The document discusses various methods in molecular biology, including nucleic acid hybridization, DNA sequencing, real-time PCR, and DNA microarrays. Nucleic acid hybridization uses complementary base pairing between DNA or RNA probes and targets. DNA sequencing determines the nucleotide order using chain-terminating dideoxynucleotides. Real-time PCR quantifies DNA or RNA targets in real time using fluorescent probes. DNA microarrays allow analysis of gene expression patterns across thousands of genes.

1. Methods in molecular biology II By: KHURAM AZIZ

3. Hybridization of nucleid acids Doublestrand DNA High temperature High pH Temperature decrease, Decreasing The pH Level Denaturation - double-stranded deoxyribonucleotic acid unwinds and separates into single-stranded strands through the breaking of hydrogen bonding between the bases DNA pair by hydrogen bonds to a complementary sequence, forming a double - stranded polynucleotide

6. Hybridization of nucleid acids was used for prenatal diagnosis normal  globin sickle-cell  globin normal protein mutated protein protein patients

7. Southern blotting

10. DNA microarray (=DNA Chip) Any cells expresses, at any one time, many hundreds or even thousands of genes. Some of products are expressed at high level (e.g. actin) while others may only be expressed in a few copies. Expresion of different sets of genes Trying to identify these differences is important field of research. Different stages of maturation tumor cell vs. normal cell

17. DNA sequencing DNA sequencing is the process of determining the nucleotide order of a given DNA fragment . There are two methods of DNA sequencing: Chemical method –has been devised by Allan Maxam and Walter Gilbert . (Dideoxy) method was developed by Frederick Sanger and colleagues in 1977. Now it is used more frequently than Maxam-Gilbert method. Walter Gilbert a Frederick Sanger w ere awarded the 1980 Nobel Prize in Chemistry . Walter Gilbert Frederick Sanger

18. First step is DNA denaturation. So, we obtain single strand DNA. Labeld synthetic deoxyribonucleotide primer is hybridized to the single strand of the DNA in the next step. Then, the primer is elongated in four separate reaction mixtures containing the four normal deoxyribonucleoside triphospates (dNTPs) plus one of the four dideoxyribonucleoside triphospates (ddNTPs) in a ratio of 100 to 1. A ddNTP molecule can add at the position of the corresponding normal dNTP, but when this occurs, chain e longation stops because the ddNTP lacks a 3′ hydroxyl. In time, each reaction mixture will contain a mixture of prematurely terminated chains ending at every occurrence of the ddNTP . The oligonucleotide primer is extended using a T7 DNA p olymerase from the 5'- end of the primer. "G" tube : all 4 dNTP, ddGTP and DNA polymerase "A„ tube: all 4 dNTP, ddATP and DNA polymerase "T„ tube: all 4 dNTP, ddTTP and DNA polymerase "C„ tube: all 4 dNTP, ddCTP and DNA polymerase

19. ddNTP <<< dNTP 1 : 100 Normal deoxyribonucleoside triphospates (dNTPs) plus one of the four dideoxyribonucleoside triphospates (ddNTPs) in a ratio of 100 to 1 is beacuse of the gradual termination of the sequencing reaction.

20. Structure of a dideoxynucleotide (in this example ddCTP ) (in this example dCTP ) N ote that the hydroxyl group which is attached to carbon 3′ in normal nucleotides is replaced by a hydrogen atom. Structure of a nucleotide

21. The enzyme makes no distinction between dNTPs and ddNTPs. Each time the ddNTP is incorporated, the synthesis stop. Because a lot of DNA molecules are present in the test tube, the strand can be terminated at any G position. &quot;G&quot; tube

22. Conventional D NA sequencing. This generally involves using a radioactively labeled nucleotide and size-fractionation of the products of the four reactions in separate wells of a p olyacrylamide gel. The dried gel is submitted to au toradiography, allowing the sequence of the c omplementary strand to be read (from bottom to top). The bottom panel illustrates a practical example, in this case a sequence within the gene for type II neurofibromatosis.

23. stops DNA synthesis Newly synthetized DNA strand What do the bands in the gel mean? PAGE electrophoresis of the &quot;G&quot; reaction

24. The sequence of the original DNA template strand can be read directly from the resuling autoradiography. 3´- CTTACAGGAAAGAGATTC AGGATTCAGGAGGCCTACCATGAA We wanted to know this sequence

25. Separation of terminated fragments is common for all nucleotides The mixture of terminated fragment is subjected to gel electrophoresis in parallel

26. An alternative to the labelling of the primer is to label the terminators instead, commonly called 'dye terminator sequencing'. The major advantage of this approach is the complete sequencing set can be performed in a single reaction, rather than the four needed with the labeled-primer approach. This is accomplished by labelling each of the dideoxynucleotide chain-terminators with a separate fluorescent dye, which fluoresces at a different wavelength. M ore commonly now , fragments are then size-separated in a narrow glass tube (capillary) filled with a viscous polymer instead of electrophoresis in a slab polyacrylamide gel . The gel is placed into a DNA sequencer for electrophoresis and analysis. Each fragment is detected as it passes a laser beam at the bottom of the gel. Each type of ddNTP emits colored light of a characteristic wavelength and it is recorded as a colored band on a stimulated gel image.

27. The gel is placed into a DNA sequencer for electrophoresis and analysis. Each fragment is detected as it passes a laser beam at the bottom of the gel. Each type of ddNTP emits colored light of a characteristic wavelength and it is recorded as a colored band on a stimulated gel image. DNA sequencer

28. The computer program interprets the raw data and outputs an electropherogram with colored peaks representing each letter in the sequence

30. Cappilary Samples Ele ctrode

31. Separation of the terminated fragments according to their sizes terminated fragment

32. Automated DNA sequencers

33. ABI 3100 16-capillary array ABI 310 single capillary Capillary Electrophoresis Instrumentation

34. GISTs – gastrointestinal stromal tumors mutations in genes c-kit and PDGFRA exon 11 c-kit ,exon 12 PDGFRA –good response to imatinib exo n 17 c-kit, exo n 18 PDGFRA resistent to imatinib

37. Real Time PCR Institute of molecular biology

39. Nowadays it is needed the more precise determination of the amount of the nucleid acid, which input into a PCR reaction.

40. PCR phases 1. Exponential phase 2. linear phase 3. „plateau“ phase

42. Representation of optical detection system layout www.biorad.com 2a. excitation filters 2b. emission filters 1. halogen tungsten lamp 4. sample plate 3. intensifier 5. ccd detector 350,000 pixels

46. Real-Time PCR Applications Patients with non-small cell lung cancer, who has high EGFR mRNA expression has better response to gefitinib and prolonged progression-free survival . Gefitinib- selective inhibitor of EGF receptor tyrosine kinase Dziadziuszko, R. et al. Clin Cancer Res 2006;12:3078-3084 Copyright ©2006 American Association for Cancer Research

50. Black line indicate product with lower melting temperature Tm (81 0 C) than the other products Tm (89 0 C) Melting curve analysis This peak corresponds to one band in the agarose gel.

56. MLPA – multiplex ligation probe assay We can detect long deletions, insertions, duplications and amplifications, known mutations and we could use this method for quantification of mRNA Principle : uses probes designed to hybridize adjacently to the target sequence. After ligation, the joined probes are amplified and quantified example of using of MLPA : we can detect BRCA1 and BRCA2 mutations in hereditary breast cancers

59. Principle of MLPA. For each specific target, a set of two probes was designed that hybridize immediately adjacent to each other on the same target strand. Both probes consist of a short (22–43 nt) target-specific sequence and a universal forward or reverse PCR primer-binding site. In addition, one of the probes contains a so-called stuffer sequence. For each probe, the stuffer part has a specific length (19–364 bp) and sequence. The long probes are M13-derived. The short probes are synthetic. After an overnight hybridization to the target DNA, the two parts of each hybridized probe are joined by a ligation reaction. Next, a PCR is carried out with a single fluorescent-labeled primer pair, which ensures that the relative yield of the PCR products is proportional to the amount of target. The fragment analysis is preferably carried out on an automated capillary sequencer. The multiple fragments can be distinguished based on different length. The peak area value of each product is used to calculate the relative quantity.

60. Pyrosequencing Dideoxy DNA sequencing - 96 samples at a time ~ 30 -60 kb of sequence per 3-4 hour electrophoretic run - require electrophoresis Pyrosequencing – is able to monitor incorporation of each nucleotide in the growing DNA chain and to identify which nucleotide was being incorporated at each step.

61. DNA chains are synthesized from dNTP precursors DNA polymerase reaction causes cleavage between the  and  phosphates dNMP (containing  phosphate) is incorporated into DNA , leaving behind a pyrophospate (containing  and  hosphate) Unused dNTPs and excess ATP are degraded by the enzyme apyrase (included in reaction mixture). If selected dNTP is not needed it will be degaraded and no light is produce .

62. A ) DNA polymerase synthetizes a DNA chain by using a single-stranded DNA template and fourth Normal dNTPs. Instead of having a mixture of the four dNTPs, the individual dNTPs are provided sequentialy. When the correct dNTP is provided, the incorporation of the dNMP nucleotide is tracked by the simultaneous production of a pyrophosphate (Ppi) group that is used to produce light. Incorrect dNTP is degradated by the enzyme apyrase. B) The insertion of the correct base is monitored by light p roduction in a a two-step reaction. The released Ppi is used by the enzyme ATP sulfur y lase to generate ATP, which in turn drives a luciferase reaction to produce light, as detected by a charge-coupled device (CCD) camera.

64. 454 pyrosequencing DNA is break into short fragments (300-500 bp) and preparing single-stranded templates. Two different oligonucleotide adaptors are ligated to the ends of DNA fragments (adaptors provide universal priming sequences for amplification). Single stranded DNA templates are immobilized on beads and beads are separated from each other by creating an oil-water emulsion. Each droplet contains a single bead and the reagents needed for PCR. After PCR there are 10 milion copies of one DNA fragment on one bead. biotin streptavidin

65. Simultaneous sequencing of the entire genome in hundreds of thousands of picoliter- Size wells The emulsion is then broken to release the beads. The beads are deposited into picoliter wells on a slide (one bead per well) that are then layered with smaller beads that have ATP sulfurylase and luciferase attached to their surface. A fixed sequešnce of the dNTPs precursors (t, then A, then C, then G) is washed over the beads and chemiluminiscent light is emited each time a nucleotide is incorporated.

66. Output

68. '3 rd generation' ('next-next-generation') sequencing is knocking on the door. It permit the sequencing of single DNA molecules that are not amplified any way (Helicos Bioscience company) technology Read length Amount per 1 run Price for 1 kb Sanger 1000 bp 36 KB 10 USD 454 400 -500 bp 0,5GB 0.2 USD Solid 50bp 180GB Illumina 75bp 20GB 0.04 USD