SlideShare una empresa de Scribd logo
1 de 29
Online bioscience course for grades 6-12 Fall 2009 bio 1.0
Class mechanics… ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
Lecture 3:  Genes and proteins bio 1.0
Take Homes: ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
What is a gene?: ,[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
http://en.wikipedia.org/wiki/Genetic_code How the genetic code works I: bio 1.0
How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
How the genetic code works III bio 1.0
Reading frames bio 1.0
Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
Step-by-step video showing how to  use the ORF Finder with our DNA  sequence to find out if it encodes a  protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
>EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
So, our sequence contains the  Green Fluorescent Protein (GFP)  Gene sequence…  bio 1.0
http:// en.wikipedia.org/wiki/Green_fluorescent_protein bio 1.0
Cells “engineered” to express GFP: bio 1.0
Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
The lac Operon-an example of  how bacterial genes are turned  “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated  bio 1.0
Protein Functions in the Body  http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
Protein Functions in the Body:  An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
Looking at GFP at the  molecular level… bio 1.0
Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
A look at GFP structure  with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
Virtual experiment: making bacteria  that glow green by giving them a GFP gene…  http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
instructor Mark E Minie PhD [email_address]   bio 1.0

Más contenido relacionado

Similar a Lecture 3 Genes And Proteins 10212009

Biopython programming workshop at UGA
Biopython programming workshop at UGABiopython programming workshop at UGA
Biopython programming workshop at UGAEric Talevich
 
Annotated biology technology resources
Annotated biology technology resourcesAnnotated biology technology resources
Annotated biology technology resourcesMarilyn Brouette
 
Introduction to NCBI
Introduction to NCBIIntroduction to NCBI
Introduction to NCBIgeetikaJethra
 
Protein Analysis
Protein AnalysisProtein Analysis
Protein AnalysisSyed Lokman
 
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxTheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxPRIYANKAZALA9
 
B.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseB.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseRai University
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouEric Ma
 
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseCRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseLeadershipProgram
 
Collaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeCollaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeChris Mungall
 
Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)Mary Beth Smith
 
Working with Chromosomes
Working with ChromosomesWorking with Chromosomes
Working with ChromosomesIoanna Leontiou
 
Novozymes Enzyme Stability Prediction
Novozymes Enzyme Stability PredictionNovozymes Enzyme Stability Prediction
Novozymes Enzyme Stability PredictionIttrainingIttraining
 
InterPro and InterProScan 5.0
InterPro and InterProScan 5.0InterPro and InterProScan 5.0
InterPro and InterProScan 5.0EBI
 

Similar a Lecture 3 Genes And Proteins 10212009 (20)

Biopython programming workshop at UGA
Biopython programming workshop at UGABiopython programming workshop at UGA
Biopython programming workshop at UGA
 
Bio4j
Bio4jBio4j
Bio4j
 
Synthetic Biology
Synthetic BiologySynthetic Biology
Synthetic Biology
 
簡報1
簡報1簡報1
簡報1
 
Annotated biology technology resources
Annotated biology technology resourcesAnnotated biology technology resources
Annotated biology technology resources
 
Biopharma VS Small Molecules Therapeutic
Biopharma VS Small Molecules TherapeuticBiopharma VS Small Molecules Therapeutic
Biopharma VS Small Molecules Therapeutic
 
Introduction to NCBI
Introduction to NCBIIntroduction to NCBI
Introduction to NCBI
 
Protein Analysis
Protein AnalysisProtein Analysis
Protein Analysis
 
ED 205 IPP
ED 205 IPPED 205 IPP
ED 205 IPP
 
Biopharmaceutical
Biopharmaceutical Biopharmaceutical
Biopharmaceutical
 
Neo4j and bioinformatics
Neo4j and bioinformaticsNeo4j and bioinformatics
Neo4j and bioinformatics
 
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxTheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
 
B.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseB.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 database
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For You
 
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseCRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
 
Collaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeCollaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of Life
 
Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)Biotechnology Chapter Five Lecture- Proteins (part b)
Biotechnology Chapter Five Lecture- Proteins (part b)
 
Working with Chromosomes
Working with ChromosomesWorking with Chromosomes
Working with Chromosomes
 
Novozymes Enzyme Stability Prediction
Novozymes Enzyme Stability PredictionNovozymes Enzyme Stability Prediction
Novozymes Enzyme Stability Prediction
 
InterPro and InterProScan 5.0
InterPro and InterProScan 5.0InterPro and InterProScan 5.0
InterPro and InterProScan 5.0
 

Más de meminie

2010 may bioit class syllabus 572010
2010 may bioit class syllabus 5720102010 may bioit class syllabus 572010
2010 may bioit class syllabus 572010meminie
 
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosLecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosmeminie
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postmeminie
 
Lecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosLecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosmeminie
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postmeminie
 
Lecture 9 The Ecosystem
Lecture 9 The EcosystemLecture 9 The Ecosystem
Lecture 9 The Ecosystemmeminie
 
Lecture 8 Biomedicine
Lecture 8 BiomedicineLecture 8 Biomedicine
Lecture 8 Biomedicinememinie
 

Más de meminie (8)

2010 may bioit class syllabus 572010
2010 may bioit class syllabus 5720102010 may bioit class syllabus 572010
2010 may bioit class syllabus 572010
 
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosLecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videos
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 post
 
Lecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosLecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videos
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 post
 
Lecture 9 The Ecosystem
Lecture 9 The EcosystemLecture 9 The Ecosystem
Lecture 9 The Ecosystem
 
Lecture 8 Biomedicine
Lecture 8 BiomedicineLecture 8 Biomedicine
Lecture 8 Biomedicine
 
Ugenex
UgenexUgenex
Ugenex
 

Último

Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...Neo4j
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century educationjfdjdjcjdnsjd
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProduct Anonymous
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...DianaGray10
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingEdi Saputra
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsTop 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsRoshan Dwivedi
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MIND CTI
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobeapidays
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodJuan lago vázquez
 
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesHTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesBoston Institute of Analytics
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityPrincipled Technologies
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...apidays
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherRemote DBA Services
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 

Último (20)

Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsTop 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
 
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesHTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation Strategies
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 

Lecture 3 Genes And Proteins 10212009

  • 1. Online bioscience course for grades 6-12 Fall 2009 bio 1.0
  • 2.
  • 3. Lecture 3: Genes and proteins bio 1.0
  • 4.
  • 5.
  • 6. Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
  • 8. How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
  • 9. How the genetic code works III bio 1.0
  • 11. Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
  • 12. Step-by-step video showing how to use the ORF Finder with our DNA sequence to find out if it encodes a protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
  • 13. >EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
  • 14. So, our sequence contains the Green Fluorescent Protein (GFP) Gene sequence… bio 1.0
  • 16. Cells “engineered” to express GFP: bio 1.0
  • 17. Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
  • 18. The lac Operon-an example of how bacterial genes are turned “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
  • 19. Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated bio 1.0
  • 20. Protein Functions in the Body http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
  • 21. Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
  • 22. Protein Functions in the Body: An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
  • 23. Looking at GFP at the molecular level… bio 1.0
  • 24. Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
  • 25. A look at GFP structure with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
  • 26. Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
  • 27. Virtual experiment: making bacteria that glow green by giving them a GFP gene… http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
  • 28. Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
  • 29. instructor Mark E Minie PhD [email_address] bio 1.0