SlideShare una empresa de Scribd logo
1 de 19
Preservation of mRNAs in Torpor
for Brown Adipose Tissue Activity
During Arousal
JORDAN SPALDING
BIOLOGY 3939
UNIVERSITY OF COLORADO
DENVER
AIMEE BERNARD, PhD
Ictidomys tridecemlineatus
Spalding Jordan, Grabek Katie, Martin Sandy
Main points
• Squirrels, hibernation and BAT
• Increase in abundance of transcripts
• Is it transcription or preservation?
13 Lined Ground Squirrels
(Ictidomys tridecemlineatus)
[1] Squirrels and Hibernation*
Hibernation
Heterothermy in Winter
Non-Shivering Thermogenesis
Torpor/Arousal Cycles
Hindle, A. (2013) Martinlab.
[iv]
Jastroch et al., Essays Biochem. (2010) 47: 53–67
Transcriptome Analysis
[2] Increase in Abundance of Transcripts*
Grabek, K. (2013). MartinLab
-1.5
-1
-0.5
0
0.5
1
1.5
2
2.5
InterBout Arousal Late Torpor Early Arousal Spring Warm
RelativeFoldChange
0
5
10
15
20
25
30
35
40
InterBout Arousal Late Torpor Early Arousal Spring Warm
BotyTemp.ºC
How does transcript abundance
increase in torpor?
Enriched for BAT activity
Cluster Enrichment
Score
No. of
Genes
Mitochondrion
4.04 27
Neutral Lipid Biosynthetic
Process 2.74 4
Lipid Catabolic Process
2.33 11
Adipocytokine Signaling
Pathway 2.17 9
Glycerolipid Metabolic
Process 2.14 12
Generation Of Precursor
Metabolites And Energy
2.08 13
Tricarboxylic Acid Cycle
2.03 5
Lipid Droplet
1.93 3
Fatty Acid Metabolism
1.38 7
Grabek, K. (2013). MartinLabFurness, D. (2013) Keele University
Stabilized
Transcription
in torpor
How can transcript abundance increase?
[3] Is it transcription or preservation?*
The experimental approach
Total RNA
Design Primers
qPCR total RNA
Hybridize Oligo(dT)Make cDNA
Clone
Sequence
Standard Curve
Elute low salt Elute high salt
qPCR long Poly(A) qPCR short poly(A)
Compare + Analyze
Compare to genome
Isolation and Sequencing
JH393516.1 137554 to 137652 (+) [LIPE (intron)]
TGGTGTCAAGCAGCCACAAA [LIPE_I8B_FOR primer] (aligned)
AAGTTGGCCGAGCCTCCTGCTGTGGTCCAGGAGACAGCTGGAACAGGGCACCAAGCAT
GGCAATAAAGCCTCATGCTGA [LIPE_I8B_REV primer] (aligned)
GSR LIPE QRSL1 BTG2 Snora
STAP2 CIDEC GAPDH Scarna OGDH
qPCR
Lipe I8B cDNA
Results
GSR LIPE QRSL1 BTG2 Snora
STAP2 CIDEC GAPDH Scarna OGDH
Transcripts with long Poly(A) tails are stable during torpor
Transcripts lacking/with short poly(A) tails decrease in torpor
Polyadenylation confers stability for select transcripts
Lipe STAP2Snora44 scaRNA 9
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
IBA LT E-Ar SpW
STAP2
Percent of Total RNA
Signal transduction
0
10
20
30
40
InterBout Arousal Late Torpor Early Arousal Spring Warm
BotyTemp.ºC
0
10
20
30
40
InterBout Arousal Late Torpor Early Arousal Spring Warm
BotyTemp.ºC
Total RNA
Long
Actual Abundance
Long
0
5
10
15
20
25
30
35
IBA LT E-Ar SpW
PercentofTotalRNA(recovered)
Conclusion
• Transcripts ‘increased’ in torpor by stabilization
• Most transcripts degraded in torpor
• Steady state decreases
Acknowledgements
• I acknowledge support from the APS’s Integrative
Organismal System Physiology Fellowship
• Thank you to Sandy Martin for being an hands-on
lab PI and persistent in developing my knowledge
• Thank you to Katie Grabek for providing technical
support and walking me through procedures
• Thanks to Allyson Hindle for help with concepts
and troubleshooting
• Thanks to Greg Florant for administrative and
technical support
• Thanks to Vishnu Raman, Ross McNeill, Kelsi
Grogan and Nico Roberts for being there for my
‘stupid’ questions.
Bibliography
i. AMREI JÄNICKE, JOHN VANCUYLENBERG, PETER R. BOAG, ANA TRAVEN,
and TRAUDE H. BEILHARZ. ePAT: A simple method to tag adenylated RNA
to measure poly(A)-tail length and other 39 RACE applications. RNA.
2012; (18)6.p1-7.
ii. Da Wei Huang,, Brad T Sherman, & Richard A Lempicki. Systematic and
integrative analysis of large gene lists using DAVID bioinformatics
resources. Nature Protocols. 2009; (4)1.p44-57
iii. Hedda A. Meijer, Martin Bushell, Kirsti Hill, Timothy W. Gant, Anne E.
Willis, Peter Jones and Cornelia H. de Moor. A novel method for poly(A)
fractionation reveals a large population of mRNAs with a short
poly(A)tail in mammalian cells. Nucleic Acids Research. 2007;(35)19.p.1-
13.
iv. Martin, Sandy. (2013) Research Strategy. p.1-17.
v. michael a. frohman, michael k. dush, and gail r. martin. Rapid
production of full-length cDNAs from rare transcripts:
Amplificationusingasinglegene-specificoligonucleotideprimer. Proc.
Nati.Acad. Sci. USA. 1988; (85) p8998-9002.

Más contenido relacionado

Destacado

Report florante at laura
Report florante at lauraReport florante at laura
Report florante at lauraisabel guape
 
Florante at laura powerpoint
Florante at laura powerpointFlorante at laura powerpoint
Florante at laura powerpointjergenfabian
 
Mga tauhan ng florante at laura
Mga tauhan ng florante at lauraMga tauhan ng florante at laura
Mga tauhan ng florante at lauralorelyn ortiza
 

Destacado (6)

Florante at Laura
Florante at LauraFlorante at Laura
Florante at Laura
 
Report florante at laura
Report florante at lauraReport florante at laura
Report florante at laura
 
Florante at Laura
Florante at LauraFlorante at Laura
Florante at Laura
 
Florante at laura buod
Florante at laura buodFlorante at laura buod
Florante at laura buod
 
Florante at laura powerpoint
Florante at laura powerpointFlorante at laura powerpoint
Florante at laura powerpoint
 
Mga tauhan ng florante at laura
Mga tauhan ng florante at lauraMga tauhan ng florante at laura
Mga tauhan ng florante at laura
 

Similar a Internship presentation

Neurotechnology Webinar Series: Dementia Biodesign
Neurotechnology Webinar Series: Dementia BiodesignNeurotechnology Webinar Series: Dementia Biodesign
Neurotechnology Webinar Series: Dementia BiodesignKTN
 
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...InsideScientific
 
The Human Microbiome in Sports Performance and Health
The Human Microbiome in Sports Performance and HealthThe Human Microbiome in Sports Performance and Health
The Human Microbiome in Sports Performance and Healthctorgan
 
Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...
Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...
Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...InsideScientific
 
Towards identifying novel phenotypes in climate adapted livestock production
Towards identifying novel phenotypes in climate adapted livestock productionTowards identifying novel phenotypes in climate adapted livestock production
Towards identifying novel phenotypes in climate adapted livestock productionSIANI
 
Ageing-associated changes in transcriptional elongation influence longevity.pdf
Ageing-associated changes in transcriptional elongation influence longevity.pdfAgeing-associated changes in transcriptional elongation influence longevity.pdf
Ageing-associated changes in transcriptional elongation influence longevity.pdfBkesNar
 
Real-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerReal-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerJoe Parker
 
Talk on Phylogenomics for MBL Molecular Evolution Course 2004
Talk on Phylogenomics for MBL Molecular Evolution Course 2004Talk on Phylogenomics for MBL Molecular Evolution Course 2004
Talk on Phylogenomics for MBL Molecular Evolution Course 2004Jonathan Eisen
 
Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...
Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...
Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...OSU_Superfund
 
iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK
iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK
iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK Cyndy Parr
 
screening model for Parkinson's disease.pptx
screening model for Parkinson's disease.pptxscreening model for Parkinson's disease.pptx
screening model for Parkinson's disease.pptxAHEMANTHBABU
 
Ecological Monitoring Techniques
Ecological Monitoring TechniquesEcological Monitoring Techniques
Ecological Monitoring TechniquesGururaja KV
 
Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...
Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...
Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...InsideScientific
 
Integrating Metabolic Phenotyping with Behavioral Neuroscience
Integrating Metabolic Phenotyping with Behavioral NeuroscienceIntegrating Metabolic Phenotyping with Behavioral Neuroscience
Integrating Metabolic Phenotyping with Behavioral NeuroscienceInsideScientific
 
Real Anti-Aging
Real Anti-AgingReal Anti-Aging
Real Anti-AgingVapula
 
Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Jonathan Eisen
 
Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Jane Landolin
 
Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...
Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...
Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...Teletón Paraguay
 

Similar a Internship presentation (20)

Neurotechnology Webinar Series: Dementia Biodesign
Neurotechnology Webinar Series: Dementia BiodesignNeurotechnology Webinar Series: Dementia Biodesign
Neurotechnology Webinar Series: Dementia Biodesign
 
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
Turn Away from Traditional Tethering and Towards a Better Method for Data Col...
 
The Human Microbiome in Sports Performance and Health
The Human Microbiome in Sports Performance and HealthThe Human Microbiome in Sports Performance and Health
The Human Microbiome in Sports Performance and Health
 
Jared Schrader Public thesis talk
Jared Schrader Public thesis talkJared Schrader Public thesis talk
Jared Schrader Public thesis talk
 
Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...
Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...
Case Studies in Home Cage Monitoring: Rodent Behavior, Circadian Biology and ...
 
Towards identifying novel phenotypes in climate adapted livestock production
Towards identifying novel phenotypes in climate adapted livestock productionTowards identifying novel phenotypes in climate adapted livestock production
Towards identifying novel phenotypes in climate adapted livestock production
 
Ageing-associated changes in transcriptional elongation influence longevity.pdf
Ageing-associated changes in transcriptional elongation influence longevity.pdfAgeing-associated changes in transcriptional elongation influence longevity.pdf
Ageing-associated changes in transcriptional elongation influence longevity.pdf
 
Real-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerReal-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe Parker
 
Talk on Phylogenomics for MBL Molecular Evolution Course 2004
Talk on Phylogenomics for MBL Molecular Evolution Course 2004Talk on Phylogenomics for MBL Molecular Evolution Course 2004
Talk on Phylogenomics for MBL Molecular Evolution Course 2004
 
Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...
Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...
Rapid In Vivo Assessment of Bioactivity in Zebrafish: High Content Data for P...
 
iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK
iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK
iEvoBio Keynote: Frontiers of discovery with Encyclopedia of Life -- TRAITBANK
 
screening model for Parkinson's disease.pptx
screening model for Parkinson's disease.pptxscreening model for Parkinson's disease.pptx
screening model for Parkinson's disease.pptx
 
Ecological Monitoring Techniques
Ecological Monitoring TechniquesEcological Monitoring Techniques
Ecological Monitoring Techniques
 
Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...
Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...
Lessons From The Core: Longitudinal Assessment vs. Point Sampling of Behavior...
 
Integrating Metabolic Phenotyping with Behavioral Neuroscience
Integrating Metabolic Phenotyping with Behavioral NeuroscienceIntegrating Metabolic Phenotyping with Behavioral Neuroscience
Integrating Metabolic Phenotyping with Behavioral Neuroscience
 
Real Anti-Aging
Real Anti-AgingReal Anti-Aging
Real Anti-Aging
 
K.A. Seifert - Algae, Protists & Fungi Plenary
K.A. Seifert - Algae, Protists & Fungi PlenaryK.A. Seifert - Algae, Protists & Fungi Plenary
K.A. Seifert - Algae, Protists & Fungi Plenary
 
Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....Diversity Diversity Diversity Diversity ....
Diversity Diversity Diversity Diversity ....
 
Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121Open pacbiomodelorgpaper j_landolin_20150121
Open pacbiomodelorgpaper j_landolin_20150121
 
Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...
Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...
Tecnología para niños con parálisis cerebral y otras discapacidades - Dra. De...
 

Último

SCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptx
SCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptxSCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptx
SCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptxRizalinePalanog2
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )aarthirajkumar25
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)Areesha Ahmad
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksSérgio Sacani
 
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...ssifa0344
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Lokesh Kothari
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptxRajatChauhan518211
 
Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPirithiRaju
 
Hubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsHubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsSérgio Sacani
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bSérgio Sacani
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...Sérgio Sacani
 
Seismic Method Estimate velocity from seismic data.pptx
Seismic Method Estimate velocity from seismic  data.pptxSeismic Method Estimate velocity from seismic  data.pptx
Seismic Method Estimate velocity from seismic data.pptxAlMamun560346
 
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...ssuser79fe74
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfmuntazimhurra
 
VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PPRINCE C P
 
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsSérgio Sacani
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxgindu3009
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfSumit Kumar yadav
 
Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)PraveenaKalaiselvan1
 

Último (20)

SCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptx
SCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptxSCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptx
SCIENCE-4-QUARTER4-WEEK-4-PPT-1 (1).pptx
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)
 
CELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdfCELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdf
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disks
 
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
TEST BANK For Radiologic Science for Technologists, 12th Edition by Stewart C...
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptx
 
Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdf
 
Hubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsHubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroids
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
 
Seismic Method Estimate velocity from seismic data.pptx
Seismic Method Estimate velocity from seismic  data.pptxSeismic Method Estimate velocity from seismic  data.pptx
Seismic Method Estimate velocity from seismic data.pptx
 
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
Chemical Tests; flame test, positive and negative ions test Edexcel Internati...
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdf
 
VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C P
 
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune WaterworldsBiogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
Biogenic Sulfur Gases as Biosignatures on Temperate Sub-Neptune Waterworlds
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdf
 
Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)
 

Internship presentation

  • 1. Preservation of mRNAs in Torpor for Brown Adipose Tissue Activity During Arousal JORDAN SPALDING BIOLOGY 3939 UNIVERSITY OF COLORADO DENVER AIMEE BERNARD, PhD Ictidomys tridecemlineatus Spalding Jordan, Grabek Katie, Martin Sandy
  • 2. Main points • Squirrels, hibernation and BAT • Increase in abundance of transcripts • Is it transcription or preservation?
  • 3. 13 Lined Ground Squirrels (Ictidomys tridecemlineatus) [1] Squirrels and Hibernation*
  • 7. Jastroch et al., Essays Biochem. (2010) 47: 53–67
  • 8. Transcriptome Analysis [2] Increase in Abundance of Transcripts* Grabek, K. (2013). MartinLab -1.5 -1 -0.5 0 0.5 1 1.5 2 2.5 InterBout Arousal Late Torpor Early Arousal Spring Warm RelativeFoldChange 0 5 10 15 20 25 30 35 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC
  • 9. How does transcript abundance increase in torpor?
  • 10. Enriched for BAT activity Cluster Enrichment Score No. of Genes Mitochondrion 4.04 27 Neutral Lipid Biosynthetic Process 2.74 4 Lipid Catabolic Process 2.33 11 Adipocytokine Signaling Pathway 2.17 9 Glycerolipid Metabolic Process 2.14 12 Generation Of Precursor Metabolites And Energy 2.08 13 Tricarboxylic Acid Cycle 2.03 5 Lipid Droplet 1.93 3 Fatty Acid Metabolism 1.38 7 Grabek, K. (2013). MartinLabFurness, D. (2013) Keele University
  • 11. Stabilized Transcription in torpor How can transcript abundance increase? [3] Is it transcription or preservation?*
  • 12. The experimental approach Total RNA Design Primers qPCR total RNA Hybridize Oligo(dT)Make cDNA Clone Sequence Standard Curve Elute low salt Elute high salt qPCR long Poly(A) qPCR short poly(A) Compare + Analyze Compare to genome
  • 13. Isolation and Sequencing JH393516.1 137554 to 137652 (+) [LIPE (intron)] TGGTGTCAAGCAGCCACAAA [LIPE_I8B_FOR primer] (aligned) AAGTTGGCCGAGCCTCCTGCTGTGGTCCAGGAGACAGCTGGAACAGGGCACCAAGCAT GGCAATAAAGCCTCATGCTGA [LIPE_I8B_REV primer] (aligned) GSR LIPE QRSL1 BTG2 Snora STAP2 CIDEC GAPDH Scarna OGDH
  • 15. Results GSR LIPE QRSL1 BTG2 Snora STAP2 CIDEC GAPDH Scarna OGDH Transcripts with long Poly(A) tails are stable during torpor Transcripts lacking/with short poly(A) tails decrease in torpor Polyadenylation confers stability for select transcripts Lipe STAP2Snora44 scaRNA 9
  • 16. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 IBA LT E-Ar SpW STAP2 Percent of Total RNA Signal transduction 0 10 20 30 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC 0 10 20 30 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC Total RNA Long Actual Abundance Long 0 5 10 15 20 25 30 35 IBA LT E-Ar SpW PercentofTotalRNA(recovered)
  • 17. Conclusion • Transcripts ‘increased’ in torpor by stabilization • Most transcripts degraded in torpor • Steady state decreases
  • 18. Acknowledgements • I acknowledge support from the APS’s Integrative Organismal System Physiology Fellowship • Thank you to Sandy Martin for being an hands-on lab PI and persistent in developing my knowledge • Thank you to Katie Grabek for providing technical support and walking me through procedures • Thanks to Allyson Hindle for help with concepts and troubleshooting • Thanks to Greg Florant for administrative and technical support • Thanks to Vishnu Raman, Ross McNeill, Kelsi Grogan and Nico Roberts for being there for my ‘stupid’ questions.
  • 19. Bibliography i. AMREI JÄNICKE, JOHN VANCUYLENBERG, PETER R. BOAG, ANA TRAVEN, and TRAUDE H. BEILHARZ. ePAT: A simple method to tag adenylated RNA to measure poly(A)-tail length and other 39 RACE applications. RNA. 2012; (18)6.p1-7. ii. Da Wei Huang,, Brad T Sherman, & Richard A Lempicki. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols. 2009; (4)1.p44-57 iii. Hedda A. Meijer, Martin Bushell, Kirsti Hill, Timothy W. Gant, Anne E. Willis, Peter Jones and Cornelia H. de Moor. A novel method for poly(A) fractionation reveals a large population of mRNAs with a short poly(A)tail in mammalian cells. Nucleic Acids Research. 2007;(35)19.p.1- 13. iv. Martin, Sandy. (2013) Research Strategy. p.1-17. v. michael a. frohman, michael k. dush, and gail r. martin. Rapid production of full-length cDNAs from rare transcripts: Amplificationusingasinglegene-specificoligonucleotideprimer. Proc. Nati.Acad. Sci. USA. 1988; (85) p8998-9002.