The document discusses using surface entropy reduction (SER) mutations to improve crystallization of an RNA-Fab complex. Key points: - SER mutations were identified on the Fab surface using software to reduce flexibility and promote crystal contacts. Mutations were incorporated using Kunkel mutagenesis. - Mutant Fabs (Fab2SMA, Fab2SMS) were expressed at 3-4 mg/L and bound RNA similarly to the wild type Fab. Initial crystal hits were found for the mutant complexes. - The SER approach aims to generalize to other RNA-Fab complexes, as demonstrated by binding of mutant Fabs to the VCIII riboswitch. Optimization of crystal hits is ongoing to improve diffraction resolution

1. Surface Entropy Reduction to increase the crystallizability of the Fab-RNA complex Priyadarshini P. Ravindran

2. INTRODUCTION 2

4. Fewer surface functional groups

6. Chaperone Assisted RNA Crystallography Crystallization chaperone - an auxiliary protein such as fragments of monoclonal antibody that binds to RNA of interest and increases its crystallization probability These chaperones 1. Mask the counterproductive surfaces while extending surfaces predisposed to forming crystal contacts 2. Provide good initial phasing information 3. Reduce conformational heterogenity 4

7. Concept of crystallization chaperones 5 CurrOpinStructBiol Koide 2009

8. Schematic Representation of IgG, Fab and Fv http://www.ub.es/biocel/wbc/tecnicas/anticuerpos.htm 6

9. Phage Display as a Platform for Obtaining anti-RNA Antibodies Amenable nuclease; Fast; Economical; High-throughput 7

11. Dr.Yeet al, have successfully crystallized this P4-P6/Fab2 complex (1.95Å )P4-P6/Fab2 complex 8 Ye et al. PNAS 2008

12. Fab Participates Extensively in Crystal Packing Greenbluegrey: RNA RedMangenta: Fab 9

13. Crystal Structure (1.95 Å) of ∆C209 P4-P6/Fab2 Electron density 2Fo-Fc map calculated with Fab model-based phases. The map is shown around the selected C209 P4-P6 regions at 1 level. 4 oC, 25 mM Mg, 36~39% MPD, 0.2 M NH4OAc, 0.1 M Na Citrate pH 5.4~5.9 10

14. Lysine Glutamate RotamersRotamers Surface Entropy Reduction Rational Protein Crystallization by mutational surface engineering – ZygmuntS.Derewenda Protein-Protein interaction disfavors lysine and glutamate residues, mutating large flexible side chains with smaller amino acid residues like alanine and serine lowers the surface entropy creating hotspots for crystal contact formation Residues to be chosen should not interfere with protein function 11

15. Proof of SER Principle - globular domain of RhoGDI KtoA Series Longenecker, et al., 2001 EtoA Series Van der Waal surface representation of RhoGDI with Lysines and glutamates Mateja, et al., 2002 Derewenda & Vekilov ., 2005 12

16. Identifying probable SER mutation residues on ∆C209 P4-P6/Fab2 13

17. Crystal structure of ∆C209 P4-P6/Fab2 (2R8S) 14

19. The suggestions from the web-based surface entropy software are as follows15

20. Identified SER mutations K217(H) K218(H) E220(H) K190(L) E123(L) Supermutant Alanine(SMA) : ∆C209 P4-P6/Fab2SMA Supermutant Serine (SMS) : ∆C209 P4-P6/Fab2SMS Kunkel mutagenesis - method used to incorporate the mutations Since the 5 mutations are at different locations, 3 Kunkel primers were in use 16

21. Construction of the ∆C209 P4-P6/Fab2 mutants 17

22. Kunkel Mutagenesis CJ236 XL1blue M13 Helper phage infection 18

23. Design of Kunkel primers Lys217,Lys218,Glu220 and Stop codon (heavy chain) AGCAACACCAAGGTCGACGCCGCCGTTGCCCCCAAATCTTGTGAC AAACTACACATAGGGCCGGCCCTCTGGTTCC Melting temp 5’end = 56 oC Melting temp 3’end = 64 oC Glu123(Light chain) CTTCATCTTCCCGCCATCTGATGCCCAGTTGAAATCTGGAACTGC Melting temp 5’end = 66 oC Melting temp 3’end = 58 oC Lys190(Light chain) AGCAGACTACGAGAAACACGCCGTCTACGCCTGCGAAGTA Melting temp 5’end = 56 oC Melting temp 3’end = 60 oC GCC a frequent Alanine coding triplet, AGC a frequent Serine coding triplet 19

24. Large scale expression and purification of the Fabs 20

25. Expression and Purification of Fabs P4P6Fab2SMA,P4P6Fab2SMS,P4P6Fab2 clones were transformed into 34B8 cells for expression in the CRAP media prepared as per protocol Proteins were purified by affinity chromatography (protein A column) 1- Standard protein marker 5-P4P6/Fab2SMS non-reduced 2-P4-P6/Fab2SMA reduced 6-P4P6Fab2 reduced 3- P4-P6/Fab2SMA non-reduced 7-P4P6Fab2 non-reduced 4-P4-P6/Fab2SMS reduced 21

27. 24 hrs incubation 1L CRAP/ampicillin culture in 2.8 L baffled flask at 30 oC 250 RPMTrials for media optimization for Fab expression-variation in media volume

29. 24 hrs incubation 500 ml CRAP/ampicillin culture in 2.8 L baffled flask at 30 oC 300 RPMIndications for good yield are After 24 hr OD600nm >6 Good observable foaming 23

30. Large scale expression and purification of ∆C209 P4-P6/Fab2SMA Expression in two batches of 3L each in CRAP/amp media After protein A purification P4P6Fab2SMA ~ 3.7mg/L 1 2 1 P4P6Fab2SMA 2 Standard marker 50 kD 25 kD 24

31. High S resin purification of ∆C209 P4-P6/Fab2SMA 50 kD 25 kD 1- Standard protein marker 4- After protein A column P4P6Fab2SMA 7- After 1st round of high S P4P6Fab2SMA 8-After 2nd round of high S P4P6Fab2SMA 25

32. Nuclease test activity data for the Fabs binding to ∆C209 P4-P6 *unrelated RNA added in all the lanes Lane1-P4P6Fab2 Lane2-P4P6Fab2SMA Lane3-P4P6Fab2SMS Lane4-Fab storage buffer Lane5-TE buffer Lane6-ddWater 1 2 3 4 5 6 Intact RNA 87% 91% 89% 90% 92% 92% 26

33. Large scale expression and purification of the Fabs and RNA 27

34. Characterization of the Fab mutants 28

35. Dot-blot apparatus Nitrocellulose membrane Hybond N+ membrane 29

36. Scatter plot showing ∆C209 P4-P6 binding to wild-type and mutant Fabs 30 Hybond membrane Nitrocellulose membrane

37. Binding curves for the ∆C209 P4-P6 RNA binding to Fab2, Fab2SMA and Fab2SMS 31

38. Mobility shift analysis of the complex formation between ∆C209P4P6 RNA Fab2,Fab2SMA and Fab2SMS P4P6 Fab2 1:1.1,1:1.2,1:1.3 SMA 1:1.1,1:1.2,1:1.3,1:1.4 SMS 1:1.1,1:1.2,1:1.3,1:1.4 32 P4P6/Fab2 P4P6/Fab2 mutants P4P6 A working stoichiometric ratio of RNA: Fab =1:1.1 was determined.

39. Crystallization of ∆C209 P4-P6 and the Fab2 mutant complexes 33

40. Initial Crystal screening for P4-P6/Fab2, P4-P6/Fab2SMA, P4-P6/Fab2SMS complexes We have set up the crystal screening using the Hampton Crystal Screen I&II (96) and Index kit (96) and Natrix Crystal Screen I&II (96) Sitting drop technique Crystal screening conditions: Sample: P4-P6/Fab2, P4-P6/Fab2SMAandP4-P6/Fab2SMS Sample concentration: 12mg/ml Sample buffer: 10mM Tris pH7.5, 25mM MgCl2, 50mM NaCl, 0.5mM Spermine-4HCl and RNase inhibitor Reservoir volume: 100 μl Temperature: 4 oC and 20 oC Drop volume -1 μl Sample: 0.5 μl and Reservoir: 0.5μl 34

41. Sitting drop method ∆C209 P4-P6/Fab2 mutant crystals at 20 oC ∆C209 P4-P6/Fab2SMA crystal 0.15M DL-Malic acid pH 7.0, 20%w/v PEG 3,350 at 20 oC ∆C209 P4-P6/Fab2SMA crystal 0.2 M Magnesium chloride hexahydrate, 0.1 M Tris Ph 8.5, 3.4M 1,6-Hexanediol at 20 oC ∆C209 P4-P6/Fab2SMA 0.01 M Magnesium chloride hexahydrate, 0.05M MES monohydrate ph 5.6, 1.8 M Lithium sulfate monohydrate at 20 oC 35 ∆C209 P4-P6/Fab2SMS crystal 2.0 M NaCl, 10%w/v PEG 6000 at 20 oC

42. Sitting drop method ∆C209 P4-P6/Fab2 mutant crystals at 4 oC ∆C209 P4-P6/Fab2SMA 0.2 M Ammonium acetate, 0.1M Sodium citrate tribasicdihydrate pH 5.6, 30%v/v(+/-)-2-Methyl-2, 4-pentanediol at 4 oC ∆C209 P4-P6/Fab2SMS 0.2 M Ammonium acetate, 0.1M Sodium citrate tribasicdihydrate pH 5.6, 30%v/v(+/-)-2-Methyl-2, 4-pentanediol at 4 oC 36

43. 37 Optimization results using hanging drop technique

44. Surface engineered Fabs bind to VCIII glycineriboswitch 38 Strobel 2008

45. Surface engineered Fabs bind to VCIII glycineriboswitch 39

47. Optimisation of the shake flask expression of Fabs to 3-4mg/L was performed

48. Initial screening of all Fabscomplexed with P4-P6 side-by-side was performed to determine the crystal hit ratio using commercially available crystallization screening kits

49. Two new crystal forms showed diffraction VCIII binding SER mutant Fabs show good binding to VCIII indicating the generality of the SER mutations 40

50. Future Directions Using gel-filtration column to purify the Fab-RNA complex and employ seeding technique to get better resolution crystals Incorporation of the two other lysine mutations from the Category A K76(H), K169(L) Promotion of anti-parallel β sheet formation-crystal contact engineering 41

51. 42

52. Questions 43

53. Background slides 44

54. Hanging drop technique Sitting drop technique 45

55. Crystals are like structure amplifiers Molecule Unit cell Crystal lattice

56. CRAP media components Adjust pH to 7.3, autoclave.Then add the following (these solutions should be filtered sterile!) to cooled CRAP media (room temperature) 47

57. Fab Storage buffer composition 10 mMTris PH 7.5 and 50mM NaCl 48

59. If two yellow colors: M-13 binded to NAV so discard. If no color: M-13 didn’t bind to clone so no phage is present. Clone will have yellow color (binding) and control should have no color or intensity 3-10x less. Phage ELISA

60. 51 Crystal structure of class I ligase/BL3-6 (3IVK) Koldobskaya et al. NSMB 2010

61. Small scale extraction of mutated DNA Sequencing analysis of the mutated DNA 3/4 clones showed successful incorporation of alanine in both heavy chain and light chain 0/4 showed incorporation of serine in both chains Light chain serine mutations were added in the subsequent step(single strand extraction of mutated heavy chain) Kunkel mutagenesis was performed on ∆C209 P4-P6/Fab2 to incorporate the stop codon Positive clones were identified by colony PCR, DNA was extracted by mini-prep and pooled together Construction of Fabmutants 52

62. 53 Crystal contacts residues in several Fab-4D5 derivative containing structures

63. Examples of proteins crystallized using SER The RGSL domain of PDZRhoGEF Longenecker KL, et al. & Derewenda Z.S. Structure (2001) Unactivated insulin-like growth factor-1 receptor kinase Munshi, S. et al. & Kuo, L.C. ActaCryst (2003) Outer surface protein A of Borreliaburgdorferi Makabe, et al., Protein Science (2006) c-Src and its inactivatorCsk Levinson, et al., Cell (2008) 54

64. 55