Maze experiment details

29
Introduction
A Major Depression disorder (MDD) manifests with the symptoms at the psychological, behavioral and physiological levels. An episoderequires the presence for at least 2 weeks of one or two core symptoms: dysphoricmood and anhedonia (a loss of interest or pleasure in activities that usually would beenjoyed). In
addition, four of the following symptoms must be present (three if bothcore symptoms are present): disturbances of sleep, feelings of worthlessness or guilt,inability to concentrate or think, increased or decreased psychomotor activity,decreased sexual drive, appetite disturbance or weight change and suicidal thoughts.
A Major Depression disorder preference is increasing. The World Health Organization estimated that in year 2020 this disorder will become the second largest health problem in human inferior to heart disease. There are three groups of antidepressant that are tricyclic antidepressants (TCAs), Monoamine oxidase
inhibitors (MAOIs), both of TCA and MAOI are the first of antidepressant shown their ability facilitated to noradrenergic and/or serotonergic neurotransmission, which correlated with behavioral excitation. But in the mid-1970s, the third group of antidepressant was found by related to serotonin, serotonin reuptake inhibitors
(SSRIs). Despite the last group is commonly prescribed in the present, there are many undesirable adverse effects of the antidepressants. Some of the various side effect from the different antidepressants are dry mouth, urinary retention, blurred vision, constipation, sedation (can interfere with driving or operating machinery),
sleep disruption, weight gain, headache, nausea, gastrointestinal disturbance/diarrhea, abdominal pain, inability to achieve an erection, inability to achieve an orgasm (men and women), loss of libido, agitation, anxiety etc(10)
These adverse side effect may cause non-compliances from the patients and resulting withfailing of
recovery of disorder. Thus, the developing safe and effective agents from traditional herbs may provide us a good way to relieve the side effects of those antidepressants.
Figure 1: The yellow pigments of curcumin that extracted fromCurcuma longa
Curcumin, a yellow pigment extracted from rhizomes of the plant Curcuma longa, has been widely used as food additive and also as herbal medicine throughout Asia. Curcumin has been reported to have antioxidant, anti-inflammatory, immono-modulatory and neuroprotective activity (8,9)
. In China, curcumin is a
major constituent of Xiaoyao-san, the traditional Chinese medicine. This regimen has been used to effectively manage mental stress and depression-related disorder.
Animal models are indispensable in clarifying the behavior and pathophysiology that underlies depression, depression–cognition interactions, and in searching for new antidepressants.Several animal models have been established, such as forced swimming test (FST), tail suspension test (TST), learned helplessness (LH)
and unpredictable chronic mild stress (UCMS). These models have been used as reliable research tools to screen effective antidepressants and to further research into pathophysiology of depression.Unpredictable chronic mild stress (UCMS) has long been used as a model of depression. In this test, mice are exposed
sequentially, over a period of weeks, to a variety of mild stressors. This model has good predictive validity (behavioral changes are reversed by chronic treatment with a wide variety of antidepressants), face validity (almost all demonstrable symptoms of depression have been demonstrated), and construct validity (UCMS
causes a generalized decrease in responsiveness to rewards, comparable to anhedonia, the core symptom of the melancholic subtype of major depressive disorder)(9)
.The anhedonia effect is most commonly used to measure the decreasing in consumption of a palatable sweet solution. In addition, UCMS animal model has been
also used to evaluate anxiety-like behaviors which is an important element in the development of depression by some behavioral assay such as the elevated plus maze and light/dark paradigm as the evaluation of anxiety-like effects (14)
. The expression of some gene may involve with depression, from our review literature
shown that Brain-derived neurotrophic factor (BDNF) is a neurotrophin important for neuronal development and synaptic plasticity. However, it has also been recently implicated in the etiology and treatment of psychiatric disorders, including depression (1)
. And a number of findings suggest that BDNF action could be
impaired in depression and stress-related affective disorders, and that BDNF is involved in the etiology of these illnesses. Chronic administration of several antidepressants, including selective serotonin reuptake inhibitors, increases BDNF expression in the hippocampus. Another study demonstrated that centrally administered
BDNF produces antidepressant-like activity in learned helplessness paradigms and the forced swim test. Therefore, up regulation of BDNF in response to antidepressant treatment could have similar behavioral effects. This is further supported by an animal study demonstrating that environmental stressors, such as
immobilization, decreased central BDNF mRNA. Indeed, chronic stress down regulates neurotrophin synthesis causing atrophy. (8)
Thus, the present study was design to investigatethe effects of curcumin on the UCMSinduced the depressive and anxiety – like behavior. The behavioral activity testswere included tail suspension test and forced swimming test (depressive – like behavior), elevated plus maze, light/dark preference and marble burying
test (anxiety-like behavior), open field test (locomotor function test)and Morris water maze task for learning and memory despair. In addition we also investigated the gene which related to the depression, BDNF expression by using beta actin as housekeeping gene.
Objectives of this study
1.To study the effect of UCMS induced behavioral changed
2.To study the UCMS on alteration of BDNF mRNA expression
3.To study the Curcumin activities on depression
4.To study the Curcumin activities on anxiety
5.To study the Effect of curcumin on BDNF expression
Materials and Methods
Animals
Male ICR mice, weight about 20 – 25 g, were obtained at the age of 3 weeks. They were housed in groups of 6 – 7 per cage. Housing conditions were thermostatically maintained at ambient temperature (22 ± 1 °C) and 12 hours light/dark cycle. They were fed with standard diet and water ad libitum and were allowed to
acclimate 7 daysbefore they were used. In case of sucrose preference, animals were fasted for 18 hours before sucrose consumption. They were randomly divided into 5 groups, which are non-stressed control group and the other 4 groups of stressed mice with unpredictable chronic mild stress.
Drugs and drug administration
After 21 days of continuous to the UCMS sequence of the below-described, mildly stressful situation, when sucrose consumption was reduced significantly in stressed animals to levels not significantly different among them, the four groups of stressed animals were assigned randomly to one of the following treatment: (1)
vehicle control, carboxymethlycellulose (CMC) solution, (2) curcumin(MP Biomedicals), 10 mg/kg body wt.; (3) curcumin, 20 mg/kg body wt.; (4) Imipramine (Nacalaitesque), 20 mg/kg body wt. All drugs were administered intraperitoneally (i.p.) once daily for last two weeks of UCMS.
Unpredictable chronic mild stress
At the start of the experiment, the animal were first trained to consume a 2% sucrose solution for a 48-h period in their cages with no food or water following food and water deprivation for 18 h. They were given sucrose for 1 h per day on the five consecutive days at the end of training in order to group the mice. The mice in
the experimental groups were then subjected to UCMS for 5 weeks. The UCMS procedure consisted of a variety of unpredictable mild stressors including two periods of tilted cage 45° (12h), two periods of 1 h restricted access to food (5 micropellets), two periods of exposure to empty bottle (3h), one period of 21 h wet cage
(200 ml water in 100 g sawdust bedding), two periods of light exposure (36h), two periods of intermittent sound (3h, 5h), two periods of paired caging (2h) and food and water deprivation for 18 h before 2% sucrose solution consumption. These stressors were randomly scheduled over a one-week period and repeated
throughout the 5-week experiment.
file:///D:/Firm/R & D/maze experiment details.htm
1 of 10 09-07-2013 22:43

Sucrose consumption
Sucrose intake were measured once weekly after the end of UCMS, 18 h of food and water deprivation. Consumption was measure by weighing the pre-weighed bottle at the end of the test. Baseline was measured at the week 0 before started of UCMS.
Tail suspension test
Figure 2: The position of mice during the tail suspension testing
The tail suspension test allows fast evaluation of drugs psychotropic effects. The animals were subjected to the short-term, inescapable stress of being suspended by their tail and develop an immobile posture. Animals were suspended 50 cm above the floor by means of an
adhesive tape, placed approximately 1 cm from the top of the tail. The time during which mice remained immobile was measured during a test period of 6 min. Mice were considered immobile only when they hung passively and completely motionless. Immobility time is
defined as the activity of stressed mice.
Forced swimming test
Figure 3: The mice were tested within the cylinder glass and recorded by camera for analysis
The mice were individual to swum for 15 min in glass cylinder (height: 27 cm, diameter: 20 cm) containing 10 cm of water at 25°C for pretest. A 24-h after pretest, mice were placed in glass cylinder again for 6 min test and was recorded the last 4 min of testing period. A mouse was judged to be immobile when it discontinued
struggling and remained floating motionless in the water, making only a small movement necessary to keep its head above water.
The Morris water maze
Figure 4: Setting of the Morris Water Maze Test
The Morris water mazeis a test of capacity of mice to learn, and retrieve, spatially encoded information; instead we are restricted to asking the mice to solve a problem for which the ability to learn and remember a spatially cued task will significantly enhance performance. This test was performed from day 28 of UCMS. One
day before the start of training, the mice were given a pre-training session in which they were allowed to swim freely in a water tank for 90 s without escape platform. The tank was placed in a dimly lit, soundproof test room with various visual cues. In the training block, the tank was filled with 15 cm depth with water
maintained at 25 ± 1°C. A transparent platform was put 1 cm below the surface of water. The tank was divided into four quadrants with a platform in a fixed position in one quadrant. Daily training consisted of four trials in whichthe mouse was placed in the water from four random startingpositions (N, E, S, W) and the
latency of escaping onto theplatform was recorded. This was conducted for 5 consecutivedays. A maximum of 90 s was allowed during which the mousehad to find the platform and climb onto it. On the sixth day ofthe MWM, each mouse was subjected to a probe test where no platform present. The time of swimming in the
former platformquadrant and the total time of swimming in all four quadrants were recorded for 90 s. The percentage of swimming in thequadrant of the former platform was calculated as a measurementof spatial memory. The MWM sessions were recordedwith a video camera for offline analyzing.
Open field analysis
Figure 5: the mouse was placed in the center of open field box
In the last week of UCMS and drug exposure, the open field analysis was performed. The open field apparatus consists of a black walls and base divided into 16 (4 × 4) identical sectors by white stripes. The animals were placed in the central sector and measured the movement of mice for 5 min manually. The open field arena
was thoroughly cleaned between each test. Motility was scored when animals crossed a sector border with both its hind limbs or rearing and grooming and report as number of squares/min. This test can determine the effect of drug on motor function.
Light/Dark preference
Figure 6; during the mouse taken in light zone
The light dark (LD) test is used to evaluate the relative anxiety status of mice. The light dark paradigm in mice is based on a conflict between the innate aversion to brightly illuminated areas and the spontaneous exploratory activity. If given a choice between a large brightly compartment versus a small dark
compartment, mice spontaneously prefer the dark. Anxiolytic compounds have been found to increase the total duration of time spent there. Anxiogenic compounds are observed to work in the opposite way.
2 of 10 09-07-2013 22:43

Elevated plus-maze
Figure 8; the elevated plus-maze apparatus
The elevated plus-maze was constructed from black acrylic plateand elevated to a height of 50 cm. It consisted of two open arms (50 x 10 cm) and two enclosed arms (30 x 5 x 15 cm). Each mouse was placed in the central square facing an open arm, and allowed to explore the maze for 5 min. The maze was cleaned
thoroughly before each test. The percentage of time spent on the open arms (time on open arms/(time on open arms + time on closed arms) x 100), the percentage open arm entries (open arm entries/total entries x 100), and total number of entries were determined. An entry was defined as three of the four paws being on the
arm.
Marble burying test
Figure 9; the result of marble burying test
The marble burying test is used to record the number of marbles buried by mice placed in a novel environment. Mice, which are placed individually in a cage, bury glass marbles that are present in the cage. This test has some predictive value for anxiety-like effect drugs. This test consists in placing 5×4 of marbles on
the 5-cm of sawdust and count the amount of marbles were buried by mouse for 30 minutes.
Sample collection
The samples were decapitation and brain sample collection
P
Inferior vena cava
reparation for brain sample collection was required the perfusion technique to get rid the blood, in this picture shown the target site (portal vein) and cut the inferior vena cava later for release the blood out.
1.
Liver
We were used normal saline to perfuse, as you can see the picture the color of liver are paling down.2.
The whole brain was collected and selected the frontal cortex, for the other part of the brain was keeping for next study.3.
Brain
Semi-quantitative reverse transcriptase polymerase chain reaction.
RNA extraction
1. Homogenize frontal cortex of UCMS in 1 ml of TRIZOL Reagent per 50-100 ng of tissue. The sample volume should not exceed 10% of the volume of TRIZOL Reagent used for homogenization.
2. Add 0.2 ml of chloroform into homogenate sample. Cap sample tubes securely. Shake tubes vigorously by hand for 15 seconds and incubate them at 15 to 30C for 2 to 3 minutes.
3. Centrifuge the samples at no more than 12,000 X g for 15 minutes at 2 to 8 °C.
4. After centrifugation, the mixture separates into a lower red, phenol-chloroform phase, an inter phase, and a colorless upper aqueous phase. RNA remains exclusively in the aqueous phase. The volume of the aqueous phase is about 60% of the volume of TRIZOL Reagent used for homogenization.
Figure: 11 Show the separation of RNA, DNA and Organic phase
5. Transfer the aqueous phase to a fresh tube and precipitate the RNA from the aqueous phase by adding to the aqueous phase 0.25 ml of isopropyl alcohol
6. Mix the resulting solution, centrifuge at 12,000 X g for 15 minutes at 4°C. The RNA precipitate, often invisible before centrifugation, forms a gel-like pellet on the side and bottom of the tube.
3 of 10 09-07-2013 22:43

Genes Primer Sequences Product size
Beta-actin Forward AACGGTCTCACGTCAGTGTA
220
Reverse GTGACAGCATTGCTTCTGTG
BDNF Forward GACAAGGCAACTTGGCCTAC
334
Reverse CCTGTCACACACGCTCAGCTC
7. Delicately decant the supernatant
8. Wash the RNA pellet with ice-cold 75% ethanol, adding at least 1 ml of 75% ethanol per 1 ml of TRIZOL Reagent used for the initial homogenization
9. Mix the samples by vortexing and inversion. Repeat above washing procedure once. Remove all leftover ethanol.
10. Re-suspend the RNA pellet in 40 ul of Rnase-Dnase free water and proceed on to quantitation of total RNA.
Quantifying total RNA
1. Dilute 1 µl of RNA with 39 µl of RNase free distilled water water (1:100 or 1:200 dilution). read the absorbance at 260 and 280 nm. A260/A280 ratio > 1.6. Ensure the spectrophotometer is blanked to reading absorption. Calculate the concentration of RNA. Apply the convention that 1 OD at 260 equals 40 µg /ml RNA.
Preparing the 0.5ug/ml tRNA
1. Pipette RNA samples equivalence to total RNA 30 µg and adjust all samples to the same volume with RNase free water.
2. Add 2M NaCl 0.1 volume and 99% EtOH 2.5 volume. Store at -20 c° over night.
3. Centrifuge all samples at 15,000 x g for 15 minutes at 4 c°.
4. Decant the supernatant and place the tubes invertly.
5. Add 200 µl of cool 70% EtOH. Mix the sample by vortexing.
7. Centrifuge all samples at 15,000 x g for 15 minutes at 4 c°.
8. Decant the supernatant. Dry up the sample by placing the tubes invertly.
9. Reconstitute with RNase free distilled water 60 µl. Mix the sample by vortexing.
10. Total RNA 0.5 µg/ml is obtained. Store at -20 °c
First-strand cDNA synthesis.
1. Add the following components to a nuclease-free microcentrifuge tube:
1 µl oligo (dT)12-18 (500 µg/ml).
1 ng to 5 µg total RNA of mRNA
1 µl 10 mM dNTP Mix (10 mM each dATP, dGTP, dCTP and dTTP at
neutral pH) Sterile, distilled water to 12 µl
2. Heat mixture to 65°C for 5 min and quick chill on ice. Collect the contents of the tube by brief centrifugation and add:
4 µl 5X First-Strand Buffer
2 µl 0.1 M DTT
1 µl RNaseOUT™ Recombinant Ribonuclease Inhibitor (40 units/µl)
3. Mix contents of the tube gently and incubate at 37°C for 2 min.
4. Add 1 µl (200 units) of M-MLV RT, and mix by pipetting gently up and
down. If using random primers, incubate tube at 25°C for 10 min.
5. Incubate 50 min at 37°C.
Polymerase chain reaction.
Time required:
Around 7 hours1.
PCR reaction: 3-6 hours, Polyacrylamide gel electrophoresis using "ATTO" gel apparatus: 1.5 hours2.
Ethidium bromide staining and photography: 45 minutes3.
Special reagents:
5X PCR Buffer (250 mM KCl, 50 mM Tris-HCl pH 8.3, 7.5 mM MgCl2)1.
Mixture of four dNTPS (dGTP, dATP, dTTP, dCTP) each at 2.5 mM The dNTP mixture is made by adding equal volumes of a 10 mM solution of each of the four separate dNTPs together.2.
Taq DNA Polymerase3.
Acrylamide (electrophoresis grade)4.
N,N'-Methylenebisacrylamide5.
10% Ammonium persµlfate6.
TEMED (N,N,N'N' Tetramethylethylenediamine,7.
Primer sequence8.
The following components will make up one reaction (5 µl total volume), but a cocktail of everything except the DNA will be made first:
4 µl 5X PCR Buffer
2 µl dNTP mixture (each at 2.5 mM)
2 µl Primer pair (each primer at 25 µM)
0.4 µl Taq polymerase
8.6 µl ddH2O
Because of the small volumes involved, it is convenient to make a cocktail, then a cocktail may be made (including a slight excess) for 13 reactions by mixing together each of the volumes. Then be added to the 1.0 µl of cDNA in each tube.
Steps:
Plan your experiment before adding any reagents (#primer pairs to be used, number of DNA templates, etc.). After doing so, make the appropriate cocktail/s and ensure complete mixing by tapping the tube and quick spinning. (Caution should be used to avoid contamination of reactions with even small amounts of
DNA. In addition, care should be taken to avoid contamination of pipetmen with carry over amplification products from previous reactions)
1.
Pipet 19 µl of the appropriate cocktail directly into the bottom of a sterile microeppendorf tube for each reaction. The tubes should be labeled by placing a round sticker on the cap to prevent smearing by oil in subsequent steps.2.
Add 1.0 µl of the DNA directly into the drop of cocktail in each tube and ensure adequate mixing. Quick spin to collect the reaction mixture in the bottom of the tube.3.
Place the tightly capped tubes in the temperature block and make sure each is firmly4.
After completion of the PCR reaction, remove the tubes from the temperature block then placing in an eppendorf rack.5.
Carefully remove only the aqueous "bubble", dissolve this problem by set to 7-8 µl by placing the pipet tip against the bubble and slowly drawing it in. Each sample should then be placed in a separate clean eppendorf tube before loading onto the polyacrylamide gel.6.
The reaction products are conveniently separated according to size by electrophoresis through a 10% polyacrylamide gel at 120 V for 1.5-2 hours, and visualized after staining the gel with ethidium bromide.7.
Run gel electrophoresis
Pouring and Running Polyacrylamide Gels electrophoresis unit: Acrylamide is a neurotoxin and should be handled with caution. Wear gloves at all times when handling acrylamide and be careful to avoid spills.
Clean the multiple gel caster and place flat on the bench top in front of you. Place the rubber gasket in its groove without stretching it.1.
Build the gel casting units by carefully placing and seating components in the following order from the bottom up2.
Place the top cover on the multiple gel caster3.
Mix the ingredients in a clean beaker, as detailed in the recipe below for a 10% polyacrylamide gel. Add the TEMED with thorough mixing just before pouring the gels.4.
Carefully pour the acrylamide evenly into the gel casting units in the multiple gel caster until the multiple gel caster is almost overflowing.5.
Insert the appropriate sized comb into each gel casting unit, and allow the acrylamide to polymerize for at least 1 hour. After complete polymerization, the gels may be wrapped in cellophane and stored at 4 degrees6.
The gels was done on the condition 120 volt constant, 60 mA, time spend around 1.5-2 hours7.
Acrylamide gel solution
Acrylamide 3.6 ml
dH20 19.2 ml
TEMED 12 µl
10%Ammonium
persulate
720 µl
50X TAE 440 µl
Note : this suolution for 2 plates
Measuring band intensity
After run gels were finished, the gels were dying with Ethidium bromide solution, slightly wash gels with gently shakes around 15 mins.1.
4 of 10 09-07-2013 22:43

Take the gels out from Ethidium bromide solution and Gel Doc was using in the camera capture of the genes.2.
The GeneSnap and Gene Tools Match, these programs were used on the interpretation intensity of the genes.3.
Although, capture pictures gel from Gel Doc are not have the same intensity, but for measuring we have reduced the unequal intensity of each gel by using the filter background intensity function. Only bands are measured and not interfered from unequal intensity on each of its background. The intensity ratio of control and
treatment group were calculated and reported as relative gene expression (BDNF/β-actin).
Statistical applying
For our study Sigma stat program was used for analyzed data and One-way ANOVA was applied for our experiment.
Results
Sucrose consumption
Figure 12: Effects of Curcumin on sucrose consumption of mice exposed to unpredictable chronic mild stress (UCMS) (mean ± S.E.M., n = 10 – 13). Chronic treatment of Curcumin (10, 20 mg/kg, i.p.) was given the last 2 weeks of the 5-week unpredictable chronic mild stress procedure. #P< 0.05 compared with non-stressed control group; *P< 0.05 compared with UCMS + vehicle group.
In the sucrose solution-training phase (base line phase, week 0), sucrose consumption did not differ significantly among the group. The UCMS gradually reduced the consumption of the 2%sucrose solution from 74.14 mg/kg in the base line week to 22.91 mg/kg in the last week of UCMS procedure. Treatment with curcumin
and imipramine caused a gradual recovery of the sucrose intake. The decreasing of sucrose preference in all groups of in the last 2 weeks, which is drug treatment period, may cause from the injection of drug. Despite the injection of drug was made them like exposed to stress condition, the mice showed recovery of sucrose
intake in the last week of UCMS procedure. At the end of 4 weeks of UCMS and drug administered, the amount of sucrose preference taken by the stressed mice receiving curcumin and imipramine were significantly higher than the vehicle-treated stressed mice. It appears therefore that curcumin might be more efficacious
than imipramine in restoring the sucrose consumption in UCMS stressed mice.
Forced swimming test and tail suspension test
Figure 13: Effect of curcumin on the forced swimming test of UCMS stressed mice (mean ± S.E.M., n = 8 – 12). The mice were administered vehicle, curcumin (10, 20 mg/kg, i.p.) or imipramine (20 mg/kg, i.p.). The mean immobility time of stressed-control mice was 200.57 ± 11.02 s. The respective percent reduction in immobility time was 21.81%, 23.88% and 14.15% for curcumin 10 mg/kg,
20 mg/kg and imipramine 20 mg/kg. #P < 0.05 vs. the stressed-control mice.
Figure 14: Effect of Curcumin on the tail suspension test of UCMS stressed mice (mean ± S.E.M., n = 8 – 12). The mice were administered vehicle, curcumin (10, 20 mg/kg, i.p.) or imipramine (20 mg/kg, i.p.). The mean immobility time of stressed-control mice was 108.76 ± 8.08 s. The respective percent reduction in immobility time was 19.75%, 40.90% and 43.35% for curcumin 10 mg/kg, 20
mg/kg and imipramine 20 mg/kg. #P < 0.05 vs. the stressed-control mice.
The effect of administration with curcumin in forced swimming test and tail suspension test at the dose of curcumin with 10 and 20 mg/kg and imipramine with 20 mg/kg. The duration of immobility time in forced swimming test, resulting in 21.81%, 23.88% and 14.15% immobility significant reduction of dose with
curcumin 10, 20 mg/kg and imipramine 20 mg/kg, respectively compared to the UCMS stressed-control mice. In the tail suspension test, with the same doses and rout of administration of curcumin and imipramine also significantly inhibited immobility with a respective percent reduction of 19.75%, 40.90% and 43.35%. In
both models of depression, the effects of curcumin were similar to those observed for the classical antidepressant Imipramine (20mg/kg).
Open field analysis
Figure 15: Effect of curcumin on the open field analysis activity (mean ± S.E.M., n = 8 –12). Chronic treatment of vehicle, curcumin with 10, 20 mg/kg and imipramine 20 mg/kg was given during last 2 weeks of UCMS procedure and resulting in significant difference between imipramine and stressed-control mice group (#P < 0.05) but not differently significant between the non-stressed control
group and the stressed-control group.
5 of 10 09-07-2013 22:43

The open field test showed the reduction of number of squares/min significantly differences between imipramine 20 mg/kg treated group and stressed-control group and the other group had no signigficantly differences when compared among groups.
Elevated plus maze
Figure 16: Effects of curcumin on the elevated plus maze of UCMS stressed mice (mean ± S.E.M., n = 8). The result showed no significantly differences between among groups.
In the elevated plus maze activity, mice were showed the decreasing of time preferences but had no significantly differences among groups.
Marble burying test
Figure 17: Effect of Curcumin on the marble burying test with the UCMS mice (mean ± S.E.M., n = 11 – 12). Data analysis was performed using one way ANOVA. #P < 0.05 compared with non-stressed control, *P < 0.05 compared with stressed-control.
In the marble burying test, the greater number of buried marble correlate with the greater severity of anxiety. The amount of buried marbles in the non-stressed control, UCMS-control and curcumin treated had no significantly differently among these groups. Onlyimipramine treated mice showed significantlydifference when
compared to the stressed-control mice and non-stressed control moce.
Light/Dark preference
According to the UCMS procedure in the last week of these stressors were given to the mice, the light/dark preference test showed the reduction of dark zone preference in group of curcumin and imipramine 20 mg/kg treated compared to stressed-control group with significantly differences. In light zone, the 20 mg/kg of
curcumin and imipramine treated also showed the induction of time preference with significantly differences. The respect percentage of dark zone timereduction were 21.75%, 31.73% and 31.28% in dose of curcumin and imipramine compared to stressed-control mice. The mean of time preference of dark zone of UCMS
group was 214.34 ± 1.38. The percentage time induction of light zone were 54.15%, 79.01% and 77.90% in dose of curcumin and imipramine compared to stressed-control mice. The mean of light time preference in the light zone of UCMS group was 85.96 ± 9.87.
Figure 18: Effect of Curcumin on light-dark preference with the UCMS stressed mice and non-stressed control (mean ± S.E.M., n = 8 – 12), #P < 0.05, compared between curcumin 20 mg/kg and imipramine20 mg/kg with the stressed-control mice.
The BDNF gene expression
The results presented BDNF gene respond of UCMS in the frontal cortex of mice after treatments, the BDNF gene were prepared by semi-quantitative RT-PCR. After that the intensity of band were used for measuring the gene expression of BDNF gene. And β-Actin Gene was used as control for BDNF intensity measuring.
220 bp
β-Actin Gene
334 bp
6 of 10 09-07-2013 22:43

BDNF Gene
Fig 19. Gel electrophoresis of β-actin and BDNF
In the first row (left) show the 1 kilo base pair plus ladder. β-Actin is the house keeping gene and BDNF gene is express when in stress condition, these are 2 genes were used in this study. Its product size of β-Actin is 220 bp and BDNF is 334 bp respectively. The results show that the intensity of β-actin are equivalence for all
samples, the intensity average is 231274.09. BDNF relative gene expression was used to determine the expression by reported as the picture next page.
β-Actin
BDNF
Control UCMS+Vehicle UCMS+Cur10 UCMS+Cur20 UCMS+IMI
7 of 10 09-07-2013 22:43

Fig 20. Relative gene expression (BDNF/β-actin) in frontal cortex of mice after has UCMS exposure and treatments. was used one-way ANOVA indicated effect of relative mRNA expression
Effect of Curcumin on relative mRNA expression with the UCMS stressed mice on chronic curcumin treatment 10 mg/kg and 20 mg/kg i.p. on UCMS were changed by increased, (mean ± S.E.M, n = 4-6), (p# < 0.05) , whereas UCMS+vehicle was decreased (p# < 0.05). And UCMS+IMI were increase attenuated BDNF
levels. (p# <0.05), whereas each treatments compare with control group.
Discussion
The UCMS model of depression involves in the presentation of a series of varied and unpredictable environment stressors, such as two periods of tilted cage 45° (12h), two periods of 1 h restricted access to food (5 micropellets), two periods of exposure to empty bottle (3h), one period of 21 h wet cage (200 ml water in 100 g
sawdust bedding), two periods of light exposure (36h), two periods of intermittent sound (3h, 5h), two periods of paired caging (2h) and food and water deprivation for 18 h. Following such exposure, mice have been reported with anhedonia effect, measured by 2% sucrose consumption. To assured these results are from
UCMS procedure and sucrose preferences; we performed the behavioral activities to test the effects of curcumin substances and used the classical antidepressant, imipramine, as standard of treatment. Anti depressive activities of curcumin were determined by FST and TST that are the screening test for searching the
antidepressant drug. The openfield test was performed to determine the effect of antidepressant on locomotor function. This test is used to evaluate the false positive results from other drugs that can induce hyperlocomotor activity. The chronic treatment of curcumin decreased the immobility time in both FST and TST without
the effect on locomotor activity.
In addition, there are 2 studies of the anxiety test in this study was performed to determine the effect of curcumin in antianxiety, which are marble burying, elevated plus maze and light/dark preferences. These study were exhibited the antianxiety relate to curcumin effect. There are only two activities that can determine the
significant level of activity that are reduction in the marble burying, only mice were treated with imipramine showed the significance differently when compared to the stressed-control mice and in the light/dark activity showed that the reduction in the dark zone had significant differences when compared to stressed-control to
curcumin 20 mg/kg and Imipramine 20 mg/kg. UCMS activity could be altered by chronic antidepressant medication and Long-term curcumin consumption increased the BDNF mRNA expression. Interestingly, we found that curcumin increased BDNF levels quite similar to the imipramine (p > 0.05) In fact; chronic
antidepressants could produce long-term adaptationin cellular signaling mechanisms in mice. The ability of curcumin to up-regulate BDNF mRNA expressionis also considered to prove its potential as antidepressant agent. Some mechanism have an involve with curcumin to explain, why it is involve to depression increased
cell proliferation andneuronal populations may be a mechanism by which curcumin treatment overcomes thestress-induced behavioral abnormalities and neuronal damage. Moreover, curcumin treatment, via up-regulation of 5-HT1A receptors and BDNF, may reverse or protect neurons from further damage in response to
chronic stress, which may underlie the therapeutic actions of curcumin . And the topic of dose of curcumin 10 mg/kg and 20 mg/kg are not different on relative gene expression, they are seem to the dose of curcumin 10 mg/kg, 20 mg/kg gives the efficiency to promote BDNF mRNA expression closely for each other,
Conclusion
The effect of Curcumin can reversed the decrease of Anhedonicbehavior, whichinvolves with depressionby monitor the sucrose consumption. These changes were reversed by chronic curcumin administration (10 or 20 mg/kg, p.o.). According to 2% sucrose consumption, at the last 2 weeks of UCMS procedure, resulting in
significantly differences of sucrose consumption among their groups. In the group of Curcumin and Imipramine treated, the mice showed the induction of sucrose preferences compared to the stressed-control mice.The effect of administration with Curcumin in forced swimming test and tail suspension test at the dose of
Curcumin with 10 and 20 mg/kg and Imipramine with 20 mg/kg. The duration of immobility time in forced swimming test, resulting in 21.81%, 23.88% and 14.15% immobility reduction of dose with Curcumin 10, 20 mg/kg and Imipramine 20 mg/kg, respectively compared to the UCMS stressed-control mice. In the tail
suspension test, these same doses of Curcumin and Imipramine also significantly inhibited immobility with a respective percent reduction of 19.75%, 40.90% and 43.35%. In both models of depression, the effects of Curcumin were similar to those observed for the classical antidepressant Imipramine (20mg/kg). In case of
open field test, they showed no differences among their groups but there is significantly differences between stressed-control and Imipramine mice and showed as the same result as light/dark preference. The light/dark preferences showed the percentage of time reduction in dark zone and induction time in light zone of mice
were treated with Curcumin and Imipramine compared to the stressed-control mice. In addition, we also found that the unpredictable chronic stress procedure induced a down-regulation of brain-derived neurotrophic factor (BDNF) protein levels (1), in the frontal cortex of UCMS mice. Furthermore, these stress-induced
decreases in BDNF were also blocked by chronic curcumin administration (10 or 20 mg/kg, i.p.). These results provide compelling evidence that the behavioral effects of curcumin in chronically stressed animals may be related to their modulating effects on other organ. In addition some evidence has hypothesis that, curcumin
has an property of MAO inhibitor that was effect on Catecholamine neurotransmitter(6) such as Serotonin, Epinephrine, Dopamine etc. these are regulate the function of mood. Although BDNF gene we have selected in this study but many gene are relevant on the depression not only BDNF gene and also should be study
further gene expression on the other organs.
Reference
1. Angelucci F, Brene S, Mathe AA. BDNF in schizophrenia, depression and corresponding animal models. Mol Psychiatry. 2005 Jan 18;10(4):345-352.
2. Chen Y, Wang H, Xia X, Kung H, Pan Y, Kong L., 2007. Behavioral and biochemical studies of total furocoumarins from seed of Psoralea corylifolia in the chronic mild stress model of depression in mice. Phytomedicine. 14, 523-529.
3. Fumagalli F, Racagni G, Colombo E, Riva MA. BDNF gene expression is reduced in the frontal cortex of dopamine transporter knockout mice. Mol Psychiatry. 0 ;8(11):898-899.
4. Holmes A, Murphy DL, Crawley JN. Reduced aggression in mice lacking the serotonin transporter. Psychopharmacology (Berl). 2002 May ;161(2):160-7.
5. Li Y, Wang F, Pan Y, Qiang L, Cheng G, Zhang W, et al. Antidepressant-like effects of curcumin on serotonergic receptor-coupled AC-cAMP pathway in chronic unpredictable mild stress of rats. Progress in Neuro- Psychopharmacology and Biological Psychiatry. 2009 Apr 30;33(3):435- 449.
6. Li S, Wang C, Wang M, Li W, Matsumoto K, Tang Y., 2007. Antidepressant like effects of piperine in chronic mild stress treated mice and its possible mechanisms. Life Sci. 80, 1373-1381.
7. Li S., Wang c., Wang M, Yukihisa M, Kinzo M., 2006. Imparment of the spatial learning and memory induced by learnhelplessness and chlonic mild stress. Pharmcology. Biochemistry and Behavior 83, 186 – 193.
8. Motterlini, R., Foresti, R., Bassi, R., Green, C.J., 2000. Curcumin, an antioxidant and anti-inflammatory agent, induces heme oxygenase-1 and protects endothelial cells against oxidative stress. Free Radic. Biol. Med. 28, 1303– 1312.
9. Thiyagarajan, M., Sharma, S.S., 2004. Neuroprotective effect of curcumin in middle cerebral artery occlusion induced focal cerebral ischemia in rats. Life Sci. 74, 969–985.
10. Wang R, Xu Y, Wu H, Li Y, Li Y, Guo J, Li X., 2008. The antidepressant effects of curcumin in the forced swimming test involve 5-HT1 and 5-HT2 receptors. Eur. J. Pharmacol. 578, 43-50.
11. Willner, P. 1997. Validity, reliability and utility of the chronic mild stress model of depression: a 10-year review and evaluation.. Psychopharmacology (Berl) 134, 319-29.
12. Woelk, H. 2000. Comparison of St John’s wort and imipramine for treating depression: randomised controlled trial. British Medical Journal, September 2.
13. Xu Y, Ku B, Cui L, Li X, Barish PA, Foster TC, et al. Curcumin reverses impaired hippocampal neurogenesis and increases serotonin receptor 1A mRNA and brain-derived neurotrophic factor expression in chronically stressed rats. Brain Research. 2007 Aug 8;11629-18.
14. Xu Y, Ku B, Tie L, Yao H, Jiang W, Ma X, Li X., 2006. Curcumin reverse the effect of chronic stress on behevior, the HPA axis, BDNF expression and phosphorylation of CREB. Brain Res. 1122, 56-64.
15. Xu Y, Ku B, Yao H, Lin Y, Ma X, Zhang Y, Li X., 2005. The effect of curcumin on depressive-like behaviors in mice. Eur. J. Pharmcol. 518, 40-46.
15. Yann S. M., Catherine B., Wim E. C. 2006. Effects of unpredictable chronic mild stress on anxiety and depression-like behavioral in mice. Behavioral Brain Research. 175, 43 – 50.
8 of 10 09-07-2013 22:43

Appendixes
Result from the behavioral activities
Sucrose consumption test
Groups Week0 Week1 Week2 Week3 Week4 Week5
Control 79.84 77.85 79.34 79.37 60.84 61.58
CMS 74.14 48.25 46.24 41.45 27.40 22.91
CMS+Cur10 77.02 52.89 51.73 36.23 22.21 34.16
CMS+Cur20 78.16 52.42 44.13 38.62 41.43 42.70
CMS+Imi20 77.71 54.66 50.00 42.27 36.36 37.36
Forced swimming test
Groups Immobility time SEM
Control 151.06 11.47
UCMS 200.57 11.02
UCMS+Cur10 156.83 13.05
UCMS+Cur20 152.68 10.74
UCMS+Imi20 172.19 11.49
Tail suspension test
Groups Immobility time SEM
Control 74.48 8.05
UCMS 108.76 8.08
UCMS+Cur10 87.28 12.85
UCMS+Cur20 64.28 9.35
UCMS+Imi20 61.61 13.35
Open field analysis
Groups Number of squares / min SEM
Control 19.43 5.87
UCMS 28.90 9.63
UCMS+Cur10 27.95 6.95
UCMS+Cur20 28.57 5.29
UCMS+IMI 22.28 7.39
Marble burying test
Groups Marble buried SEM
Control 16.25 1.25
UCMS 17.83 0.59
UCMS+Cur10 16.55 0.98
UCMS+Cur20 16.08 0.55
UCMS+IMI 7.58 1.73
First strand DNA (Master Mix 1)
Reagents X1 (12 µl) X34 (340 µl)
1 µl oligo (dT)12-18 1 µl 34 µl
5 µg total RNA of mRNA 2 µl 68 µl
dNTP mix (10nm) 1 µl 34 µl
9 of 10 09-07-2013 22:43

RNase free water qs. 8 µl 274 µl
First strand DNA (Master Mix 2)
Reagents X1 (8 µl) X34 (272 µl)
5X buffer 4 µl 136 µl
0.1 M DTT 2 µl 68 µl
RNase inhibitor 0.2 µl 6.8 µl
RNase free water qs. 0.8 µl 27.2 µl
M-MLV 1 µl 34 µl
PCR Master Mix
Reagents X1 (10 µl) X13
5X Green goteq 2 µl 26 µl
25 mM Mgcl2 1 µl 13 µl
2.5 mM dNTP mix 1 µl 13 µl
Forward primer 0.5 µl 6.5 µl
Reverse primer 0.5 µl 6.5 µl
Goteq DNA polymerase 0.2 µl 2.6 µl
Template (cDNA) 0.5 µl 6.5 µl
RNase free water 4.3 µl 55.9 µl
Relative mRNA expression
Groups Relative mRNA expression SD
Control 1 0.218779299
UCMS 0.618688619 0.401335607
UCMS+Cur10 1.264133712 0.444033146
UCMS+Cur20 1.393872774 0.194736253
UCMS+IMI20 1.334582614 0.374420443
10 of 10 09-07-2013 22:43

Maze experiment details

Recomendados

Recomendados

Más contenido relacionado

La actualidad más candente

La actualidad más candente (20)

Similar a Maze experiment details

Similar a Maze experiment details (20)

Más de La

Más de La (11)

Último

Último (20)

Maze experiment details