenotypic
diversity of a population and, hence, may have a role in
adaptation and evolution.
 Epigenetic variation has been suggested as an explanation for
the missing heritability in complex traits.

46. /40
 With the help of epigenetic mapping we can identify
additional significant QTL associated with important
agronomic traits.
 A total of 125 QTL associated with seven agronomic
traits in regions having a greater density of DNA
methylation markers were identified by Yan Long et.
al., 2012 in rice plant.

47. /40
Epigenetic mechanisms can leads to variation of gene expression
in hybrids.
Fig: Genetic and epigenetic regulation of gene expression in hybrids
Guangming et al., 2013

48. /40
 Transgenic plants are routinely generated for crop improvement or
for research purposes. However, the transgene may become silenced
in following generations, posing a more serious challenge in
applying genetic engineering to crop breeding
 Transgene that are integrated into genomic regions which are
subjected to epigenetic modifications during stress treatment are
susceptible to environmentally induced silencing.
 To avoid this Screen for lines with single copy insertions of
transgene into hypomethylated regions.

49. /40
Epigenetics and cancer-
• Scientists now think epigenetics play significant role in the
development of cancer.
• An epigenetic change that silences a tumor suppressor gene could
lead to uncontrolled cellular growth. Epigenetic change that "turns
off" genes that help repair damaged DNA, leading to an increase in
DNA damage, which in turn, increases cancer risk.
Epigenetics and drugs-
• At the FDA, scientists are investigating many drugs that function
through epigenetic mechanisms.
• One such drug azacytidine has been approved for use in the United
States to treat myelodysplastic syndrome, a blood disease that can
progress to leukemia. The drug turns on genes that had been shut off
by methylation.

50. /40
 Epigenotype based products-
• Using a variety of simple
measurements and blood type data,
D'Adamo is able to classify
individuals are one of six basic
Epigenotypes: The Hunter, Gatherer,
Teacher, Explorer, Warrior and Nomad
types.
• Dr. D'Adamo has developed this 100%
vegetarian dietary supplement
customized specifically for the Nomad
genotype. It was developed to
compliment both the genetic and
epigenetic makeup.

51. /40
 The field of epigenetics has rapidly developed into one of the most
influential areas of scientific research.
 Recent advances in analytical methodology have allowed for a
significant expansion of what is known about genome wide mapping
of DNA methylation and histone modifications.
 Good knowledge of epigenetic mechanisms leads to better
understanding of regulation of gene expression at transcriptional and
post-transcriptional levels.
 Epigenetic mechanisms such as DNA methylation and histone
modification play a key role in plant development and stress
response.
 Mechanism of transgenerational epigenetic inheritance is still not
clear.

52. THANK YOU