CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx

•Descargar como DOCX, PDF•

0 recomendaciones•14 vistas

CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT LESSON PLAN OVERVIEW: ● Students will engage in critical thinking regarding the systems of the human body and pathology in Anatomy, and specifically the for the following topics: Integumentary, musculoskeletal, pulmonary, respiratory, urinary, circulatory, male/female reproductive, electrolytes/hydration, endocrine, and immune/lymphatic. SPECIFIC TOPIC/Assigned pathology : Asthma -Students will be assigned pathology 2 week of the course, they will be assigned to develop a Research Document Report and PowerPoint by apply researched information on their topic. Define the disease, Cause of the disease, Signs & Symptoms of the disease (If apply, include stages, levels, or types of the disease), Laboratory findings (include, all blood test names, genetic test, urine test, i.e.) Must include all normal versus abnormal levels that will confirm the disease, Images of the Disease (X-ray, MRI, Ct Scans, PET scans), Treatment for the disease (this includes name of the medications, dosage, side effects, alternative medications, Diet for the patient, Demographics of the disease, Prognosis of the disease, Photos of the disease throughout the PowerPoint presentation. 11. All students must apply APA and writing style format. References must be within the last 5 years and no less than 10 references. -All references are to be included in the PowerPoint presentation and Written Report in APA format. Websites: ● Google scholar, eMedicine, World Health Origination (WHO), Center for Disease and Prevention Control (CDC), Web-Med, MayoCLinic, and other healthcare organizations, i.e Recommended reading: Martini, Nath, & Bartholomew. Fundamental’s Of Anatomy & Physiology, 11th Edition. Pearson .

Educación

Laboratory findings (include, all blood test names, genetic
test, urine test, i.e.) Must include all normal versus
abnormal levels that will confirm the disease,
Images of the Disease (X-ray, MRI, Ct Scans, PET scans),
Treatment for the disease (this includes name of the
medications, dosage, side effects, alternative medications,
Diet for the patient,
Demographics of the disease,
Prognosis of the disease,
Photos of the disease throughout the PowerPoint
presentation.
11. All students must apply APA and writing style format.
References must be within the last 5 years and no less than 10
references.
-All references are to be included in the PowerPoint
presentation and Written Report in APA format.
Websites:
● Google scholar, eMedicine, World Health Origination (WHO),
Center for Disease and Prevention Control (CDC), Web-Med,

MayoCLinic, and other healthcare organizations, i.e
Recommended reading:
Martini, Nath, & Bartholomew.
Fundamental’s Of Anatomy & Physiology, 11th
Edition. Pearson

Más contenido relacionado

Similar a CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx

For this assignment, you are to complete a clinical case - narrated PowerPoint report that will follow the SOAP note example provided below. The case report will be based on the clinical case scenario list below. You are to approach this clinical scenario as if it is a real patient in the clinical setting. Instructions: Step 1 - Read the assigned clinical scenario and using your clinical reasoning skills, decide on the diagnoses. This step informs your next steps. Step 2 - Document the given information in the case scenario under the appropriate sections, headings, and subheadings of the SOAP note. Step 3 - Document all the classic symptoms typically associated with the diagnoses in Step 1. This information may NOT be given in the scenario; you are to obtain this information from your textbooks. Include APA citations. Example of Steps 1 - 3: You decided on Angina after reading the clinical case scenario (Step 1) Review of Symptoms (list of classic symptoms): CV: sweating, squeezing, pressure, heaviness, tightening, burning across the chest starting behind the breastbone GI: indigestion, heartburn, nausea, cramping Pain: pain to the neck, jaw, arms, shoulders, throat, back, and teeth Resp: shortness of breath Musculo: weakness Step 4 – Document the abnormal physical exam findings typically associated with the acute and chronic diagnoses decided on in Step 1. Again, this information may NOT be given. Cull this information from the textbooks. Include APA citations. Example of Step 4: You determined the patient has Angina in Step 1 Physical Examination (list of classic exam findings): CV: RRR, murmur grade 1/4 Resp: diminished breath sounds left lower lobe Step 5 - Document the diagnoses in the appropriate sections, including the ICD-10 codes, from Step 1. Include three differential diagnoses. Define each diagnosis and support each differential diagnosis with pertinent positives and negatives and what makes these choices plausible. This information may come from your textbooks. Remember to cite using APA. Step 6 - Develop a treatment plan for the diagnoses. Only use National Clinical Guidelines to develop your treatment plans. This information will not come from your textbooks. Use your research skills to locate appropriate guidelines. The treatment plan must address the following: a) Medications (include the dosage in mg/kg, frequency, route, and the number of days) b) Laboratory tests ordered (include why ordered and what the results of the test may indicate) c) Diagnostic tests ordered (include why ordered and what the results of the test may indicate) d) Vaccines administered this visit & vaccine administration forms given, e) Non-pharmacological treatments f) Patient/Family education including preventive care g) Anticipatory guidance for the visit (be sure to include exactly what you discussed during the visit; review Bright Futures website for this section) h) Follow-up appointment with a.

For this assignment, you are to complete aclinical case - narrat.docx

sleeperharwell

STUDY DESIGNs PRESENTATION BY AFFRAM.pdf

AfframHspt

General teaching about disease

Ivano-Frankivsk National Medical University

Chronic Obstructive Pulmonary Disease Demographic Information.docx

sdfghj21

Epidemiology an overview

Bhoj Raj Singh

This assignment addresses the following objectives: 1 . interpret the meanings of medical terms through root, prefix, suffix, and whole word recognition;2. construct medical terms by combining word elements;3. utilize medical terms and standard medical abbreviations in their appropriate context;4. identify the major organs, structure, and function of each body system;7. apply medical terminology to the healthy state and the diseased state of a body system; and8. utilize appropriate medical terminology to explain pathophysiologic processes and how they affect bodysystems and the individual as a whole Select a medical condition from any chapter in the textbook. Research the following: pathophysiology, symptom manifestation, treatment options including medical, surgical and pharmacological, and the prognosis of the disease. Document the source using APA format. Submit the assignment to me using the following guidelines: The report should be approximately 2-3 typed pages, double-spaced, using 12 pt. font. Appropriate medical terminology is required; as always, in medical terminology, spelling and grammar count. Grading Pathophysiology – explain how the disease process affects an organ, system, and the entire human being. 25 points Symptoms – list the symptoms one experiences with the condition; explain what organs and systems are involved and how symptoms manifest themselves. 25 points Treatment – What treatment is involved? Is it curative or palliative; medical, surgical or pharmacological? 25 points Prognosis – what is the chance that treatment will cure the condition? Will any body organs lose their function? Will the person be able to live a functional, productive life? Are there new or experimental programs on the horizon for these conditions? .

This assignment addresses the following objectives 1. .docx

howardh5

Hepatocellular Carcinoma Define the disease, Demographics of the Disease Cause of the disease, Signs & Symptoms of the disease (If apply, include stages, levels, or types of the disease), Laboratory findings (include, all blood test names, genetic test, urine test, i.e.) Must include all normal versus abnormal levels that will confirm the disease, Images of the Disease (X-ray, MRI, Ct Scans, PET scans); all images bust be cited in APA format and referred in the reference page of the report and PowerPoint. Treatment for the disease (this includes name of the medications, dosage, side effects, alternative medications, Diet for the patient, Prognosis of the disease, Photos of the disease throughout the PowerPoint presentation. All students must apply APA and writing style format. References must be within the last 5 years and no less than 10 references. All references must be accountable in the in-text citations throughout the document and PowerPoint. In addition, all PowerPoint slides must have citations at the bottom of each slide; .

Hepatocellular CarcinomaDefine the disease,Demographics of t.docx

simonithomas47935

Study Designs in Epidemiology-Ahmed Mandil-2.ppt

LawalBelloDanchadi

04Introduction_to_Pathophysiology.pptx

SammyWeils

04Introduction_to_PF.ppt

AimanSiddiqui21

Knowledge is the fact or condition of knowing something with familiarity gained through experience or association. A Knowledge base system is also known as expert system. It is a computer program that contains some of the subject-specific knowledge, and contains the knowledge and analytical skills of one or more human experts. This paper deals with the deals with the development of knowledge base system in medicine which is able to give an appropriate diagnosis for all the diseases with fever as one symptom. A Knowledge-based system assists in the diagnosis of diseases to doctor in some critical cases. It also improves quality of decision making and speed-up of human professional work.

Knowledge Base System in Medicine with Special Reference to Consulting Physician

IJESM JOURNAL

Comprehensive SOAP Template This template is for a full history and physical. For this course include only areas that are related to the case. Patient Initials: _______ Age: _______ Gender: _______ Note: The mnemonic below is included for your reference and should be removed before the submission of your final note. O = onset of symptom (acute/gradual) L= location D= duration (recent/chronic) C= character A= associated symptoms/aggravating factors R= relieving factors T= treatments previously tried – response? Why discontinued? S= severity SUBJECTIVE DATA: Include what the patient tells you, but organize the information. Chief Complaint (CC): In just a few words, explain why the patient came to the clinic. History of Present Illness (HPI): This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care, coding, and billing analysis. Paint a picture of what is wrong with the patient. You need to start EVERY HPI with age, race, and gender (e.g., 34-year-old AA male). You must include the seven attributes ofeach principal symptom in paragraph form not a list: 1. Location 2. Quality 3. Quantity or severity 4. Timing, including onset, duration, and frequency 5. Setting in which it occurs 6. Factors that have aggravated or relieved the symptom 7. Associated manifestations Medications: Include over-the-counter, vitamin, and herbal supplements. List each one by name with dosage and frequency. Allergies: Include specific reactions to medications, foods, insects, and environmental factors. Identify if it is an allergy or intolerance. Past Medical History (PMH): Include illnesses (also childhood illnesses), hospitalizations. Past Surgical History (PSH): Include dates, indications, and types of operations. Sexual/Reproductive History: If applicable, include obstetric history, menstrual history, methods of contraception, sexual function, and risky sexual behaviors. Personal/Social History: Include tobacco use, alcohol use, drug use, patient’s interests, ADL’s and IADL’s if applicable, and exercise and eating habits. Immunization History: Includelast Tdap, Flu, pneumonia, etc. Significant Family History: Include history of parents, grandparents, siblings, and children. Lifestyle: Include cultural factors, economic factors, safety, and support systems and sexual preference. Review of Systems: From head-to-toe, include each system that covers the Chief Complaint, History of Present Illness, and History (this includes the systems that address any previous diagnoses).Remember that the information you include in this section is based on what the patient tells you so ensure that you include all essentials in your case (refer to Chapter 2 of the Sullivan text). General: Include any recent weight changes, weakness, fatigue, or fever, but do not restate HPI data here. HEENT: Neck: Breasts: Respiratory: Cardiovascular/Peripheral Vascular: Gastrointestinal: Genitourinary: Mu.

Comprehensive SOAP TemplateThis template is for a full history.docx

donnajames55

Three homeopathic physicians participated in methodical data collection over a 3-month period in the O&G outpatient setting of The Calcutta Homeopathic Medical College and Hospital, West Bengal, India. A specifically designed Excel spreadsheet was used to record data on consecutive appointments, including date, patient identity, socioeconomic status, place of abode, religion, medical condition/complaint, whether chronic/acute, new/follow-up case, patient-assessed outcome (7-point Likert scale: 3 to þ3), prescribed homeopathic medication, and whether other medication/s was being taken for the condition. These spreadsheets were submitted monthly for data synthesis and analysis. Data on 878 appointments (429 patients) were collected, of which 61% were positive, 20.8% negative, and 18.2% showed no change. Chronic conditions (93.2%) were chiefly encountered. A total of 434 medical conditions and 52 varieties were reported overall. The most frequently treated conditions were leucorrhea (20.5%), irregular menses (13.3%), dysmenorrhea (10%), menorrhagia (7.5%), and hypomenorrhea (6.3%). Strongly positive outcomes (þ3/þ2) were mostly recorded in oligomenorrhea (41.7%), leucorrhea (34.1%), polycystic ovary (33.3%), dysmenorrhea (28%), and irregular menses (22.2%). Individualized prescriptions predominated (95.6%). A total of 122 different medicines were prescribed in decimal (2.9%), centesimal (87.9%), and 50 millesimal potencies (4.9%). Mother tinctures and placebo were prescribed in 3.4% and 30.4% instances, respectively. Several instances of medicine-condition pairings were detected. This systematic recording cataloged the frequency and success rate of treating O&G conditions using homeopathy.

Obstetrics and gynecology outpatient scenario of an Indian homeopathic hospit...

home

DISSERTATION PRESENTATION.pptx

omkarsinhchudasama1

Pathology.ppt

fgcpkinaeehilrjwvw

final pathophysiology.pptx

VandanaChandan1

Clinical Reasoning MEDICINE.pptx

Amr El-Ghammaz

Pneumonia Of Left Lung Essay.docx

sdfghj21

Domestic animal diseases.pptx

NarayanNeupane3

Fundamental of epidemioloy

Mahmoud Shaqria

Similar a CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx (20)

For this assignment, you are to complete aclinical case - narrat.docx

STUDY DESIGNs PRESENTATION BY AFFRAM.pdf

General teaching about disease

Chronic Obstructive Pulmonary Disease Demographic Information.docx

Epidemiology an overview

This assignment addresses the following objectives 1. .docx

Hepatocellular CarcinomaDefine the disease,Demographics of t.docx

Study Designs in Epidemiology-Ahmed Mandil-2.ppt

04Introduction_to_Pathophysiology.pptx

04Introduction_to_PF.ppt

Knowledge Base System in Medicine with Special Reference to Consulting Physician

Comprehensive SOAP TemplateThis template is for a full history.docx

Obstetrics and gynecology outpatient scenario of an Indian homeopathic hospit...

DISSERTATION PRESENTATION.pptx

Pathology.ppt

final pathophysiology.pptx

Clinical Reasoning MEDICINE.pptx

Pneumonia Of Left Lung Essay.docx

Domestic animal diseases.pptx

Fundamental of epidemioloy

Más de mydrynan

CSIA 413: Cybersecurity Policy, Plans, and Programs June 2, 2019 Executive Summary The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives. Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system. Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company. Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD. Acceptable Use Policy Introduction This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information. Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly. Policy Content Utilization of IT Systems Red Clay Renovation possesses the property rights to all informati.

CSIA 413 Cybersecurity Policy, Plans, and Programs.docx

mydrynan

CSIS 100 CSIS 100 - Discussion Board Topic #1: One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries. There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major. Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process: · First, define each field (i.e. IS, IT, CS). Understand the similarities and differences. · Second, determine what jobs are available in each area. · Third, look at the degree completion plans for each of these programs. · Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?) · Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities. · Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal? To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first. The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university: http://www.liberty.edu/academics/registrar/index.cfm?PID=2981 Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible. Discussion Board Deliverables Main Post: In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following: 1. Your desired career upon graduation 2. Why you chose this career 3. Your intended major 4. Your strengths, weaknesses, and interests 5. How the major supports your chosen career 6. How God has led you to reach your decision 7. A Bib.

CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx

mydrynan

CSI Paper Grading Rubric- (worth a possible 100 points) .docx

mydrynan

CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting: (a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System (b) Audit Plan for assessing employee awareness of and compliance with IT security policies a. Are employees aware of the IT security policies in the Employee Handbook? b. Do employees know their responsibilities under those policies? (c) Audit Plan for assessing the IT security policy system a. Do required policies exist? b. Have they been updated within the past year? c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)? Your Task Assignment As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors. · For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.

CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx

mydrynan

CSI 170 Week 3 Assingment Assignment 1: Cyber Computer Crime Assignment 1: Cyber Computer Crime Create a 15-slide presentation in which you: 1. Describe the responsibilities of the National Security Administration (NSA). 2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively. 3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography. 4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices. 5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year. 4/15/2019 Auden, Musée des Beaux Arts english.emory.edu/classes/paintings&poems/auden.html 1/1 Musee des Beaux Arts W. H. Auden About suffering they were never wrong, The old Masters: how well they understood Its human position: how it takes place While someone else is eating or opening a window or just walking dully along; How, when the aged are reverently, passionately waiting For the miraculous birth, there always must be Children who did not specially want it to happen, skating On a pond at the edge of the wood: They never forgot That even the dreadful martyrdom must run its course Anyhow in a corner, some untidy spot Where the dogs go on with their doggy life and the torturer's horse Scratches its innocent behind on a tree. In Breughel's Icarus, for instance: how everything turns away Quite leisurely from the disaster; the ploughman may Have heard the splash, the forsaken cry, But for him it was not an important failure; the sun shone As it had to on the white legs disappearing into the green Water, and the expensive delicate ship that must have seen Something amazing, a boy falling out of the sky, Had somewhere to get to and sailed calmly on. Pieter Brueghel, The Fall of Icarus Oil-tempera, 29 inches x 44 inches. Museum of Fine Arts, Brussels. See also: William Carlos Williams' "Landscape with the Fall of Icarus " Return to the Poem Index javascript:openwin('Icarus.jpg',530,330) http://english.emory.edu/classes/paintings&poems/Williams.html http://english.emory.edu/classes/paintings&poems/titlepage.html 1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora. 2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald. 3. Nora’s treatment by Krogstad. 4. Nora’s contrast with Christine INTRO: Females in Conflict Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen. Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes the format of a playwright to convey through the use of evolving characters different political and social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the other characters.

CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx

mydrynan

CSE422 Section 002 – Computer Networking Fall 2018 Homework 2 – 50 points Sockets (10 points) 1. For a client-server application over TCP, why must the server program be executed before the client program? 2. For a client-server application over UDP, why may the client program be executed before the server program? 3. The UDP server shown in the course slides needed only one socket, whereas the TCP server needed two sockets. Why? 4. If the TCP server were to support N simultaneous connections, each from a different client host, how may sockets would the TCP server need? 5. You are creating an event logging service that will be handling event messages from multiple remote clients. This service can suffer delays in message delivery and even the loss of some event messages. Would you implement this using TCP or UDP? Why? The HTTP GET message (10 Points) Consider the figure below, where a client is sending an HTTP GET message to a web server, gaia.cs.umass.edu. Suppose the client-to-server HTTP GET message is the following: GET /kurose_ross/interactive/quotation1.htm HTTP/1.1 Host: gaia.cs.umass.edu Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic, audio/vnf.wave, video/mp4, video/wmv, application/*, */* Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800 User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML, like Gecko) Chrome/17.0.963.56 Safari/535.11 Answer the following questions: 1. What is the name of the file that is being retrieved in this GET message? 2. What version of HTTP is the client running? CSE422 Section 002 – Computer Networking Fall 2018 3. What formats of text, images, audio, and video does the client browser prefer to receive? [Note: for this and the following questions on browser media and language preferences, you will need to do a bit of additional reading on the Web. Here is a good place to start.] 4. What do the strings "application/*" and "*/*" signify in the Accept: header? 5. What languages is the browser indicating that it is willing to accept? [Note: you can look at your own browser preferences to get a listing of language codes.] 6. What is the meaning of the "relative quality factor," q, associated with the various version of English? [Note: Here is a good place to start. See also [RFC 2616].] 7. What is the client's preferred version of English? What is the browser's least preferred version of English? 8. Does the browser sending the HTTP message prefer Swiss French over traditional French? Explain. 9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If so, approximately how long ago did the client receive the file, assuming the GET request has just been issued? 10. What is the type of client browser and the client's operating system? [Note: To answer this, you'll need to understan.

CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx

mydrynan

CSCI 132: Practical Unix and Programming Adjunct: Trami Dang Assignment 4 Fall 2018 Assignment 41 This set of exercises will strengthen your ability to write relatively simple shell scripts using various filters. As always, your goals should be clarity, efficiency, and simplicity. It has two parts. 1. The background context that was provided in the previous assignment is repeated here for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt is a DNA string of length 21. Each sequence of three consecutive letters is called a codon. For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac, and tgt. Your task is to write a script named codonhistogram that expects a file name on the command line. This file is supposed to be a dna textfile, which means that it contains only a DNA string with no newline characters or white space characters of any kind; it is a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the number of occurrences of every codon in the file, assuming the first codon starts at position 13, and it must output the number of times each codon occurs in the file, sorted in order of decreasing frequency. For example, if dnafile is a file containing the dna string aacgtttgtaaccagaactgt, then the command codonhistogram dnafile should produce the following output: 3 aac 2 tgt 1 cag 1 gtt because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes first, then the codon name. 1 This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/. 2 This is really just a simplification to make the assignment easier. In reality, it is not necessarily a multiple of 3. 3 Tho.

CSCI 132 Practical Unix and Programming .docx

mydrynan

* CSCI 714: Software Project Planning and Estimation Lecture 4B: Work Breakdown Structure Gursimran Singh Walia North Dakota State University [email protected] * The Work Breakdown StructureA work breakdown structure (WBS) is an outcome-oriented analysis of the work involved in a project that defines the total scope of the projectIt is a foundation document in project management because it provides the basis for planning and managing project schedules, costs, and changes Approaches to Developing WBSsUsing guidelines: Some organizations, like the DOD, provide guidelines for preparing WBSsThe analogy approach: It often helps to review WBSs of similar projectsThe top-down approach: Start with the largest items of the project and keep breaking them downThe bottoms-up approach: Start with the detailed tasks and roll them up Basic Principles for Creating WBSs* 1. A unit of work should appear at only one place in the WBS. 3. A WBS item is the responsibility of only one individual, even though many people may be working on it. 4. The WBS must be consistent with the way in which work is actually going to be performed; it should serve the project team first and other purposes only if practical. 5. Project team members should be involved in developing the WBS to ensure consistency and buy-in. 6. Each WBS item must be documented to ensure accurate understanding of the scope of work included and not included in that item. 7. The WBS must be a flexible tool to accommodate inevitable changes while properly maintaining control of the work content in the project according to the scope statement. *Cleland, David I. Project Management: Strategic Design and Implementation, 1994 Good WBS Design PrinciplesThe 100% RuleThe WBS defines 100% of the work of the projectAnything that isn’t defined in the WBS is outside the scope of the project.The work content on any item is the sum of what is included under that work itemUpper Levels are Planned outcomes (deliverables), not planned actionsEnds of WBS include the activities needed to create the project deliverablesMutually-exclusive elementsWork should only appear in one place in the WBSWBS must be consistent with the way the project will be performed and controlledMust be easy to update WBS RolePartition the major project deliverables into smaller components to improve the accuracy of cost estimatesProvide a mechanism for collecting actual costsProvide a mechanism for performance measurement and control Why create a WBS?Cost EstimatingCost BudgetingResource PlanningRisk Management PlanningActivity Definition SchedulingScheduling forces:Quantification of discrete effortPlacement of tasks in proper relationshipTwo most common scheduling methodologiesBar Charts (aka Gantt Charts)Critical Path Method (CPM) using Precedence Diagramming Method (PDM) Bar / Gantt Charts Defined:Analyze and specify the basic approach in executionSegment into reasonable number of activitiesEstimate the time required.

CSCI 714 Software Project Planning and EstimationLec.docx

mydrynan

CSCI 561 Research Paper: Topic Proposal and Outline Instructions The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course. Each Topic Outline must include the following 3 items: 1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”. 2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions” 3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources. Example formats for Topic Outlines (an example, not a template): Research Objectives · Briefly describe the overall concept of system integration. · Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach. · Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages. · Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches. Questions 1. Why is system integration an important step in the software development process? 2. Why has big-bang integration not survived as a useful testing method? 3. Why have top-down and bottom-up integration not been replaced by more modern methods? 4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively? References 1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165. 2. Testing Computer Software, 2nd Edition, by Cem Kaner 3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley. During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email. The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2. The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5. Quantitative Reasoning 2 Project Shawn Cyr MTH/216 01/16/2019 Mr. Kim Running head: QUANTITATIVE REASONING 2 PROJEC.

CSCI 561Research Paper Topic Proposal and Outline Instructions.docx

mydrynan

CSCI 561 DB Standardized Rubric 50 Points Criteria Levels of Achievement Content Advanced Proficient Developing Not present Thread (19 pts.) Student effectively answers the questions with supporting material from the week’s reading with thoughtful analysis. Christian worldview integration found, supported by scripture. 19 to 17 points* Student’s post effectively answers both questions in the discussion board by thoroughly analyzing material presented by the course readings (internal sources) as well as other academically approved sources (external). Post shows a thorough interaction with material in a thought-provoking manner to encourage class interaction. 16 points* Student’s post effectively answers the key points of both questions in the discussion board. Post reveals interaction with course readings (internal) sources or other academically approved (external) sources. Post shows proficient interaction with material in logical manner so as to encourage class interaction. 15 to 1 points* Student’s post answers all or most of the key points of both questions in the discussion board. Post reveals interaction with some course (internal) sources or other (external) sources. Post shows moderate interaction with material in logical manner which may or may not promote class interaction. 0 points No post was made for this thread. Reply 1 (8 pts) Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture. 8 points* Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with both course readings (internal sources) and other academically approved sources (external). Biblical integration found. 7 points* Student’s reply adds some depth to the ongoing conversation and encourages collaborative discussion among peers in a proficient way. Student supports their thoughts with either course readings (internal sources) or other academically approved sources (external). Biblical integration found. 6 to 1 points* Student’s reply adds minimal depth to the ongoing conversation among peers in a thought-provoking way. Student supports their thoughts with either course readings (internal sources) or other sources (external). Biblical integration may or may not be found. 0 points No initial reply was made for this thread. Reply 2 (8 pts) Student commentary adds value to the ongoing conversation, supports thoughts with academic material. Christian worldview integration found, supported by scripture. 8 points* Student’s reply adds notable depth to the ongoing conversation and encourages collaborative discussion among peers in a thought-provoking way. Student supports their thoughts with course readings (internal sources) or other academically approved sources (external). Biblical integration found. 7 points* Student’s reply adds some depth to the .

CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx

mydrynan

CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx

mydrynan

CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx

mydrynan

CSCE 1040 Homework 2 For this assignment we are going to design a system to schedule drivers and passengers for rides in the Mean Green EagleLift system For this we will need the following entities, plus collections for each of the entities: Driver, Passenger and Ride. The data for a Driver will contain at least the following: Driver Id (6 digits) Driver Name (20 characters each for first and last name) Vehicle Capacity ( integer value for number of passengers) Handicapped Capable (Boolean) Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other) Driver Rating (floating point value 0-5) Available (Boolean) Pets allowed (Boolean) Notes (String – could include days and hours of operation, coverage area, etc) You may add other data needed for your implementation as well as you will need accessor and mutator functions for the data. The data for a Passenger will contain at least: Name (e.g. Fred Smith) ID number (6 digits e.g. 123456) Payment preference (cash, credit, debit) Handicapped (Boolean) Default rating required (floating point) Has pets (Boolean) You may add other data needed for your implementation as well as you will need accessor and mutator functions for the data. The data for a Ride (The transaction entity) will contain at least the following: Ride ID (8 digit value auto assigned) Pickup location (string) Pickup Time (Time value) Drop-off location (string) Size of party (whole number) Includes pets (Boolean) Drop-off time (Time value – entered at completion) Status (Active, Completed, Cancelled) Rating by customer (floating point value) You may add other data needed for your implementation as well as you will need accessor and mutator functions for the data. For the collections of each of the 3 Entity Classes identified above you will need to include the ability to: Add Edit Delete Search/Find based on appropriate criteria Print a list of all entries in the specific collection Print the details for a single entity (do a find first) Print a list of all Rides for a particular Passenger Print a list of all Rides for a Particular Driver Print a list of all Active (future and current) Rides, all completed rides and all cancelled rides for the Rides collection when you add a Ride you will need to verify that a. the Driver selected is available during the defined time period b. the Driver selected has number of seats sufficient for the passengers c. The Driver has the appropriate pet policy d. The Driver has required Handicapped capability e. the driver has at least the minimum rating preferred by the Passenger Note that a particular Driver could have multiple assignments as long as they do not conflict with dates or times. For this assignment you do not need to worry about verifying availability based on starting and ending locations. You will also need to provide in the Rides collection the ability to print an assignment schedule for a particular .

CSCE 1040 Homework 2 For this assignment we are going to .docx

mydrynan

CSCE 509 – Spring 2019 Assignment 3 // updated 01May19 DUE: May 11, 2019 at 5 p.m. • Two data sets available on Moodle o {concaveData.npy, concaveTarget.npy} o {testData.npy, testTarget.npy} • Write TensorFlow code to perform DNN classification with three (3) classes • Use concave*.npy for training • Use test*.npy for test • Data is the data matrix; Target is the labeled targets from {0, 1, 2} • Do each of the following steps. For each step: Note the accuracy of the classification using the test data set. Discuss the results. 1. Write TensorFlow code to perform DNN classification using default settings. Define your own architecture with two hidden layers. Calculate the number of parameters in your network. Do not let the number of parameters exceed the number of input samples in concave*.npy 2. Use one or two additional layers compared to (1) but be sure that the number of parameters do not exceed the number of input samples. Which has better accuracy performance? Or are they about the same? 3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”) to each input feature. Write the data sets as files, to be read in as input sets. Repeat the classification using the new input files with the architecture that has better performance in (1) or (2). What is the accuracy performance for the same number of epochs? If the accuracy performance is about the same, does it converge faster or slower or about the same? 4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change the tf.layers.dense() function initlialization to He initialization by using the variance_scaling_initializer() function: he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0) hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu, kernel_initializer=he_init, name=”hidden1”) # do the same for other hidden layers What is the accuracy performance? Compare to either (1) or (2). 5. Take the architecture from either (1) or (2). Replace the relu activation function by the exponential linear unit (ELU). In the tf.layers.dense function, use activation=tf.nn.elu What is the accuracy performance? Compare to either (1) or (2) and to (4). 6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and normalize the inputs to the activation function of each layer by learning the mean and scales of the inputs for each layer. Modify the Python code as follows: X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”) training = tf.placeholder_with_default(False, shape=(), name=”training”) Then in defining the hidden layers: hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”) batchnorm1 = tf.layers.batch_normalization(hidden1, training=training, momentum=0.9) bn1_act = tf.nn.elu(batchnorm1) hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”) batchnorm2 = tf.layers.batch_normalization.

CSCE509–Spring2019Assignment3updated01May19DU.docx

mydrynan

CSCI 2033: Elementary Computational Linear Algebra (Spring 2020) Assignment 1 (100 points) Due date: February 21st, 2019 11:59pm In this assignment, you will implement Matlab functions to perform row operations, compute the RREF of a matrix, and use it to solve a real-world problem that involves linear algebra, namely GPS localization. For each function that you are asked to implement, you will need to complete the corresponding .m file with the same name that is already provided to you in the zip file. In the end, you will zip up all your complete .m files and upload the zip file to the assignment submission page on Gradescope. In this and future assignments, you may not use any of Matlab’s built-in linear algebra functionality like rref, inv, or the linear solve function A\b, except where explicitly permitted. However, you may use the high-level array manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements” and “Concatenating Matrices” in the Matlab documentation for more information. However, you are allowed to call a function you have implemented in this assignment to use in the implementation of other functions for this assignment. Note on plagiarism A submission with any indication of plagiarism will be directly reported to University. Copying others’ solutions or letting another person copy your solutions will be penalized equally. Protect your code! 1 Submission Guidelines You will submit a zip file that contains the following .m files to Gradescope. Your filename must be in this format: Firstname Lastname ID hw1 sol.zip (please replace the name and ID accordingly). Failing to do so may result in points lost. • interchange.m • scaling.m • replacement.m • my_rref.m • gps2d.m • gps3d.m • solve.m 1 Ricardo Ricardo Ricardo Ricardo � The code should be stand-alone. No credit will be given if the function does not comply with the expected input and output. Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late; No point for more than 48 hours late. 2 Elementary row operations (30 points) As this may be your first experience with serious programming in Matlab, we will ease into it by first writing some simple functions that perform the elementary row operations on a matrix: interchange, scaling, and replacement. In this exercise, complete the following files: function B = interchange(A, i, j) Input: a rectangular matrix A and two integers i and j. Output: the matrix resulting from swapping rows i and j, i.e. performing the row operation Ri $ Rj . function B = scaling(A, i, s) Input: a rectangular matrix A, an integer i, and a scalar s. Output: the matrix resulting from multiplying all entries in row i by s, i.e. performing the row operation Ri sRi. function B = replacement(A, i, j, s) Input: a rectangular matrix A, two integers i and j, and a scalar s. Output: the matrix resulting from adding s times row j to row i, i.e. performing the row operatio.

CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx

mydrynan

CSCE 3110 Data Structures & Algorithms Summer 2019 1 of 12 Project 3 – Hopscotch Hash Table Due: 11:59 PM on Friday, June 21, 2019 PROGRAM DESCRIPTION In this C++ program, you will implement an efficient hopscotch hash table that improves on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17 and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve collisions using linear probing where the maximal length of the probe sequence (i.e., distance away from the original hash location) is bound by the hopscotch hash algorithm where MAX_DIST = 4. You shall support the following five operations that are menu driven: 1. Insert Value 2. Delete Value 3. Search Value 4. Output Table 5. Exit Program All data shall be entered through the console and consist of integers. You may assume valid data, though data may be out of range (i.e., zero, negative integers or possibly out of range of menu options). Your algorithm to find the next available slot is bound by the end of the table so that the linear probe sequence need not be circular. In other words, you do not need to wrap around beyond the last element of the array to the first for either the linear probe or the bound for the hopscotch algorithm. For example, if the user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in the array, but an element already exists at that location, the insert will fail as there are no more array locations beyond this to attempt to insert the element. You must keep an item array containing the elements as well as an associated hop array that indicates positions in the item array that are occupied with items that hash to the same value. You should also provide specific feedback to the user on successful operations or when an operation failed. The search should utilize the hash value and then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not simply search the entire array to accomplish this operation. Be sure to handle the case that requires multiple hops (i.e., using recursion) to get the value within the correct range. REQUIREMENTS • Your code should be well documented in terms of comments. For example, good comments in general consist of a header (with your name, course section, date, and brief description), comments for each variable, and commented blocks of code. • Your program will be graded based largely on whether it works correctly on the CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that your program compiles and runs on a CSE machine. aemalki aemalki aemalki aemalki aemalki aemalki aemalki aemalki CSCE 3110 Data Structures & Algorithms Summer 2019 2 of 12 • You should contact your instructor if there is any question about what is being asked for. • This is an individual programming assignment that must be the sole work of the individual student. Any in

CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx

mydrynan

CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx

mydrynan

CSC-321 Final Writing Assignment In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The article will include the following components: 1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field to the company attacked by the vulnerability. a. Audience: A C-level business executive. Do not assume they will have any technical knowledge but assume they are very interested in the economic impact of things. b. Purpose: Provide a summary that they will use to make business decisions from. You need to be convincing that the cost of security makes business sense. 2) Technical report: a 3-page technical report including the following topics: Introduction, Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable), technological impact (if applicable), political impact (if applicable), patches available/needed to prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and recommendations for company XYZ to protect itself from similar vulnerabilities. a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of computer science, engineering, and math but no specific security knowledge. b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a similar one against XYZ. 3) Press release: a 2-page article for popular consumption (think wired). This should explain the vulnerability, protection, and potential impact to general audiences (users and share-holders). a. Format: 2-page wired article. Be informative, objective, and entertaining b. Audience: General public who are interested in technology but may have never taken a computer science course and, almost certainly, have never taken a computer security course. c. Purpose: To express your understanding to a broad audience. Choosing your topic Your article must be about a recent computer security exploit with real world impacts. You must get your topic approved in lab or by email before April 22nd. Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go over and should be no more than ¼ column under. Press release (2 pages) Draft: Apr, 29 Due: May, 13 Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is intended for a general audience who is interested in technology but does not have formal technical backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if anything) the general audience should do. This article should be informative, objective, and entertaining. Executive Summary (1 page) .

CSC-321 Final Writing Assignment In this assignment, you .docx

mydrynan

Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations. The following are the deliverables for this project: Deliverables Enterprise Key Management Plan: An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations. Enterprise Key Management Policy: A two- to three-page double-spaced Word document. Lab Report: A Word document sharing your lab experience along with screenshots. There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.” When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission. Step 1: Identify Components of Key Management Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem. Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care. Review these authentication resources to learn about authentication and the characteristics of key management. Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram. Read these resources on data at rest , data in use, and data in motion . Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed. Review these resources on insecure handling, and identify areas where insecure handling may be a concern for your organization. Incorporate this information in your key management plan. In the next step, you will consider key management capabilities. Step 3: Identify Key Management Gaps, Risks, Solution s, and Challenges In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care. Conduct independent research to identify typical gaps in key manage.

Cryptography is the application of algorithms to ensure the confiden.docx

mydrynan

CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too. Please modify the server.c such that the server can carry out the same communication with 3 clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”). Client.c #include #include #include #include #include #include #include #include void error(const char *msg) { perror(msg); exit(0); } int main(int argc, char *argv[]) { int sockfd, portno, n; struct sockaddr_in serv_addr; struct hostent *server; char buffer[256]; if (argc < 3) { fprintf(stderr,"usage %s hostname port\n", argv[0]); exit(0); } portno = atoi(argv[2]); sockfd = socket(AF_INET, SOCK_STREAM, 0); if (sockfd < 0) error("ERROR opening socket"); server = gethostbyname(argv[1]); if (server == NULL) { fprintf(stderr,"ERROR, no such host\n"); exit(0); } bzero((char *) &serv_addr, sizeof(serv_addr)); serv_addr.sin_family = AF_INET; bcopy((char *)server->h_addr, (char *)&serv_addr.sin_addr.s_addr, server->h_length); serv_addr.sin_port = htons(portno); //printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr)); if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0) error("ERROR connecting"); printf("Please enter the message: "); bzero(buffer,256); fgets(buffer,255,stdin); n = write(sockfd,buffer,strlen(buffer)); if (n < 0) error("ERROR writing to socket"); bzero(buffer,256); n = read(sockfd,buffer,255); if (n < 0) error("ERROR reading from socket"); printf("%s\n",buffer); close(sockfd); return 0; } Server.c /* A simple server in the internet domain using TCP The port number is passed as an argument */ #include #include #include #include #include #include #include #include void error(const char *msg) { perror(msg); .

CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx

mydrynan

Más de mydrynan (20)

CSIA 413 Cybersecurity Policy, Plans, and Programs.docx

CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx

CSI Paper Grading Rubric- (worth a possible 100 points) .docx

CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx

CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx

CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx

CSCI 132 Practical Unix and Programming .docx

CSCI 714 Software Project Planning and EstimationLec.docx

CSCI 561Research Paper Topic Proposal and Outline Instructions.docx

CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx

CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx

CSCE 1040 Homework 2 For this assignment we are going to .docx

CSCE509–Spring2019Assignment3updated01May19DU.docx

CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx

CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx

CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx

CSC-321 Final Writing Assignment In this assignment, you .docx

Cryptography is the application of algorithms to ensure the confiden.docx

CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx

Último

Accessible Digital Futures project (20/03/2024)

Jisc

Making communications land - Are they received and understood as intended? webinar Thursday 2 May 2024 A joint webinar created by the APM Enabling Change and APM People Interest Networks, this is the third of our three part series on Making Communications Land. presented by Ian Cribbes, Director, IMC&T Ltd @cribbesheet The link to the write up page and resources of this webinar: https://www.apm.org.uk/news/making-communications-land-are-they-received-and-understood-as-intended-webinar/ Content description: How do we ensure that what we have communicated was received and understood as we intended and how do we course correct if it has not.

Making communications land - Are they received and understood as intended? we...

Association for Project Management

FSB Advising Checklist - Orientation 2024

Elizabeth Walsh

How to Give a Domain for a Field in Odoo 17

Celine George

Graduate Outcomes Presentation Slides - English

neillewis46

Key note speaker Neum_Admir Softic_ENG.pdf

Admir Softic

Micro-Scholarship, What it is, How can it help me.pdf

Poh-Sun Goh

ICT Role in 21st Century Education & its Challenges.pptx

AreebaZafar22

Introduction to Nonprofit Accounting: The Basics

TechSoup

Google Gemini An AI Revolution in Education.pptx

Dr. Sarita Anand

Wizards are very useful for creating a good user experience. In all businesses, interactive sessions are most beneficial. To improve the user experience, wizards in Odoo provide an interactive session. For creating wizards, we can use transient models or abstract models. This gives features of a model class except the data storing. Transient and abstract models have permanent database persistence. For them, database tables are made, and the records in such tables are kept until they are specifically erased.

How to Create and Manage Wizard in Odoo 17

Celine George

This PowerPoint helps students to consider the concept of infinity.

christianmathematics

Python Notes for mca i year students osmania university.docx

Ramakrishna Reddy Bijjam

Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes

Celine George

Basic Civil Engineering notes first year Notes Building notes Selection of site for Building Layout of a Building What is Burjis, Mutam Building Bye laws Basic Concept of sunlight ventilation in building National Building Code of India Set back or building line Types of Buildings Floor Space Index (F.S.I) Institutional Vs Educational Building Components & function Sills, Lintels, Cantilever Doors, Windows and Ventilators Types of Foundation AND THEIR USES Plinth Area Shallow and Deep Foundation Super Built-up & carpet area Floor Area Ratio (F.A.R) RCC Reinforced Cement Concrete RCC VS PCC

Basic Civil Engineering first year Notes- Chapter 4 Building.pptx

Denish Jangid

SOC 101 Demonstration of Learning Presentation

camerronhm

Spatium Project Simulation student brief

Association for Project Management

Unit-IV- Pharma. Marketing Channels.pptx

VishalSingh1417

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

MaritesTamaniVerdade

On National Teacher Day, meet the 2024-25 Kenan Fellows

Mebane Rash

CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx

1. CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT LESSON PLAN OVERVIEW: ● Students will engage in critical thinking regarding the systems of the human body and pathology in Anatomy, and specifically the for the following topics: Integumentary, musculoskeletal, pulmonary, respiratory, urinary, circulatory, male/female reproductive, electrolytes/hydration, endocrine, and immune/lymphatic. SPECIFIC TOPIC/Assigned pathology : Asthma -Students will be assigned pathology 2 week of the course, they will be assigned to develop a Research Document Report and PowerPoint by apply researched information on their topic. Define the disease, Cause of the disease, Signs & Symptoms of the disease (If apply, include stages, levels, or types of the disease),

2. Laboratory findings (include, all blood test names, genetic test, urine test, i.e.) Must include all normal versus abnormal levels that will confirm the disease, Images of the Disease (X-ray, MRI, Ct Scans, PET scans), Treatment for the disease (this includes name of the medications, dosage, side effects, alternative medications, Diet for the patient, Demographics of the disease, Prognosis of the disease, Photos of the disease throughout the PowerPoint presentation. 11. All students must apply APA and writing style format. References must be within the last 5 years and no less than 10 references. -All references are to be included in the PowerPoint presentation and Written Report in APA format. Websites: ● Google scholar, eMedicine, World Health Origination (WHO), Center for Disease and Prevention Control (CDC), Web-Med,

3. MayoCLinic, and other healthcare organizations, i.e Recommended reading: Martini, Nath, & Bartholomew. Fundamental’s Of Anatomy & Physiology, 11th Edition. Pearson

CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx

Recomendados

Recomendados

Más contenido relacionado

Similar a CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx

Similar a CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx (20)

Más de mydrynan

Más de mydrynan (20)

Último

Último (20)

CRITICAL THINKING RESEARCH REPORT AND POWERPOINT ASSIGNMENT.docx