Enviar búsqueda
Cargar
01 knapsack using backtracking
•
Descargar como PPT, PDF
•
17 recomendaciones
•
53,128 vistas
M
mandlapure
Seguir
Tecnología
Denunciar
Compartir
Denunciar
Compartir
1 de 22
Descargar ahora
Recomendados
In shared PPT we have discussed Knapsack problem using greedy approach and its two types i.e Fractional and 0-1
Knapsack problem using greedy approach
Knapsack problem using greedy approach
padmeshagrekar
DAA
daa-unit-3-greedy method
daa-unit-3-greedy method
hodcsencet
Concurrency Control Techniques
Concurrency Control Techniques
Concurrency Control Techniques
Raj vardhan
Its Al About Data Structure and Algorithm Analysis
Greedy algorithm
Greedy algorithm
International Islamic University
useful for basic learner of DFS
Distributed file system
Distributed file system
Anamika Singh
presentation of Graph coloring Technique using backtracking
Graph coloring using backtracking
Graph coloring using backtracking
shashidharPapishetty
Backtracking is a general algorithm for finding all (or some) solutions to some computational problems, notably constraint satisfaction problems, that incrementally builds candidates to the solutions, and abandons each partial candidate c ("backtracks") as soon as it determines that c cannot possibly be completed to a valid solution.
Backtracking
Backtracking
Vikas Sharma
8 queens problem using back tracking
8 queens problem using back tracking
Tech_MX
Recomendados
In shared PPT we have discussed Knapsack problem using greedy approach and its two types i.e Fractional and 0-1
Knapsack problem using greedy approach
Knapsack problem using greedy approach
padmeshagrekar
DAA
daa-unit-3-greedy method
daa-unit-3-greedy method
hodcsencet
Concurrency Control Techniques
Concurrency Control Techniques
Concurrency Control Techniques
Raj vardhan
Its Al About Data Structure and Algorithm Analysis
Greedy algorithm
Greedy algorithm
International Islamic University
useful for basic learner of DFS
Distributed file system
Distributed file system
Anamika Singh
presentation of Graph coloring Technique using backtracking
Graph coloring using backtracking
Graph coloring using backtracking
shashidharPapishetty
Backtracking is a general algorithm for finding all (or some) solutions to some computational problems, notably constraint satisfaction problems, that incrementally builds candidates to the solutions, and abandons each partial candidate c ("backtracks") as soon as it determines that c cannot possibly be completed to a valid solution.
Backtracking
Backtracking
Vikas Sharma
8 queens problem using back tracking
8 queens problem using back tracking
Tech_MX
Knapsack Problem
Knapsack Problem
Jenny Galino
Directory structure :single level,two level,tree structured,acyclic graph structure
Directory structure
Directory structure
sangrampatil81
20. Parallel Databases in DBMS
20. Parallel Databases in DBMS
koolkampus
Advanced Computer Architecture,Program Partitioning and Scheduling,Program Partitioning & Scheduling,Latency,Levels of Parallelism,Loop-level Parallelism,Subprogram-level Parallelism,Job or Program-Level Parallelism,Communication Latency,Grain Packing and Scheduling,Program Graphs and Packing
program partitioning and scheduling IN Advanced Computer Architecture
program partitioning and scheduling IN Advanced Computer Architecture
Pankaj Kumar Jain
Worst-case analysis is sometimes overly pessimistic. Amortized analysis of an algorithm involves computing the maximum total number of all operations on the various data structures. Amortized cost applies to each operation, even when there are several types of operations in the sequence. In amortized analysis, time required to perform a sequence of data structure operations is averaged over all the successive operations performed. That is, a large cost of one operation is spread out over many operations (amortized), where the others are less expensive. Therefore, amortized anaysis can be used to show that the average cost of an operation is small, if one averages over a sequence of operations, even though one of the single operations might be very expensive.
Amortized Analysis of Algorithms
Amortized Analysis of Algorithms
sathish sak
algorithm and analysis of 15 puzzle probelem using branch and bound.
15 puzzle problem using branch and bound
15 puzzle problem using branch and bound
Abhishek Singh
Backtracking Algorithm by salm ibrahim
Backtracking Algorithm.ppt
Backtracking Algorithm.ppt
SalmIbrahimIlyas
Sets and disjoint sets union123
Sets and disjoint sets union123
Ankita Goyal
Master method in Analysis of Algorithms
Master method
Master method
Rajendran
Contents: 1.What is Concurrency Control? 2.Lock Based Protocol 3.Two Phase Locking Protocol 4.Deadlock
Concurrency Control in Database Management System
Concurrency Control in Database Management System
Janki Shah
swap space management
Swap space management and protection in os
Swap space management and protection in os
rajshreemuthiah
It gives overview of how to design and analysis algorithm. Different strategies used to design and analysis of algorithms.
Analysis of algorithms
Analysis of algorithms
Ganesh Solanke
15. Transactions in DBMS
15. Transactions in DBMS
koolkampus
Backtracking
Backtracking
subhradeep mitra
daa
Branch and bound
Branch and bound
Nv Thejaswini
Given a set of non-negative integers, and a value sum, determine if there is a subset of the given set with sum equal to given sum.
sum of subset problem using Backtracking
sum of subset problem using Backtracking
Abhishek Singh
For Students
Greedy Algorihm
Greedy Algorihm
Muhammad Amjad Rana
Paging
Shadow paging
Shadow paging
GowriLatha1
An introductory project showing how to identify if a DP solution to a problem exists. It also discusses the essential parts of DP solutions briefly.
Elements of dynamic programming
Elements of dynamic programming
Tafhim Islam
B trees in Data Structure
B trees in Data Structure
Anuj Modi
Knapsack using greedy algorithm with simple example
Knapsack
Knapsack
Karthik Chetla
pengantar kecerdasan buatan logika fuzzy. arsitektur komputer. salah satu materi untuk memahami cara kerja logika fuzzy
1 blind search
1 blind search
Rahel Amanda
Más contenido relacionado
La actualidad más candente
Knapsack Problem
Knapsack Problem
Jenny Galino
Directory structure :single level,two level,tree structured,acyclic graph structure
Directory structure
Directory structure
sangrampatil81
20. Parallel Databases in DBMS
20. Parallel Databases in DBMS
koolkampus
Advanced Computer Architecture,Program Partitioning and Scheduling,Program Partitioning & Scheduling,Latency,Levels of Parallelism,Loop-level Parallelism,Subprogram-level Parallelism,Job or Program-Level Parallelism,Communication Latency,Grain Packing and Scheduling,Program Graphs and Packing
program partitioning and scheduling IN Advanced Computer Architecture
program partitioning and scheduling IN Advanced Computer Architecture
Pankaj Kumar Jain
Worst-case analysis is sometimes overly pessimistic. Amortized analysis of an algorithm involves computing the maximum total number of all operations on the various data structures. Amortized cost applies to each operation, even when there are several types of operations in the sequence. In amortized analysis, time required to perform a sequence of data structure operations is averaged over all the successive operations performed. That is, a large cost of one operation is spread out over many operations (amortized), where the others are less expensive. Therefore, amortized anaysis can be used to show that the average cost of an operation is small, if one averages over a sequence of operations, even though one of the single operations might be very expensive.
Amortized Analysis of Algorithms
Amortized Analysis of Algorithms
sathish sak
algorithm and analysis of 15 puzzle probelem using branch and bound.
15 puzzle problem using branch and bound
15 puzzle problem using branch and bound
Abhishek Singh
Backtracking Algorithm by salm ibrahim
Backtracking Algorithm.ppt
Backtracking Algorithm.ppt
SalmIbrahimIlyas
Sets and disjoint sets union123
Sets and disjoint sets union123
Ankita Goyal
Master method in Analysis of Algorithms
Master method
Master method
Rajendran
Contents: 1.What is Concurrency Control? 2.Lock Based Protocol 3.Two Phase Locking Protocol 4.Deadlock
Concurrency Control in Database Management System
Concurrency Control in Database Management System
Janki Shah
swap space management
Swap space management and protection in os
Swap space management and protection in os
rajshreemuthiah
It gives overview of how to design and analysis algorithm. Different strategies used to design and analysis of algorithms.
Analysis of algorithms
Analysis of algorithms
Ganesh Solanke
15. Transactions in DBMS
15. Transactions in DBMS
koolkampus
Backtracking
Backtracking
subhradeep mitra
daa
Branch and bound
Branch and bound
Nv Thejaswini
Given a set of non-negative integers, and a value sum, determine if there is a subset of the given set with sum equal to given sum.
sum of subset problem using Backtracking
sum of subset problem using Backtracking
Abhishek Singh
For Students
Greedy Algorihm
Greedy Algorihm
Muhammad Amjad Rana
Paging
Shadow paging
Shadow paging
GowriLatha1
An introductory project showing how to identify if a DP solution to a problem exists. It also discusses the essential parts of DP solutions briefly.
Elements of dynamic programming
Elements of dynamic programming
Tafhim Islam
B trees in Data Structure
B trees in Data Structure
Anuj Modi
La actualidad más candente
(20)
Knapsack Problem
Knapsack Problem
Directory structure
Directory structure
20. Parallel Databases in DBMS
20. Parallel Databases in DBMS
program partitioning and scheduling IN Advanced Computer Architecture
program partitioning and scheduling IN Advanced Computer Architecture
Amortized Analysis of Algorithms
Amortized Analysis of Algorithms
15 puzzle problem using branch and bound
15 puzzle problem using branch and bound
Backtracking Algorithm.ppt
Backtracking Algorithm.ppt
Sets and disjoint sets union123
Sets and disjoint sets union123
Master method
Master method
Concurrency Control in Database Management System
Concurrency Control in Database Management System
Swap space management and protection in os
Swap space management and protection in os
Analysis of algorithms
Analysis of algorithms
15. Transactions in DBMS
15. Transactions in DBMS
Backtracking
Backtracking
Branch and bound
Branch and bound
sum of subset problem using Backtracking
sum of subset problem using Backtracking
Greedy Algorihm
Greedy Algorihm
Shadow paging
Shadow paging
Elements of dynamic programming
Elements of dynamic programming
B trees in Data Structure
B trees in Data Structure
Destacado
Knapsack using greedy algorithm with simple example
Knapsack
Knapsack
Karthik Chetla
pengantar kecerdasan buatan logika fuzzy. arsitektur komputer. salah satu materi untuk memahami cara kerja logika fuzzy
1 blind search
1 blind search
Rahel Amanda
ADA- 0-1 knapsack problem
Knapsack problem using dynamic programming
Knapsack problem using dynamic programming
khush_boo31
a
0 1 knapsack problem using dynamic programming
0 1 knapsack problem using dynamic programming
Maher Alshammari
Kruskal Algorithm
Kruskal Algorithm
Snehasis Panigrahi
Problem: Given, number of items each with a weight and value. The aim is to find each item to be put in a knapsack so that the total weight of included items is less than or equal to the capacity of the knapsack simultaneous total value of the included items should be maximum. It’s a problem that belongs to the NP class of problems. The decision problem form of the knapsack problem is NP-complete whereas optimization problem is NP-hard..
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
International Islamic University
DESIGN AND ANALYSIS OF ALGORITHMS
DESIGN AND ANALYSIS OF ALGORITHMS
Gayathri Gaayu
Knapsack problem ==>> Given some items, pack the knapsack to get the maximum total value. Each item has some weight and some value. Total weight that we can carry is no more than some fixed number W. So we must consider weights of items as well as their values.
Knapsack problem
Knapsack problem
Vikas Sharma
Define Greedy algorithm. solution for knapsack problem using greedy approach
Greedy Algorithm - Knapsack Problem
Greedy Algorithm - Knapsack Problem
Madhu Bala
In this you can learn how to solve Knapsack Problem of fixed tuple using Space Tree
Knapsack problem using fixed tuple
Knapsack problem using fixed tuple
Mohanlal Sukhadia University (MLSU)
Destacado
(10)
Knapsack
Knapsack
1 blind search
1 blind search
Knapsack problem using dynamic programming
Knapsack problem using dynamic programming
0 1 knapsack problem using dynamic programming
0 1 knapsack problem using dynamic programming
Kruskal Algorithm
Kruskal Algorithm
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
DESIGN AND ANALYSIS OF ALGORITHMS
DESIGN AND ANALYSIS OF ALGORITHMS
Knapsack problem
Knapsack problem
Greedy Algorithm - Knapsack Problem
Greedy Algorithm - Knapsack Problem
Knapsack problem using fixed tuple
Knapsack problem using fixed tuple
Similar a 01 knapsack using backtracking
Helpful for the cse students
Dynamic Programming for 4th sem cse students
Dynamic Programming for 4th sem cse students
DeepakGowda357858
Disjoint sets
Disjoint sets
Core Condor
This lecture presented as part of Model Uncertainty: Statistical and Mathematical fall course.
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
The Statistical and Applied Mathematical Sciences Institute
CS 354 Computer Graphics University of Texas, Austin February 2, 2012
CS 354 Graphics Math
CS 354 Graphics Math
Mark Kilgard
These presentation slides serve as a presenting tool for a Computer Science lecture to teach the subject of Recursion in the context of Computer Algorithms.
Recursion - Computer Algorithms
Recursion - Computer Algorithms
Alaa Al-Makhzoomy
Dynamic Programming-DAA
Dynamic Programming.pptx
Dynamic Programming.pptx
Thanga Ramya S
Divide-and-Conquer & Dynamic Programming Divide-and-Conquer: Divide a problem to independent subproblems, find the solutions of the subproblems, and then merge the solutions of the subproblems to the solution of the original problem. Dynamic Programming: Solve the subproblems (they may overlap with each other) and save their solutions in a table, and then use the table to solve the original problem. Example 1: Compute Fibonacci number f(0)=0, f(1）=1， f(n)=f(n-1)+f(n-2) Using Divide-and-Conquer: F(n) = F(n-1) + F(n-2) F(n-2) + F(n-3) + F(n-3) + F(n-4) F(n-3)+F(n-4) + F(n-4)+F(n-5) + F(n-4)+F(n-5) + F(n-5) + F(n-6) ……………………. Computing time: T(n) = T(n-1) + T(n-2), T(1) = 0 T(n)＝O(2 ） Using Dynamic Programmin: Computing time=O(n) n Chapter 8 Dynamic Programming (Planning) F(0) F(1) F(2) F(3) F(4) …… F(n) Example 2 The matrix-train mutiplication problem * Structure of an optimal parenthesization Matrix Size A1 30×35 A2 35×15 A3 15×5 A4 5×10 A5 10×20 A6 20×25 Input 6 5 3 2 4 1 3 3 3 3 3 3 3 3 5 1 2 3 4 5 i j 1 2 3 4 5 s[i,j] 6 5 3 2 4 i j m[i,j] 15125 10500 5375 3500 5000 0 11875 7125 2500 1000 0 9375 4375 750 0 7875 2625 0 15750 0 0 1 2 3 4 5 6 １ i-1 k j Matrix-Chain-Order(p) １ n := length[p] -1; 2 for i = 1 to n 3 do m[i,i] := 0; 4 for l =2 to n 5 do {for i=1 to n-l +1 6 do { j := i+ l-1; 7 m[i,j] := ; 8 for k = i to j-1 9 do {q := m[i,k]+m[k+1,j] +p p p ; 10 if q < m[i,j] 11 then {m[i,j] :=q; s[i,j] := k}; }; }; 13 return m, s; Input of algorithm: p , p , … , p （The size of A = ｐ *ｐ ） Computing time O(n ) 8 0 1 n i i+1 i 3 Example 3 Longest common subsequence (LCS) A problem from Bioinformatics: the DNA of one organism may be S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAAA, while the DNA of another organism may be S2 = GTCGTTCTTAATGCCGTTGCTCTGTAAA. One goal of comparing two strands of DNA is to determine how “similar” the two strands are, as some measure of how closely related the two organisms are. Problem Formulization Given a sequence X = ( ), another sequence Z = ( ) is a subsequence of X if there exists a strictly increasing sequence ( ) of indices of X such that for all j = 1, 2, …k, we have . Theorem Let X = ( ) and Y = ( ...
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
jacksnathalie
This learner's module discusses or talks about the topic of Quadratic Functions. It also discusses what is Quadratic Functions. It also shows how to transform or rewrite the equation f(x)=ax2 + bx + c to f(x)= a(x-h)2 + k. It will also show the different characteristics of Quadratic Functions.
Mathematics 9 Quadratic Functions (Module 1)
Mathematics 9 Quadratic Functions (Module 1)
Juan Miguel Palero
Introduction for Backtracking
Backtracking
Backtracking
Sally Salem
This is a project based on a class performance
Integer_Functions .pdf
Integer_Functions .pdf
JainggaPotla
Fast parallelizable scenario-based stochastic optimization: a forward-backward LBFGS method for stochastic optimal control problems with global convergence rate guarantees. (Talk at EUCCO 2016, Leuven, Belgium).
Fast parallelizable scenario-based stochastic optimization
Fast parallelizable scenario-based stochastic optimization
Pantelis Sopasakis
quadratic functions
Module 1 quadratic functions
Module 1 quadratic functions
dionesioable
Dynamic programming /Analysis of Algorithm
AOA ppt.ppt
AOA ppt.ppt
SaimaShaheen14
Algorithm to find Single Source Shortest Paths in a Weighted Directed Graph consisting of Negative Cycles
Bellman ford
Bellman ford
Kiran K
design analysis algorithm
designanalysisalgorithm_unit-v-part2.pptx
designanalysisalgorithm_unit-v-part2.pptx
arifimad15
Newton Raphson method for load flow analysis
Newton Raphson method for load flow analysis
divyanshuprakashrock
Design and Analysis of Algorithms
Daa chpater14
Daa chpater14
B.Kirron Reddi
Polynomials are very important mathematical tool for Engineers. In this lecture we will discuss about how to deal with Polynomials in MATLAB and one of its application, Curve Fitting.
Polynomials and Curve Fitting in MATLAB
Polynomials and Curve Fitting in MATLAB
Shameer Ahmed Koya
Maths04
Maths04
sansharmajs
solutions
Chapter 04 answers
Chapter 04 answers
Rajwinder Marock
Similar a 01 knapsack using backtracking
(20)
Dynamic Programming for 4th sem cse students
Dynamic Programming for 4th sem cse students
Disjoint sets
Disjoint sets
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
CS 354 Graphics Math
CS 354 Graphics Math
Recursion - Computer Algorithms
Recursion - Computer Algorithms
Dynamic Programming.pptx
Dynamic Programming.pptx
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
Mathematics 9 Quadratic Functions (Module 1)
Mathematics 9 Quadratic Functions (Module 1)
Backtracking
Backtracking
Integer_Functions .pdf
Integer_Functions .pdf
Fast parallelizable scenario-based stochastic optimization
Fast parallelizable scenario-based stochastic optimization
Module 1 quadratic functions
Module 1 quadratic functions
AOA ppt.ppt
AOA ppt.ppt
Bellman ford
Bellman ford
designanalysisalgorithm_unit-v-part2.pptx
designanalysisalgorithm_unit-v-part2.pptx
Newton Raphson method for load flow analysis
Newton Raphson method for load flow analysis
Daa chpater14
Daa chpater14
Polynomials and Curve Fitting in MATLAB
Polynomials and Curve Fitting in MATLAB
Maths04
Maths04
Chapter 04 answers
Chapter 04 answers
Último
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
The Digital Insurer
Increase engagement and revenue with Muvi Live Paywall! In this presentation, we will explore the five key benefits of using Muvi Live Paywall to monetize your live streams. You'll learn how Muvi Live Paywall can help you: Monetize your live content easily: Set up pay-per-view access to your live streams and start generating revenue from your content. Increase audience engagement: Provide exclusive, premium content behind the paywall to keep your viewers engaged. Gain valuable viewer insights: Track viewer data and analytics to better understand your audience and tailor your content accordingly. Reduce content piracy: Muvi Live Paywall's security features help protect your content from unauthorized distribution. Streamline your workflow: The all-in-one platform simplifies the process of managing and monetizing your live streams. With Muvi Live Paywall, you can take control of your live stream monetization and create a sustainable business model for your content. Learn more about Muvi Live Paywall and start generating revenue from your live streams today!
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Roshan Dwivedi
This presentation explores the impact of HTML injection attacks on web applications, detailing how attackers exploit vulnerabilities to inject malicious code into web pages. Learn about the potential consequences of such attacks and discover effective mitigation strategies to protect your web applications from HTML injection vulnerabilities. for more information visit https://bostoninstituteofanalytics.org/category/cyber-security-ethical-hacking/
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation Strategies
Boston Institute of Analytics
These are the slides delivered in a workshop at Data Innovation Summit Stockholm April 2024, by Kristof Neys and Jonas El Reweny.
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Neo4j
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
The Digital Insurer
Presentation from Melissa Klemke from her talk at Product Anonymous in April 2024
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
Product Anonymous
Discord is a free app offering voice, video, and text chat functionalities, primarily catering to the gaming community. It serves as a hub for users to create and join servers tailored to their interests. Discord’s ecosystem comprises servers, each functioning as a distinct online community with its own channels dedicated to specific topics or activities. Users can engage in text-based discussions, voice calls, or video chats within these channels. Understanding Discord Servers Discord servers are virtual spaces where users congregate to interact, share content, and build communities. Servers may revolve around gaming, hobbies, interests, or fandoms, providing a platform for like-minded individuals to connect. Communication Features Discord offers a range of communication tools, including text channels for messaging, voice channels for real-time audio conversations, and video channels for face-to-face interactions. These features facilitate seamless communication and collaboration. What Does NSFW Mean? The acronym NSFW stands for “Not Safe For Work,” indicating content that may be inappropriate for professional or public settings. NSFW Content NSFW content encompasses material that is sexually explicit, violent, or otherwise graphic in nature. It often includes nudity, profanity, or depictions of sensitive topics.
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
UK Journal
How to get Oracle DBA Job as fresher.
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
Remote DBA Services
Copy of the slides presented by Matt Robison to the SFWelly Salesforce user group community on May 2 2024. The audience was truly international with attendees from at least 4 different countries joining online. Matt is an expert in data cloud and this was a brilliant session.
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
Anna Loughnan Colquhoun
Stay safe, grab a drink and join us virtually for our upcoming "GenAI Risks & Security" Meetup to hear about how to uncover critical GenAI risks and vulnerabilities, AI security considerations in every company, and how a CISO should navigate through GenAI Risks.
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdf
lior mazor
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving. A report by Poten & Partners as part of the Hydrogen Asia 2024 Summit in Singapore. Copyright Poten & Partners 2024.
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Edi Saputra
Building Digital Trust in a Digital Economy Veronica Tan, Director - Cyber Security Agency of Singapore Apidays Singapore 2024: Connecting Customers, Business and Technology (April 17 & 18, 2024) ------ Check out our conferences at https://www.apidays.global/ Do you want to sponsor or talk at one of our conferences? https://apidays.typeform.com/to/ILJeAaV8 Learn more on APIscene, the global media made by the community for the community: https://www.apiscene.io Explore the API ecosystem with the API Landscape: https://apilandscape.apiscene.io/
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
apidays
MySQL Webinar, presented on the 25th of April, 2024. Summary: MySQL solutions enable the deployment of diverse Database Architectures tailored to specific needs, including High Availability, Disaster Recovery, and Read Scale-Out. With MySQL Shell's AdminAPI, administrators can seamlessly set up, manage, and monitor these solutions, ensuring efficiency and ease of use in their administration. MySQL Router, on the other hand, provides transparent routing from the application traffic to the backend servers in the architectures, requiring minimal configuration. Completely built in-house and supported by Oracle, these solutions have been adopted by enterprises of all sizes for their business-critical applications. In this presentation, we'll delve into various database architecture solutions to help you choose the right one based on your business requirements. Focusing on technical details and the latest features to maximize the potential of these solutions.
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Miguel Araújo
In this session, we will delve into strategic approaches for optimizing knowledge management within Microsoft 365, amidst the evolving landscape of Copilot. From leveraging automatic metadata classification and permission governance with SharePoint Premium, to unlocking Viva Engage for the cultivation of knowledge and communities, you will gain actionable insights to bolster your organization's knowledge-sharing initiatives. In this session, we will also explore how to facilitate solutions to enable your employees to find answers and expertise within Microsoft 365. You will leave equipped with practical techniques and a deeper understanding of how there is more to effective knowledge management than just enabling Copilot, but building actual solutions to prepare the knowledge that Copilot and your employees can use.
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Drew Madelung
writing some innovation for development and search
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
sudhanshuwaghmare1
Presented by Mike Hicks
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
ThousandEyes
Read about the journey the Adobe Experience Manager team has gone through in order to become and scale API-first throughout the organisation.
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
Radu Cotescu
Scaling API-first – The story of a global engineering organization Ian Reasor, Senior Computer Scientist - Adobe Radu Cotescu, Senior Computer Scientist - Adobe Apidays New York 2024: The API Economy in the AI Era (April 30 & May 1, 2024) ------ Check out our conferences at https://www.apidays.global/ Do you want to sponsor or talk at one of our conferences? https://apidays.typeform.com/to/ILJeAaV8 Learn more on APIscene, the global media made by the community for the community: https://www.apiscene.io Explore the API ecosystem with the API Landscape: https://apilandscape.apiscene.io/
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
apidays
💉💊+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHABI}}+971581248768 +971581248768 Mtp-Kit (500MG) Prices » Dubai [(+971581248768**)] Abortion Pills For Sale In Dubai, UAE, Mifepristone and Misoprostol Tablets Available In Dubai, UAE CONTACT DR.Maya Whatsapp +971581248768 We Have Abortion Pills / Cytotec Tablets /Mifegest Kit Available in Dubai, Sharjah, Abudhabi, Ajman, Alain, Fujairah, Ras Al Khaimah, Umm Al Quwain, UAE, Buy cytotec in Dubai +971581248768''''Abortion Pills near me DUBAI | ABU DHABI|UAE. Price of Misoprostol, Cytotec” +971581248768' Dr.DEEM ''BUY ABORTION PILLS MIFEGEST KIT, MISOPROTONE, CYTOTEC PILLS IN DUBAI, ABU DHABI,UAE'' Contact me now via What's App…… abortion Pills Cytotec also available Oman Qatar Doha Saudi Arabia Bahrain Above all, Cytotec Abortion Pills are Available In Dubai / UAE, you will be very happy to do abortion in Dubai we are providing cytotec 200mg abortion pill in Dubai, UAE. Medication abortion offers an alternative to Surgical Abortion for women in the early weeks of pregnancy. We only offer abortion pills from 1 week-6 Months. We then advise you to use surgery if its beyond 6 months. Our Abu Dhabi, Ajman, Al Ain, Dubai, Fujairah, Ras Al Khaimah (RAK), Sharjah, Umm Al Quwain (UAQ) United Arab Emirates Abortion Clinic provides the safest and most advanced techniques for providing non-surgical, medical and surgical abortion methods for early through late second trimester, including the Abortion By Pill Procedure (RU 486, Mifeprex, Mifepristone, early options French Abortion Pill), Tamoxifen, Methotrexate and Cytotec (Misoprostol). The Abu Dhabi, United Arab Emirates Abortion Clinic performs Same Day Abortion Procedure using medications that are taken on the first day of the office visit and will cause the abortion to occur generally within 4 to 6 hours (as early as 30 minutes) for patients who are 3 to 12 weeks pregnant. When Mifepristone and Misoprostol are used, 50% of patients complete in 4 to 6 hours; 75% to 80% in 12 hours; and 90% in 24 hours. We use a regimen that allows for completion without the need for surgery 99% of the time. All advanced second trimester and late term pregnancies at our Tampa clinic (17 to 24 weeks or greater) can be completed within 24 hours or less 99% of the time without the need surgery. The procedure is completed with minimal to no complications. Our Women's Health Center located in Abu Dhabi, United Arab Emirates, uses the latest medications for medical abortions (RU-486, Mifeprex, Mifegyne, Mifepristone, early options French abortion pill), Methotrexate and Cytotec (Misoprostol). The safety standards of our Abu Dhabi, United Arab Emirates Abortion Doctors remain unparalleled. They consistently maintain the lowest complication rates throughout the nation. Our Physicians and staff are always available to answer questions and care for women in one of the most difficult times in their lives. The decision to have an abortion at the Abortion Cl
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
?#DUbAI#??##{{(☎️+971_581248768%)**%*]'#abortion pills for sale in dubai@
As privacy and data protection regulations evolve rapidly, organizations operating in multiple jurisdictions face mounting challenges to ensure compliance and safeguard customer data. With state-specific privacy laws coming up in multiple states this year, it is essential to understand what their unique data protection regulations will require clearly. How will data privacy evolve in the US in 2024? How to stay compliant? Our panellists will guide you through the intricacies of these states' specific data privacy laws, clarifying complex legal frameworks and compliance requirements. This webinar will review: - The essential aspects of each state's privacy landscape and the latest updates - Common compliance challenges faced by organizations operating in multiple states and best practices to achieve regulatory adherence - Valuable insights into potential changes to existing regulations and prepare your organization for the evolving landscape
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc
Último
(20)
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation Strategies
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdf
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
01 knapsack using backtracking
1.
2.
3.
4.
N-Queens Problem
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Descargar ahora
![Backtracking Technique ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]](https://image.slidesharecdn.com/01knapsackusingbacktracking-120120043113-phpapp02/85/01-knapsack-using-backtracking-1-320.jpg){kind=tracking}
![Backtracking Technique ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]](data:image/gif;base64,R0lGODlhAQABAIAAAAAAAP///yH5BAEAAAAALAAAAAABAAEAAAIBRAA7)