2. vectors Cloning vectors: 克隆载体 to clone a gene in a vector Expression vectors: 表达载体 to express a gene from a vector Integration vectors: 整合载体 to integrate a gene in a genome through a vector
4. Cloning vectors: allowing the exogenous DNA to be inserted, stored, and manipulated mainly at DNA level. expression vectors: allowing the exogenous DNA to be inserted, stored, and expressed.
5.
6. Ampicillin resistant? yes yes Tetracycline resistant? No yes B X B B B X Amp r ori Amp r Tc r ori -Screening by insertional inactivation of a resistance gene Twin antibiotic resistance screening Amp r Tc r ori pBR322
7. Replica plating: transfer of the colonies from one plate to another using absorbent pad or Velvet ( 绒布 ). transfer of colonies +ampicillin + ampicillin + tetracycline these colonies have bacteria with recombinant plasmid
8. Blue white screening Amp r ori pUC18 (3 kb) MCS (Multiple cloning sites, 多克隆位点) Lac promoter lacZ’ Screening by insertional inactivation of the lacZ gene The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.
9. Recreated vector : blue transformants Recombinant plasmid containing inserted DNA: white transformants Recreated vector (no insert) Recombinant plasmid (contain insert) back
10. Multiple cloning sites Multiple restriction sites enable the convenient insertion of target DNA into a vector Amp r ori pUC18 (3 kb) MCS (Multiple cloning sites, 多克隆位点) Lac promoter lacZ’ … ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA… . T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser… EcoRI SacI KpnI SmaI XmaI BamHI XbaI SalI HincII AccI PstI SphI Lac Z
11.
12. T7 promoter RBS Start codon MCS Transcription terminator Amp r ori T7 expression vector An bacterial expression vector
16. Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage . Human genome (3 x 10 9 bp): large genome and large gene demand vectors with a large size capacity. Cloning large DNA fragments (Eukaryotic Genome project) Genomic library VS cDNA library
17.
18. C) Packaging and infect Formation of a cosmid clone Digestion Ligation
19. YAC vectors Accommodates genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genome, but not good in mapping and analysis. (yeast artificial chromosome)
22. BAC vectors 细菌人工染色体 1. More stable than YAC 2. Capacity is 300-350 kb 3. One to two copies in each cell 4. Easy to handle 5. More popular in genomic mapping
23.
24. Gene library: a collection of different DNA sequence from an organism, each of which has been cloned into a vector for ease of purification, storage and analysis. Genomic libraries cDNA libraries Gene library (made from genomic DNA) (made from cDNA- copy of mRNA) I 1 Genomic libraries
25.
26. I 1-2 Size of library (ensure enough clones) must contain a certain number of recombinants for there to be a high probability of it containing any particular sequence The formula to calculate the number of recombinants: N = ln (1 - P ) ln (1- f ) P : desired probability f : the fraction of the genome in one insert I 1 Genomic libraries
27. For example :for a probability of 0.99 with insert sizes of 20 kb these values for the E.coli (4.6 ×10 6 bp) and human (3×10 9 bp) genomes are : N E.coli = = 1.1 ×10 3 ln( 1-0.99) ln[1-(2×10 4 /4.6×10 6 )] N human = = 6.9 ×10 5 ln(1-0.99) ln[1-(2 ×10 4 /3 ×10 9 )] These values explain why it is possible to make good genomic libraries from prokaryotes in plasmids where the insert size is 5-10kb ,as only a few thousand recombinants will be needed. I 1 Genomic libraries
28.
29. To make a representative genomic libraries , genomic DNA must be purified and then broken randomly into fragments that are correct in size for cloning into the chosen vector . Purification of genomic DNA : Prokaryotes : extracted DNA directly from cells remove protein, lipids and other unwanted macro- molecules by protease digestion and phase extraction. Eukaryotes : prepare cell nuclei I 1 Genomic libraries
30. Break DNA into fragments randomly: Physical shearing : pipeting, mixing or sonicaion Restriction enzyme digestion : partial digestion is preferred to get a greater lengths of DNA fragments. I 1 Genomic libraries
31.
32. I 1-4 Vectors According to genome’s size,we can select a proper vector to construct a library . Vectors Plasmid phageλ cosmid YAC insert (kb) 5 23 45 1000 The most commonly chosen genomic cloning vectors are λ relacement vectors which must be digested with restriction enzymes to produce the two λ end fragment or λ arms between which the genomic DNA will be digested I 1 Genomic libraries
33. cos cos Long (left) arm short (right) arm Exogenous DNA (~20-23 kb) λ phage vector in cloning cos cos Long (left) arm short (right) arm Exogenous DNA (~20-23 kb)
34.
35. I 2 cDNA libraries I 2-1 mRNA isolation, purification I 2-2 Check theRNA integrity I 2-3 Fractionate and enrich mRNA I 2-4 Synthesis of cDNA I 2-5 Treatment of cDNA ends I 2-6 Ligation to vector Gene libraries and screening
40. 1. Traditionally method was done by pass a preparation of total RNA down a column of oligo (dT)-cellulose 2. More rapid procedure is to add oligo(dT) linked to magnetic beads directly to a cell lysate and ‘pulling out’ the mRNA using a strong magnet 3. Alternative route of isolating mRNA is lysing cells and then preparing mRNA-ribosome complexes on sucrose gradients Three methods to isolate mRNA. I 2 cDNA libraries
41. Make sure that the mRNA is not degraded. Methods: Translating the mRNA : use cell-free translation system as wheat germ extract or rabbit reticulocyte lysate to see if the mRNAs can be translated Analysis the mRNAs by gel elctrophoresis : use agarose or polyacrylamide gels I 2-2 Check the mRNA integrity I 2 cDNA libraries
42. I 2-3 Cloning the particular mRNAs Is useful especially one is trying to clone a particular gene rather to make a complete cDNA library. Fractionate on the gel: performed on the basis of size, mRNAs of the interested sizes are recovered from agarose gels Enrichment: carried out by hybridization Example: clone the hormone induced mRNAs (substrated cDNA library) I 2 cDNA libraries
43. I 2-4 Synthesis of cDNA : First stand synthesis: materials as reverse transcriptase ,primer( oligo(dT) or hexanucleotides) and dNTPs ( Fig 1.1) Second strand synthesis: best way of making full-length cDNA is to ‘tail’ the 3’-end of the first strand and then use a complementary primer to make the second. ( Fig 2.1 ) I 2 cDNA libraries
44. 5’ mRNA AAAAA -3’ HO- TTTTT P -5’ 5’ Reverse transcriptase Four dNTPs AAAAA -3’ TTTTT P -5’ mRNA mRNA c DNA c DNA c DNA Duplex c DNA AAAAA -3’ TTTTT P -5’ TTTTT P -5’ 3’ 3’-CCCCCCC Terminal transferase dCTP Alkali (hydrolyaes RNA) Purify DNA oligo(dG) Klenow polymerase or reverse Transcriotase Four dNTPs 5’-pGGGG-OH 5’ 3’-CCCCCCC 5’-pGGGG 3’-CCCCCCC TTTTT P -5’ -3’ Fig 1.1 The first strand synthesis I 2 cDNA libraries
45. 5’-pGGGG 3’-CCCCCCC HO-CCGAATTCGGGGGG 3’-GGCTTAAGCCCCCC 5’-pAATTCGGGGGG TTTTTGGCTTAAGCC-OH CCGAATTCGG-3’ 3’-CCCC 3’-CCCCCCC 3’-CCC 5’-pGGGG 5’-pGGGG TTTTTp-5’ -3’ TTTTTp-5’ TTTTTp-5’ -3’ -3’ TTTTTGGCTTAAp-5’ HO-CCG/AATTCGG-3’ 3’-GGCTTAA/GCC-OH CCG-3’ Duplex cDNA Single strand-specific nuclease Klenow polymerase treat with E.coRI methylase Add E.colRI linkers using T4 DNA ligase E.colRI digestion Ligate to vector and transfom Fig 2.1 Second strand synthesis
46. I 2-5 Treatment of cDNA ends Blunt and ligation of large fragment is not efficient, so we have to use special acid linkers to create sticky ends for cloning. The process : Move protruding 3’-ends (strand-special nuclease) Fill in missing 3’ nucleotide (klenow fragment of DNA polyI and 4 dNTPs) Ligate the blunt-end and linkers (T4 DNA ligase) Restriction enzyme digestion (E.coRI ) Tailing with terminal transferase or using adaptor molecules I 2 cDNA libraries
47. I 2-6 Ligation to vector Any vectors with an E.coRI site would suitable for cloning the cDNA. The process : Dephosphorylate the vector with alkaline phosphatase Ligate vector and cDNA with T4 DNA ligase (plasmid or λ phage vector) I 2 cDNA libraries
48. I 3 Screening procedures I 3-1 Screening I 3-2 Colony and plaque hybridization I 3-3 Expression screening I 3-4 Hybrid arrest and release I 3-5 Chromosome walking (repeat screening) Gene libraries and screening
49.
50.
51. I 3-2 Colony and plaque hybridization Transfer the DNA in the plaque or colony to a Nylon or nitrocellulose membrane Phage DNA bind to the membrane directly Bacterial colonies must be lysed to release DNA on the membrane surface. Hybridization (in a solution Containing Nucleic acid probe) Wash to remove unhybri- dization probe and visualize X-ray film(radio- actively labeled ) antibody or enzyme (modified nucleotide labeled Line up the hybridizated region or repeated hybridization (Alkali treatment) I 3 Screening procedures
52. Transfer to nitrocellulose or nylon membrane Denature DNA(NaOH) Bake onto membrane Probe with 32 p-labled DNA complementary to gene of interest Expose to film Select positive from master plate Keep master plate Screening by plaque hybridization I 3 Screening procedures
53.
54. Expression screening (1) If the inserts are cloned into an expression sites, it may be expressed. Therefore, we can screen for the expressed proteins. However, this screening may miss the right clone Example: the EcoRI site of lgt11 vector. The inserted genes have one in six change (1/6) to be in both the correct orientation (2 possibilities; ) and reading frame ( three possibilities ; three nucleotide code XXX). I 3 Screening procedures
55. Expression screening (2) The procedure has similarities to the plaque hybridization protocol. ‘ Plaque lift’ ( taken by placing a membrane on the dish of plaque ) Immersed in a solution of the antibody Detected by other antibodies Repeat cycles of screening to isolate pure plaques Antibodies can be used to screen the expression library. I 3 Screening procedures