Please write in C Clunker Motors Inc- is recalling all vehicles in its.docx

•Descargar como DOCX, PDF•

0 recomendaciones•2 vistas

Please write in C Clunker Motors Inc. is recalling all vehicles in its Extravagant line from model years 1999-2002. Given an int variable modelYear and an array of chars representing a string modelName write a statement that prints the message \"RECALL\" to standard output if the values of modelYear and modelName match the recall details. Solution Recall.c #include <stdio.h> #include<string.h> int main() { int modelYear; char modelName[50]; printf(\"Please enter model name :\ \"); gets(modelName); printf(\"Please enter modelYear \ \"); scanf(\"%d\", &modelYear); if ((strcmp(modelName, \"Extravagant\") == 0) && modelYear >= 1999 && modelYear <= 2002){ printf(\"\ RECALL\ \"); } return 0; } Output: Please enter model name : Extravagant Please enter modelYear 2000 RECALL .

Educación

Más contenido relacionado

Más de helenc18

The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain. Solution The payment of cash dividends to shareholders is classified as a financing activity. FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders. In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section. Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity. Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise). Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders. Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section. NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity. .

The sale of stock and the sale of bonds are reported as financing acti.docx

helenc18

Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves. Solution Following factors influence the precipitation volumetric analysis. 1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation. 2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions. 3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate. 4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph. 5. Temperature is directly proportional to the precipitation. 6. Foreign elements present decrease the stability of product as they can show coprecipitation. 4. .

Precipitation volumetric analysis involves formation reactions of solu.docx

helenc18

POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand Solution Answer - Similarties - Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine. both have a phosphate groups in their nucleotides. Difference - DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone. DNA contain thymine, while RNA contain uracil. complementary strand - PAIR ATÂ Â ;GC........write pair TACTAACTGTAACTCCTAGGTA .

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

helenc18

Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.) Solution Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have, .

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

helenc18

Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review. Q2. Write a biography paragraph about the scientist: Ohm. Solution Name : George Simon Ohm. He is a German Physicist. Total Life : March 16 th 1789 to July 6 th 1854. ( 65 years 3 months and 20 days ) Studies : he studied the subjects are Maths , Physics , Chemistry , Philosophy. he is a doctorate from Erlangen University. ( October 25 th 1811 ) Teaching carrier : He worked as a Teacher and Professor in various Posistions and in various places. Invention : Ohm\'s Law. V = i R V = voltage i = current R = resistance Famous Law which will be useful in the total electricity concepts. Awards : Copley Medal in the year of 1841. and Scintific career. Area of interests : Physics Especially in Electric fields. .

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

helenc18

please write carefully and explain clearly. Thank you. Solution Ksp of CoCO3 = 1*10^-10 CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq) s s Ksp = [Co^2+][CO3^2-] Ksp = s*s Ksp = s^2 1*10^-10 = s^2 s^2 = 1*10^-10 s = 1*10^-5 mole/L molar mass of CoCO3 = 118.94g/mole solubility of cobalt(II) carbonate = 1*10^-5 mole/L = 1*10^-5 mole/L * 118.94g/mole = 1.1894*10^-3g/L = 1.1894mg/L The solubility of CoCO3 = 1.1894mg/L .

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

helenc18

Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority Solution 1.Waste Prevention:Waste prevention also called â€œsource reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane 2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils. 3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion. .

Prioritize the three themes of integrated solid waste management- 1^st.docx

helenc18

present synchronized savage code while (1) { getServingFromPot (); eat (); } present synchronized cook code here while (1) { refillPot (); } Solution servings = 0 mutex = Semaphore(1) emptyPot = Semaphore(0) fullPot = Semaphore(0) <Cook> while true: emptyPot.wait() putServingsInPot(M) fullPot.signal() <Savage> while true: mutex.wait() if servings == 0: emptyPot.signal() fullPot.wait() servings = M servings -= 1 getServingFromPot() mutex.signal() eat() .

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

helenc18

Prepare general journal entries to record the following transactions for the Harris Company. (The company uses the balance sheet approach for recording bad debts expense.) 2010 Dec. 31 Recorded Bad Debts Expense, $800 2011 Jan. 3 Wrote off Jalâ€™s account as uncollectible, $60 Mar. 4 Wrote off Hallâ€™s account as uncollectible, $75 Jul. 5 Recovered $45 from Hall Aug. 19 Wrote off M. Wilsonâ€™s account as uncollectible, $100 Nov. 7 Recovered $25 from Jal Solution (1) Dec 31, 2010 DR Bad Debt Expense $800 Accounts Receivable $800 (To record bad debt expense) (2) Jan 3, 2011 DR Allowance for uncollectible receivable $60 Accounts receivable $60 (To record write-off of Jal\'s account as uncollectible) (3) Mar 4, 2011 DR Allowance for uncollectible receivable $75 Accounts receivable $75 (To record write-off of Hall\'s account as uncollectible) (4) Jul 5, 2011 DR Cash $45 Bad debt recovered (Income) $45 (To record partial recovery of bad debt from Hall) (5) Aug 19, 2011 DR Allowance for uncollectible receivable $100 Accounts receivable $100 (To record write-off of M. Wilson\'s account as uncollectible) (6) Nov 7, 2011 DR Cash $25 Bad debt recovered (Income) $25 (To record partial recovery of bad debt from Jal) .

Prepare general journal entries to record the following transactions f.docx

helenc18

Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)? Solution Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc. Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively. Different technological specifications important to be implemented in a website design are mentioned below: Technological specification varies on the basis of website or system being designed. .

Prepare functional specifications for the company-'s use of the Web an.docx

helenc18

Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting. Solution Reason One The increasing use of Internet of Thing In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws. Since these devices werenâ€™t originally registered on network, they may not have enough cybersecurity protections. so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization. Reason 2 The Breaches are a financial burden Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization. Reason 3 the real threats are insider threats The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes. Reason 4 Without cybersecurity the reputation of the organization is at risk. If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization .

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

helenc18

Más de helenc18 (11)