DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad
Similar a DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad
Similar a DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad (20)
Estimating the Size and Operations of the Public Sector and its Impact on Whe...
DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of Pakistan: Improving Socio-economic Standard of the People of these Regions by Dr. Amer Jamil, University of Agriculture, Faisalabad
1. DNA barcoding and biochemical profiling of medicinal plants of
Northern and desert areas of Pakistan: Improving socio-economic
standard of people of these regions
Principal Investigator:
Prof Amer Jamil
Dept of Chemistry and Biochemistry
Co-Principal Investigator:
Prof Muhammad Ashfaq
Director, Institute of Agricultural and Resource Economics
University of Agriculture, Faisalabad
2. Core issues Associated with
Medicinal Plants
Lack of cultivation; mostly wild collection
Inaccurate identification of medicinal plants
Substitution or adulteration of the raw ingredients
- decreased product’s efficacy
- could prove fatal
Poor socio-economic condition of the local people
residing around this valuable resource
Threat of losing our
native medicinal plant species
3. Threats to the medicinal plants
1. Habitat degradation
2. Poverty
Collection of medicinal herbs without any
consideration of their regeneration
3. Negative exploitation
– illegal extraction and transport of the plant material to
other regions without any permission
4. Lack of awareness
– Not well aware of the modern values of the medicinal
plants and the environmental consequences of loss of
biodiversity
4. PROBLEM STATEMENT
• Biodiversity conservation
– A step towards conservation of natural plant resources and
endangered species of this region
• Most of the local people of the targeted areas are
living below poverty line
– Lack of awareness about actual potential of such valuable
resource; medicinal plants
– No ownership
• Many medicinal plants are being used due to health
benefits however,
– no proper documentation
– active ingredients of the plants are mostly unknown
The local people therefore are unable to exploit the valuable
resource that exists in their vicinity
5. HYPOTHESIS
Pr oj ect w l l hel p del i ver i ng concr et e
i
gui del i nes t o devel op i m em abl e
pl ent
pol i ci es f or conser vat i on of nat ur al
r esour ces (m ci nal pl ant s), pr ovi di ng
edi
ow shi p of t he i ndi genous m er i al
ner at
t o t he l ocal peopl e and st r engt heni ng
of t he r ur al econom es of
i t he
t ar get ed r egi ons
6. Targets to be Achieved
During First Six Months
Field Visits for the collection of Medicinal Plants
Flow of Medicinal Plants
Designing of the primers
Optimization of the PCR conditions for DNA
barcoding
7. Progress During First Six Months of the Project
Selection of Two Regions of Pakistan Covering Northern
and Desert Areas
Main objectives of these visits:
to identify the marketable species of medicinal plants
to check the flow of medicinal plants
to diagnose the problems, facing in performing their activities
to explore pre and post conflict socioeconomic conditions and
their impact on livelihood
8. Questionnaires
Questionnaires were
designed for Farmers,
pickers, shopkeepers and
hakeems (herbal
medicine practitioners)
Questions concerning the
utility of different plants,
types of plants, quantity
of plants used, mode of
purchase, rate of
consumption, availability,
profit ratio, economic/
market value were asked
10. Particulars Name of
Medicinal Plants
A( B( C(
Area ( kanal) ) ) )
Seed Quantity
Cost (Rs)
Land Preparation No.
(Culti+Sohagas) Cost
Sowing Rs.
Hoeing No.
Cost (Rs)
Irrigation Type
No.
Cost
Fertilizers Type/Qty
Price/bag
11. Pesticide/Chemical Type
s Qty
Cost
Harvesting/process Cost
ing
Other
Costs(Specify)
Output (kg)
( Fresh)
Price per kg
Fresh
Output (kg) (Dry)
Price per kg (Dry)
Sowing and
harvesting time
12. Labor Cost
Type Family labour Hired labour Permanent labour
Working Value of Working Wages per Working Month
hours family hours Day hour ly
labour Wages
Men
Women
Children
other
To whom do you sell?
i) Assembler/shopkeeper ii) Medicinal companies iii) Collector iv) Hakim v)
others (Specify)_______
In which form you sell?
•Fresh ii) Dry iii) other ( Specify) _______
What problems you face during Production/Marketing etc of product?
(Specify)
What solutions you suggest to resolve these problems? (Specify)
13. Questionnaire for Picker (Collector)
Name_____________Village_____________Tehsils_____________District________
________
Age_______ (Years) picking Experience________ (Years) Schooling Years_______
Family Members__________ Family type: i) Nuclear ii) Joint iii) Extended
What types of plants you collect (Name)?
1 ____________ 2 _____________ 3 ____________ 4 ____________ 5
_______
From where you collect?
1) Private farms 2) Naturally grown 3) others (specify) _______
Family labour No. of hours for collection (per How many days spent in
month) a year
Men
Women
Children
14. In which form do you sell the plants?
•Fresh ii) Dry iii) After processing iv) other (Specify) …………….
What is over time population of these plants?
•Increasing ii) Decreasing iii) Same
If decreasing, give reasons;
i…………………………………………ii)………………………………………….
To whom do you sell the plants?
i) Hakim ii) Assembler/shopkeeper iii) Send other cities iv) Consumer v) Others (
Specify)…….
Price per kg received for different plants?
i)___________ ii) ______________ iii) _____________ iv) ____________ v)
_______
What is total quantity you sell in a year (Kgs)
i)___________ ii) ______________ iii) _____________ iv) ____________ v)
_______
Have you any other business (job)? Yes _______, No_______, if Yes (Specify)_______
Income per month from the job________________ Income of family from all
sources………….Rs/month
What problems you face during Selling/Collection? (Specify)
What solutions you suggest to resolve these problems?
Time of picking for different plants
1 ____________ 2 _____________ 3 ____________ 4 ____________ 5
_______
15. Questionnaire for Assembler
(Shopkeeper)
Name_____________Village_____________Tehsils_____________Distri
ct________________
Age_______ (Years) Assembling Experience________ (Years)
Schooling Years_______
Family Members__________ Family type: i) Nuclear ii) Joint iii)
Extended
What types of plants you Assemble?
1 _______ 2 _______ 3 _______ 4 _______ 5 _______
From where you purchase?
i) Collector ii) private farm iii) other (Specify) _______
What is your mode of purchase?
i) Go yourself ii) People Come to Sell iii) Hired Collectors iv) Other
(Specify) _______
What price per kg you pay for different plants?
•_____________ ii) ___________ iii) _____________ iv) ___________
v) _______
16. Ownership of shop? Yes……………..No……………, if No then rent of
shop…………./month
No. of employees ………….. Salaries of employees ………………..
(Rs/month)
Chowkidar charges …………..(Rs/month)
Avg. Electricity bill ………….(Rs/month), Ave. phone bill
………….(Rs/month)
Other costs………………..(Rs/month)
In which form do you sell?
•Fresh ii) Dry iii) After processing iv) other ( Specify) _______
To whom do you sell?
i) Hakim ii) Medicinal companies iii) export iv) Consumer v) other
(Specify) _______
Per kg selling price of these plants?
i) ______________ ii) _____________ iii) ______________ iv)
____________ v) _______
If other business is also carried out, what is % of medicinal plant to
total business ………..
What is your perception about the population of these plants?
•Increasing ii) Decreasing iii) Same
If decreasing, give reasons;
Is it your full time job? Yes _______, No _______ if No
Then what is your other Business (Job)? (Specify) _______
Income from other business______________ (Rs/month)
What problems you face during Selling/Purchasing etc? (Specify)
What solutions you suggest to resolve these problems? (Specify)
17. Questionnaire For Hakim
(The herbal medicine practitioner)
Name_____________Village_____________Tehsils_____________District__________
______
Age_______ (Years) Hikmat Experience________ (Years) Schooling Years_______
What type of plants you Purchase from local market (top 5)?
i) _________________ ii) ______________ iii) _____________ iv) ________ v)
________
Source?
•Collector ii) Shopkeeper/Retailer iii) Other (Specify) _________________
What price per kg you pay for different plants (Top 5)?
i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
Quantity of plants ( kg) used per month?
i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
Price of one unit of medicine you charge from customer?
i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
Most common diseases cured by these plants?
i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______
18. Ownership of shop? Yes……………..No……………, if No then
rent of shop…………./month
No. of employees ………….. Salaries of employees
……………….. (Rs/month)
Chowkidar charges …………..(Rs/month)
Avg. Electricity bill ………….(Rs/month), Ave. phone bill
………….(Rs/month)
Other costs………………..(Rs/month)
Total sale of shop (Income of
Hikmat)…………………….(Rs/month)
What problems you face during Selling/Purchasing of these local
medicinal plants? (Specify)
What solutions you suggest to resolve these problems? (Specify)
19. Visit to Northern Area
Date News Headlines
4 April,At least 14 people were killed and over 50 others injured in sectarian
violence in Gilgit-Baltistan region of northern Pakistan
2012
9 April,PAF evacuates 120 foreigners trapped in Giglit-Baltistan curfew
The Northern region included 2012
16 Aug, DIG Gilgit Ali Sher confirmed the attack on passengers and killing of about 20
Gilgit-Baltistan.
passengers in the attack of armed terrorists near at Gilgit.
2012
17 Aug, [News] Killing People of Giglit-Baltistan – Another Dark Day
2012 This is the second time in a span of three months, Armed terrorist of Taliban killed 43 people
from Gilgit-Baltistan on the basis of sectarian affiliations.
18 Aug, Two truck drivers killed in Chalt Hunza Nagar
2012
Switched to Swat Valley due 23 Aug,
2012
Gilgit Under Curfew:Gilgit (Monitoring Desk): In the post FC man killing and
reported abductions of Truck drivers in various parts of Giglit-Baltistan, and
due to the tense environment the law enforcement agencies have imposed
an unannounced curfew in Giglit-City. It has caused sever problem form many
to Security reasons as the people who where visiting for many important official and business related
tasks to the Capital City of Gilgit.
contact person in GB did not 28 Aug,
2012
Two men including a policeman were killed and another was injured in
shootings in the restive town of Gilgit on Saturday.
recommend the visit at that
28 Aug,
2012
Criminals running toward GB: Interior Minister Rehman Malik
07 Sep, Aug 16: Terrorists ambushed four buses, pulled out the passengers and shot
2012 at least 19 of them dead in the Babusar Top area of Mansehra district on
time. Thursday.
“More than 50 terrorists wearing commando uniform intercepted a convoy
going from Rawalpindi to Gilgit-Baltistan before 7am, hauled off passengers
from four vans, identified them through their national identity cards and shot
19 of them dead,” District Coordination Officer Dr Amber Ali Khan said
07 Sep, Gilgit Baltistan Legislative Assembly in a unanimous resolution on Tuesday
2012 condemned the recent terrorist attacks killing innocent people
12 Dec, Terror attacks increased in GB:Advocate Yawar was seriously injured at
2012 Domail locality, after attacked by a hand-grenade
12 Dec,
2012
Violence in Gilgit: two killed several injured
20. Visit to Swat
Collection, Photography and Preservation of
Medicinal Plants
More than 50 fresh medicinal plants were collected
from the Swat valley
About 35 dry Medicinal Plant Parts were also
collected
Special thanks to Dr Hassan Sher for providing help
21. Diagrammatic Representation of Medicinal Plants’
Flow in the Swat Valley
Picker/
Collectors
Shopkeeper Middlemen
Consumers Pansaars Traders
Pharma and other Hakeems Export
Industries
22. List of Medicinal Plants (in Dry Form) collected from Swat valley
Sr. No Name Parts Collected
1 Buntal (Impatiens glandulifera) Seeds
2 Khakshir Seeds
3 Onion Seeds
4 Rehan Seeds
5 Tudari Surkh Seeds
6 Kehoon Seeds
7 Methi Seeds
8 Serala Seeds
9 Smaq dana Seeds
10 Kasoos Seeds
11 Curfus Seeds
12 Persosha Weeds
13 Aconitum heterophyllum Weeds
14 Guchi (Mushroom) Weeds
15 Anjabaar Weeds
16 Kakora Weeds
17 Kabab e khaddan Weeds
18 Berg e Bensa Weeds
19 Dar e hild/ Darishk/ Zarishka/ Kornay Weeds
20 Ephedra Weeds
21 Damasa Weeds
22 Gidder tobacco Weeds
23 Gul e banafsha Weeds
24 Noor Alum/ Shakakal Weeds
25 Zakhm e hayat Weeds
26 Gul e Tesu Weeds
27 Discoria Weeds
28 Mamekh Weeds
29 Mater Jer (Roots) Weeds
30 Mushk e Bala/ Asaroon Weeds
31 Kuth Weeds
32 Ratan Jo Weeds
33 Mushk e bala Weeds
34 Afsateeen/ Arae Weeds
35 Materikeria Weeds
24. Visit to desert area (Cholistan desert)
Yazman, Channer Pir and Derawer fort
were visited
About 50 medicinal plants were collected
Special thanks to Cholistan Institute of Desert Studies for providing help during the visit
26. Seeds of medicinal plants collected from the Cholistan desert
S. No. Botanical Name Common Name
1 Acacia ampliceps
2 Acacia nilotica
3 Capparis decidua Karir
4 Cenchrus biflorus
5 Cenchrus ciliaris
6 Cymbopogon jwarancusa Khawi
7 Ficus benghalensis
8 Ficus religiosa
9 Panicum turgidum
10 Sporobolus violadas
11 Vetiveria zizanioides Dhaman
27. Medicinal Plants (Fresh) collected from
the Cholistan Desert
Sr No Botanical Name Common Name Medicinal Use, if known
1 Suaeda fruticosa Kali Lani
2 Salsola foetida Lani
3 Haloxylon salicornicum Lana
4 Crotalaria burhia Chag
5 Haloxylon recurvum Khar Treatment of intestinal ulcer
6 Fagonia cretica Dhamasha
7 Dipterygium glaucum Thuma
8 Cenchrus prorate Durban
9 Leptadenia pyrotechnica Khip
10 Calotropis procera Ak Against inflammation, snake bite, digestive
tract infections, etc
11 Cymbopogon jwarancusa Khavi To treat cough and as blood purifier
12 Capparis decidua Karir Against rheumatism, pain and wounds
13 Aerva javanica Bui-Kaltan Against diarrhea and haematuria in cattle
14 Tamarix dioica Lai
15 Calligonum polygonoides Phog
16 Prosopis cineraria Jandi/Kandi Treatment of rheumatism in animals
28. • The local collectors provide the desert medicinal plants to
the wholesale dealers and hakims at a very cost because of
lack of awareness about the importance of medicinal plants.
• No market is available for the sale/purchase of medicinal
plants.
• No policy by the Provisional or Federal Government exists
regarding Pricing, Selling, Purchasing, Marketing,
Distribution, Export and Sustainability of medicinal plants
found naturally in Cholistan desert.
• Cholistan Institute of Desert Studies (CIDS) has taken some
initiative to make the farmers, collectors and Hakims aware
of the importance of the medicinal plants.
30. Visit to the market of medicinal plants in
Lahore
Central Market of Pakistan for selling/purchase/
export of the Medicinal Plants
Usually peoples were reluctant to answers, they
were afraid because they were considering as tax
officer
After detailed introduction and showing the
visiting cards and ID card, some of them agreed
and Few gave information due to references
Suspicions prevailing in the market
A few plants have been discovered recently with
antidiabetic and/or anticancer potential. Price is
up to Rs. 4000/kg, but are exported without
acknowledging their real value; there is no export
policy.
31. An overview of visit to Medicinal Plant Market in Lahore
Wholesalers Name Name of plants (they Locality of M. Comments
deal) Plants
1.Shakoor Sahib Banafsha, Reetha, Swat Valley > No Adulteration in Swat Traders
(Papar Market) Brooza, Koor, > Adulteration is here
Bhman Surkh, Puth >If we go there (e,g in Swat, etc) our bargaining
Patri, Malathi, etc. power becomes weak
2.Mr. Naeem Banafsha Jungles/ Mountains > Majority of the traders about 150 in are
(Paper Mandi) working in Akbari Mandi while only 35-40 in
Papar Mandi
3.Mr Asif 6-7 Major Plants From Local market >Incredible margins exist due to lack of price
(Papar Mandi) and resell to Policy
Retailer/ Processor
4.Mr. Shahbaz Matar Jarri (Doodh From different > In Akbari Mandi genuine traders of M. Plants
(Akbari Mandi) Bacha), Asheesh Localities are only 25-30 (Out of 150); Rest are doing mix
business of karyana and medicinal plants
> There is no export policy or price system
> Hamdard, Marhaba, Ajmal, Hakeems, etc
purchase to use
5.Wahab Traders 5-6 Medicinal Plants Export from local D-S based price system
(Akbar Mandi) market as well as
from Swat
32. DNA Barcoding
Discriminatory power
Low intra-species variability
Species level genetic variability
Short sequence length: 400-800
Universality
33. Collection of Specimens (Leaves, roots, shoots or flowers of medicinal plants)
DNA isolation Omitted step; replaced with an advanced method:
Phire Plant Direct PCR kit (Thermo Scientific)
Amplification of selected (ITS2 of nuclear genome; matK, psbA-trnH, rbcL of
DNA regions by PCR cpDNA)
Sequencing of amplified
(Sanger Method)
products
Sequencing matching &
(BLAST and Reference database of NCBI)
alignment
Species identification
(various bioinfomatics tools)
& Phylogenetic study
34. DNA Barcoding and Conservation of
Plant Biodiversity
A standardized library of barcodes will enable
- identification of rare, native or invasive, endangered
species
- systematic and conservation-based studies
- track ancient divergences between basal lineages
- trace organism's evolutionary history and
systematic/taxonomic relationships
Authentication of the status of our biodiversity
Adulterated herbal medicinal materials
Establish the evolutionary links of the plant species that
are missing at the moment
35. DNA barcoding analysis
Primers designing and optimization of PCR conditions
Selection of four genes ITS, rbcL, trnH-psbA, and matK
Primers’ detail used for DNA barcoding studies
Amplicon length
S. No. Primer Name Sequence
(bp)
1. ITS 5F 5′GGAAGTAAAAGTCGTAACAAGG 700
2. ITS 4R 5′TCCTCCGCTTATTGATATGC 700
3. rbcL 1f 5′ATGTCACCACAAACAGAAAC 750
4. rbcL 724r 5′TCGCATGTACCTGCAGTAGC 750
5. trnH-psbA psbAF 5′GTTATGCATGAACGTAATGCTC 400-600
6. trnH-psbA trnH2 5′CGCGCATGGTGGATTCACAATCC 400-600
7. matK 390F 5′CGATCTATTCATTCAATATTTC 850
8. matK 1326R 5′TCTAGCACACGAAAGTCGAAGT 850
36. PCR conditions for different regions of DNA from the Plants
PCR reaction Cycling Protocol
3 step protocol
Component 25 µL reaction Cycle step Cycles
Temp. Time
Initial 98 ˚C 5 min
H2 O 9.5 µL 1
denaturation
Denaturation 98 ˚C 5 sec
Phire plant PCR buffer 12.5 µL Annealing Variable* 1 min 30
Extension 72 ˚C 1 min
Primer F and Primer R 1.3 µL each Final Extension 72 ˚C 7 min
DNA polymerase 0.5 µL 1
Seed sample 0.5 mm punch
*Annealing temperatures: ITS 51 oC, rbcL 56 oC, trnH-psbA 55 oC, matK 52 oC
Agarose gel for amplified fragments after PCR. Lane 1 ITS, Lane
2 rbcL, Lane 3 DNA ladder, Lane 5 trnH-psbA, Lane 7 matK1
37. Conclusions
~100 plants collected and preserved from both the
regions; another visit will be made to the desert area
during March (best season) for further collection of
the plants and in May to the Swat valley.
No valid price system for the sale/purchase of the
medicinal plants was found in the main markets.
Wholesalers buy the medicinal plants from different
collectors at a very low rate and sell in bulk amount at
higher rates to the bigger markets.
The PCR based method for DNA barcoding is
optimized and ready to be applied on the medicinal
plants.
38. Conclusion….continued
It was noted that the local people could not exploit
the medicinal plants due to the following reasons:
• Lack of awareness regarding time of harvesting of
the medicinal plants
• Roots and/or shoots that are grazed and collected for
medicinal purpose are a threat for their regeneration
• Lack of skills for using medicinal plants as economic
opportunity
• Lack of knowledge about the marketing of available
medicinal plants species
39. Conclusion….continued
• Poor management of medicinal plants such as
uncontrolled and unsystematic grazing, improper
harvesting and mismanagement
• Pickers suffer the problems including low price paid
by dealers, lack of appropriate tools and equipments,
etc., as well as no proper market for sale.
40. Work in progress/future work
Identification of the unidentified plants by a taxonomist
Amplification of the desired DNA sequences from the
collected medicinal plants followed by sequencing and
phylogenetic analysis
Detailed socio-economic analyses of the regions with
respect to the medicinal plants
Biochemical analysis on selected plants of both the regions
to assess their real economic importance and value
Organization of awareness workshops in both the regions
Development of policy guidelines for implementation in
the regions for conservation of medicinal plants and
improving economic condition of the local people
41. Documentation of medicinal plants on molecular
basis is necessary for conservation of biodiversity,
and to provide ownership of the important plants to
the respective region, ultimately leading to improve
the socio-economic condition of the neglected
communities