Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

From Sequence to Knowledge (Phage Genomics Workshop Intro at the 22nd Biennial Evergreen Phage Meeting)

328 visualizaciones

Publicado el

This is an introduction to the Phage Genomics Workshop at the 22nd Biennial Evergreen International Phage Meeting, Aug 6 2017.
It introduces the workshop outline, system, and the genome annotation workflow

Publicado en: Ciencias
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

From Sequence to Knowledge (Phage Genomics Workshop Intro at the 22nd Biennial Evergreen Phage Meeting)

  1. 1. From Sequence to Knowledge Assembly, Annotation, and Analysis of Phage genomes from Genomic and Metagenomic Data Sets A helping hand through The Annotation Bottleneck Ramy K. Aziz
  2. 2. Workshop presenters 6 Aug 2017 Phage Genomics - Evergreen 2017 Alejandro Reyes AR Ramy Aziz RA Jason Gill JG
  3. 3. PRELUDE 6 Aug 2017 Phage Genomics - Evergreen 2017
  4. 4. A bit of history… • Since 2009, the Genomics Workshop has become an essential part of the Evergreen phage meeting • The challenge always is: how to meet needs/expectations that are so many and so diverse, in ~4 hours 6 Aug 2017 Phage Genomics - Evergreen 2017
  5. 5. A bit of history… • Since 2009, the Genomics Workshop has become an essential part of the Evergreen phage meeting • The challenge always is: how to meet needs/expectations that are so many and so diverse, in ~4 hours • The answer is: ……. 6 Aug 2017 Phage Genomics - Evergreen 2017
  6. 6. A bit of history… 6 Aug 2017 Phage Genomics - Evergreen 2017
  7. 7. The 2011 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  8. 8. The 2013 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  9. 9. The 2013 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  10. 10. The 2013 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  11. 11. The 2015 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  12. 12. The 2015 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  13. 13. The 2015 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  14. 14. The 2015 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  15. 15. The 2015 workshop 6 Aug 2017 Phage Genomics - Evergreen 2017
  16. 16. MOTIVATION 6 Aug 2017 Phage Genomics - Evergreen 2017
  17. 17. “The analysis bottleneck” • Observation: – We generate more data than we can analyze. – We generate sequence data faster than we can analyze them. • Opinion: – Not all bottlenecks are created equal! – It is important to define the question(s) before working on the answer(s)! 6 Aug 2017 Phage Genomics - Evergreen 2017
  18. 18. “The analysis bottleneck” • The Lavigne paradox (2013) 6 Aug 2017 Phage Genomics - Evergreen 2017
  19. 19. “The analysis bottleneck” • The Lavigne paradox (2013) 6 Aug 2017 Phage Genomics - Evergreen 2017
  20. 20. “The analysis bottleneck” • The Lavigne paradox (2015) 6 Aug 2017 Phage Genomics - Evergreen 2017
  21. 21. AUDIENCE 6 Aug 2017 Phage Genomics - Evergreen 2017
  22. 22. Workshop audience • Who (how many) among you have: – annotated at least a phage genome? – worked on a viral metagenome? – used the command line (Unix, Linux, Mac Terminal) for sequence analysis? • We have actually ran an online survey, and here is what we found … 6 Aug 2017 Phage Genomics - Evergreen 2017
  23. 23. Workshop audience 6 Aug 2017 Phage Genomics - Evergreen 2017
  24. 24. Workshop audience 6 Aug 2017 Phage Genomics - Evergreen 2017
  25. 25. Workshop audience 6 Aug 2017 Phage Genomics - Evergreen 2017
  26. 26. Workshop audience 6 Aug 2017 Phage Genomics - Evergreen 2017
  27. 27. Workshop audience 6 Aug 2017 Phage Genomics - Evergreen 2017
  28. 28. Quick group activity Defining the question(s): • Introduce yourself, your institution, and your favorite phage • Do you have a genome sequenced? Planning to? – Why have you sequenced your phage genome? – Why you want to sequence your phage genome? • What is the single most pressing question you want to have answered from genome analysis? 6 Aug 2017 Phage Genomics - Evergreen 2017
  29. 29. DEFINING THE QUESTION(S) 6 Aug 2017 Phage Genomics - Evergreen 2017
  30. 30. What you want …... is from genome from metagenome 6 Aug 2017 Phage Genomics - Evergreen 2017 Incomplete frameshift - complete - accurate Credit: Andrew Kropinski Credit: Bas Dutilh faulty assembly
  31. 31. What you want …... is from genome from metagenome 6 Aug 2017 Incomplete faulty assembly frameshift - complete - accurate Phage Genomics - Evergreen 2017 Credit: Andrew Kropinski Credit: Bas Dutilh
  32. 32. A process of reconstruction 6 Aug 2017 Phage Genomics - Evergreen 2017
  33. 33. A process of reconstruction • Experimentally 6 Aug 2017 Phage Genomics - Evergreen 2017 DNA TGATTGTGTGTTTGCGCAATGCG ATGTGTATATATAGTGAGCTTGCCC GTCTCTCTNNNTCTCTTG TGATTGGTCTNNNTCTCTTGCGCAATGCG
  34. 34. A process of reconstruction • Experimentally • Computationally 6 Aug 2017 Phage Genomics - Evergreen 2017 TGATTGTGTGTTTGCGCAATGCG ATGTGTATATATAGTGAGCTTGCCC GTCTCTCTNNNTCTCTTG TGATTGGTCTNNNTCTCTTGCGCAATGCG DNA TGATTGTGTGTTTGCGCAATGCG ATGTGTATATATAGTGAGCTTGCCC GTCTCTCTNNNTCTCTTG TGATTGGTCTNNNTCTCTTGCGCAATGCG
  35. 35. A process of reconstruction • Experimentally • Computationally 6 Aug 2017 Phage Genomics - Evergreen 2017 TGATTGTGTGTTTGCGCAATGCG ATGTGTATATATAGTGAGCTTGCCC GTCTCTCTNNNTCTCTTG TGATTGGTCTNNNTCTCTTGCGCAATGCG “Any phage one can get!” “eDNA” TGATTGTGTGTTTGCGCAATGCG ATGTGTATATATAGTGAGCTTGCCC GTCTCTCTNNNTCTCTTG TGATTGGTCTNNNTCTCTTGCGCAATGCG
  36. 36. Assembly Gene finding/ ORF calling tRNA calling Annotation (Assigning functions) orienting Validation Fixing frameshifts Introns and Inteins Subsystem assignment Refinement/ Secondary annotation loop Special purpose: toxins, morons, integrases, lifestyle prediction Regulatory elements (promoters, terminators) Output: files and graphics From Sequence to Knowledge From raw sequence data to genome submission/ publication
  37. 37. Classification • The phage sequence space (Lima-Mendez et al.) • The phage proteomic tree (Edwards & Rohwer) • New: VIP tree http://www.genome.jp/viptree 6 Aug 2017 Phage Genomics - Evergreen 2017
  38. 38. Countless tools 6 Aug 2017 Phage Genomics - Evergreen 2017
  39. 39. This workshop: outline 1. Annotation overview 2. Automated tools for genome annotation: – PhAnToMe/RAST related tools – Galaxy/ Apollo 3. Tools for metagenome-based analyses – Assembly – Functional prediction via protein families 6 Aug 2017 Phage Genomics - Evergreen 2017
  40. 40. Where to go from here? • Part I: General introduction of genome annotation • Part II: Two levels – Level 1: Novices and beginners: Automated annotation tools – Level 2: Intermediate to advanced users: Command-line based tools 6 Aug 2017 Phage Genomics - Evergreen 2017
  41. 41. Online resources/ Slideshare • Data & links: – http://egybio.net/tutorial • Slides – http://bit.ly/annotation2016 – http://bit.ly/phantome4 – Old tutorials (more detailed, but missing latest ): • Evergreen 2011: http://slidesha.re/phantome1 • http://slidesha.re/phiRAST1 (by Karin Holmfeldt) • Evergreen 2013: http://bit.ly/phantome2 • Evergreen 2015: http://bit.ly/phantome3 6 Aug 2017 Phage Genomics - Evergreen 2017

×