SlideShare una empresa de Scribd logo
1 de 55
DNA
(Deoxyribonucleic acid)
Mr. Sagar Kishor Savale
[Department of Pharmacy (Pharmaceutics)]
2015-016
avengersagar16@gmail.com
Department of Pharmacy (Pharmaceutics) | Sagar savale
20-12-2015 1
History Of DNA
• Discovery of the DNA double helix
Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless
bacteria into deadly bacteria in (1928)
Rosalind Franklin - X-ray photo of DNA in (1952)
Watson and Crick - described the DNA molecule from Franklin’s X-ray in (1953)
• Watson & Crick proposed
• DNA had specific pairing between the nitrogen bases:
• ADENINE – THYMINE
• CYTOSINE - GUANINE
• DNA was made of 2 long stands of nucleotides arranged in a specific way called the “Complementary Rule”
20-12-2015 2
C
T
A
A
T
CG
GC
A
C G
AT
AT
A T
TA
C
TA
0.34 nm
3.4 nm
(a) Key features of DNA structure
G
1 nm
G
(c) Space-filling model
T
20-12-2015 3
DNA
• DNA = deoxyribonucleic acid.
• DNA carries the genetic information in the cell – i.e. it carries the instructions for making all the structures and
materials the body needs to function.
• DNA is capable of self-replication.
• Most of the cell’s DNA is carried in the nucleus – a small amount is contained in the mitochondria.
•
• Importance of DNA
• Molecule
20-12-2015 4
20-12-2015 5
20-12-2015 6
• 2’-deoxyribose sugar
• Four bases:
• Adenine, A
• Guanine, G
• Thymine, T
• Cytosine, C
• Purine bases
Adenine and guanine
Two carbon rings
• Pyrimidine bases
Thymine and cytosine
A single carbon ring
Base part
Sugar part
DNA = deoxyribonucleic acid.
20-12-2015 7
20-12-2015 8
20-12-2015 9
20-12-2015 10
DNA Structure
• DNA is a nucleic acid, made of long chains of nucleotides
Nucleotide
Phosphate
group
Nitrogenous
base
Sugar
Polynucleotide Sugar-phosphate backbone
DNA nucleotide
Phosphate
group
Nitrogenous base
(A, G, C, or T)
Thymine (T)
Sugar
(deoxyribose)
20-12-2015 11
DNA has four kinds of bases, A, T, C, and G
Pyrimidines
Thymine (T) Cytosine (C)
Purines
Adenine (A) Guanine (G)
20-12-2015 12
20-12-2015 13
DNA is a Double Helix
• Nucleotides
• A, G, T, C
• Sugar and phosphate form the
backbone
• Bases lie between the backbone
• Held together by
H-bonds between the bases
• A-T – 2 H bonds
• G-C – 3 H bonds
20-12-2015 14
DNA Double Helix
P
P
P
O
O
O
1
2
3
4
5
5
3
3
5
P
P
P
O
O
O
1
2 3
4
5
5
3
5
3
G C
T A
20-12-2015 15
H - Bonds
• The bases attract each other because of hydrogen bonds.
• Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA.
• The bonds between cytosine and guanine are shown here with dotted lines.
• When making hydrogen bonds, cytosine always pairs up with guanine
• Adenine always pairs up with thymine
• Adenine is bonded to thymine here
C
C
C
C
N
N
O
N
C
C
C
C
N
N
O
N
N
N
C
C
C
C
C
N
N
O
O
C
20-12-2015 16
• Hydrogen bonds between bases hold the strands together: A
and T, C and G
Ribbon model Partial chemical structure Computer model
Hydrogen bond
20-12-2015 17
20-12-2015 18
Chargraff’s Rule
•Adenine and Thymine always join together
• A T
• Cytosine and Guanine always join together
• C G
20-12-2015 19
20-12-2015 20
• Each strand is a template for a new strand
helicase
DNA polymerase
20-12-2015 21
The ladder model
• The structure of DNA can be understood more easily by untwisting the double helix and
displaying the molecule as if it were a ladder.
• The side rails of the ladder (the “backbone”) are alternating phosphate and sugar
molecules. The rungs are paired nitrogen base molecules held together by a hydrogen bond.
Nucleotide
Base pair
Backbone
20-12-2015 22
The base pairing rule
• Each “rung” of the DNA ladder is formed from two nitrogen bases.
• There are four bases – adenine (A), thymine (T), cytosine (C), and guanine (G).
• The base adenine always bonds with thymine (A-T), and cytosine always bonds with guanine (C-G).
• The binding of two nucleotides forms a base pair. In DNA, cytosine and guanine are bound together by 3 hydrogen bonds,
whereas adenine and thymine are bound by 2 hydrogen bonds.
Location of DNA
Most of the DNA occurs in the cell nucleus;
however, each mitochondrion contains
37 genes – this is referred to as
mitochondrial DNA.
20-12-2015 23
The function of DNA Genes
• A chromosome consists of segments of DNA known as genes.
• Genes contain the instructions for the construction of a particular protein, or RNA.
• It is estimated that there are about 20,000–25,000 genes in the human genome (i.e. about 3
billion base pairs).
• Genetic information is carried in the linear sequence of nucleotides in DNA
• Genetic information contains instructions to synthesize proteins
• DNA forms double helix with two complimentary strands holding together by hydrogen bonds
between A-T (2 bonds) and G-C (3 bonds)
• DNA duplication occurs using one strand of parental DNA as template to form complimentary
pairs with a new DNA strand.
• DNA is in nucleus in eucaryotes
20-12-2015 24
Introns and exons
• Genes consist of introns and exons
• Exons are sections of coding DNA – i.e. they contain instructions for making
proteins.
• Introns are sections of non-coding DNA (once called "junk DNA") – i.e. they
do not contain instructions for making proteins but are now believed to serve
other important functions.
20-12-2015 25
The Genetic Code
• Describes how nucleotide
sequence is converted to protein
sequence
• Unit of three nucleotides = a
codon
• A codon codes for a specific
amino acid (structural
component of protein)
• The four bases can form 64
different codons
• 20 amino acids are found from
the nature
• Regulatory codons
20-12-2015 26
Reading the code
• The sequence of bases is read in groups of three called codons.
• Thus the sequence:
AAGCCGTTTAGAGAGATTCCT
Is read as:
AAG CCG TTT AGA GAG ATT CCT
• Each codon represents one of the 20 different amino acids.
20-12-2015 27
DNA
chromatin
chromatin fibers
fibers connected to
chromosome scaffold
Condenced scaffold
Chromosome
20-12-2015 28
How DNA works
20-12-2015 29
Genes as Information Transfer
• A gene is the sequence of nucleotides within a portion of DNA that codes for a
peptide or a functional RNA
• Sum of all genes = genome
20-12-2015 30
Replication of DNA
• Semiconservative
• Daughter DNA is a double helix with 1 parent strand and 1 new strand
• Found that 1 strand serves as the template for new strand
20-12-2015 31
20-12-2015 32
20-12-2015 33
DNA Template
Each strand of the parent DNA is used as a template to make the new daughter strand DNA replication makes 2
new complete double helices each with 1 old and 1 new strand
20-12-2015 34
Replication Origin
• Site where replication begins
• 1 in E. coli
• 1,000s in human
• Strands are separated to allow replication
machinery contact with the DNA
• Many A-T base pairs because easier to break 2
H-bonds that 3 H-bonds
• Note anti-parallel chains
20-12-2015 35
Replication Fork
• Bidirectional movement of the DNA replication machinery
20-12-2015 36
DNA Polymerase
• An enzyme that catalyzes the addition of a
nucleotide to the growing DNA chain
• Nucleotide enters as a nucleotide tri-PO4
• 3’–OH of sugar attacks first phosphate of tri-
PO4 bond on the 5’ C of the new nucleotide
• releasing pyrophosphate (PPi) + energy
• Bidirectional synthesis of the DNA double
helix
• Corrects mistaken base pairings
• Requires an established polymer (small RNA
primer) before addition of more nucleotides
• Other proteins and enzymes necessary
20-12-2015 37
How is DNA Synthesized
• Original theory
• Begin adding nucleotides at origin
• Add subsequent bases following pairing rules
• Expect both strands to be synthesized simultaneously
• This is NOT how it is accomplished
20-12-2015 38
20-12-2015 39
• Actually how DNA is synthesized
• Simple addition of nucleotides along one strand, as expected
• Called the leading strand
• DNA polymerase reads 3’  5’ along the leading strand from the RNA primer
• Synthesis proceeds 5’  3’ with respect to the new daughter strand
• Remember how the nucleotides are added 5’  3’
• Actually how DNA is synthesized
• Other daughter strand is also synthesized 5’3’ because that is only way that DNA can be
assembled
• However the template is also being read 5’3’
• Compensate for this by feeding the DNA strand through the polymerase, and primers and make many short
segments that are later joined (ligated) together
• Called the lagging strand
20-12-2015 40
DNA Replication Fork
20-12-2015 41
20-12-2015 42
Starting Synthesis
• DNA polymerase can only ADD nucleotides
to a growing polymer
• Another enzyme, primase, synthesizes a short
RNA chain called a primer
• DNA/RNA hybrid for this short stretch
• Base pairing rules followed (BUT A-U)
• Later removed, replaced by DNA and the
backbone is sealed (ligated)
• Primers
• Simple addition of primer along
leading strand
• RNA primer synthesized 5’  3’,
then polymerization with DNA
• Many primers are needed along the
lagging strand
• 1 primer per small fragment of new
DNA made along the lagging strand
• Called Okazaki fragments
• Removal of Primers
Other enzymes needed to excise (remove) the primers
Nuclease – removes the RNA primer nucleotide by
nucleotide
Repair polymerase – replaces RNA with DNA
DNA ligase – seals the sugar-phosphate backbone by
creating phosphodiester bond
Requires Mg2+ and ATP
20-12-2015 43
20-12-2015 44
20-12-2015 45
20-12-2015 46
Repair Mechanisms
20-12-2015 47
DNA Transcription
20-12-2015 48
DNA Translation
20-12-2015 49
A summary of transcription and translation in a eukaryotic cell
TRANSCRIPTION
RNA is transcribed
from a DNA template.
DNA
RNA
polymerase
RNA
transcript
RNA PROCESSING
In eukaryotes, the
RNA transcript (pre-
mRNA) is spliced and
modified to produce
mRNA, which moves
from the nucleus to the
cytoplasm.
Exon
RNA transcript
(pre-mRNA)
Intron
NUCLEUS
FORMATION OF
INITIATION COMPLEX
After leaving the
nucleus, mRNA attaches
to the ribosome.
CYTOPLASM
mRNA Growing
polypeptide
Ribosomal
subunits
Aminoacyl-tRNA
synthetase
Amino
acid
tRNA
AMINO ACID ACTIVATION
Each amino acid
attaches to its proper tRNA
with the help of a specific
enzyme and ATP.
Activated
amino acid
TRANSLATION
A succession of tRNAs
add their amino acids to
the polypeptide chain
as the mRNA is moved
through the ribosome
one codon at a time.
(When completed, the
polypeptide is released
from the ribosome.)
AnticodonA A A
U G G U U U A U G
E A
Ribosome
1
5
5
3
Codon
2
3 4
5
20-12-2015 50
Chromosomes
• 23 chromosome pairs  46 chromosomes
• 44 autosomes, 2 sex chromosomes
• X and Y –chromosomes
• XX  female
• XY  Male
20-12-2015 51
20-12-2015 52
Sex Determination in Humans
20-12-2015 53
References
• www.wikipedia.org
• www.sciencedirect.com
• www.medscape.com
• www.biolife.com
• www.nature.com
• www.Googlescoler.com
• www.pubmed.com
20-12-2015 54
20-12-2015 55

Más contenido relacionado

La actualidad más candente

La actualidad más candente (20)

A complete PPT on DNA
A complete PPT on DNA A complete PPT on DNA
A complete PPT on DNA
 
Watson and crick model of dna
Watson and crick model of dnaWatson and crick model of dna
Watson and crick model of dna
 
DNA Structure PowerPoint
DNA Structure PowerPointDNA Structure PowerPoint
DNA Structure PowerPoint
 
Chromosome and its structure
Chromosome and its structureChromosome and its structure
Chromosome and its structure
 
DNA Replication
DNA ReplicationDNA Replication
DNA Replication
 
DNA strcture and function
DNA strcture and functionDNA strcture and function
DNA strcture and function
 
DNA Structure and Function (Diamsay, Mendoza))
DNA Structure and Function (Diamsay, Mendoza))DNA Structure and Function (Diamsay, Mendoza))
DNA Structure and Function (Diamsay, Mendoza))
 
DNA & RNA
DNA & RNADNA & RNA
DNA & RNA
 
DNA & RNA
DNA & RNADNA & RNA
DNA & RNA
 
Dna structure
Dna structureDna structure
Dna structure
 
Biochemistry of DNA Structure
Biochemistry of DNA StructureBiochemistry of DNA Structure
Biochemistry of DNA Structure
 
DNA Replication PowerPoint
DNA Replication PowerPointDNA Replication PowerPoint
DNA Replication PowerPoint
 
DNA replication
DNA replicationDNA replication
DNA replication
 
Genetic code ppt
Genetic code pptGenetic code ppt
Genetic code ppt
 
DNA structure
DNA structureDNA structure
DNA structure
 
Protein synthesis
Protein synthesis Protein synthesis
Protein synthesis
 
DNA Replication
 DNA Replication DNA Replication
DNA Replication
 
Structure and function of rna
Structure and function of rnaStructure and function of rna
Structure and function of rna
 
Mutation
Mutation Mutation
Mutation
 
DNA RNA
DNA RNADNA RNA
DNA RNA
 

Similar a DNA DNA Structure and Function

Deoxyribonucleic Acid ppt
Deoxyribonucleic Acid pptDeoxyribonucleic Acid ppt
Deoxyribonucleic Acid pptJessa Arino
 
Biomolecular pharmacy
Biomolecular pharmacyBiomolecular pharmacy
Biomolecular pharmacykeshob ghosh
 
Lec 10 level 3-de (dna structure and replication)
Lec 10  level 3-de (dna structure and replication)Lec 10  level 3-de (dna structure and replication)
Lec 10 level 3-de (dna structure and replication)dream10f
 
Chem 45 Biochemistry: Stoker chapter 22 Nucleic Acids
Chem 45 Biochemistry: Stoker chapter 22 Nucleic AcidsChem 45 Biochemistry: Stoker chapter 22 Nucleic Acids
Chem 45 Biochemistry: Stoker chapter 22 Nucleic AcidsShaina Mavreen Villaroza
 
Lecture_Nucleic acids.ppt
Lecture_Nucleic acids.pptLecture_Nucleic acids.ppt
Lecture_Nucleic acids.pptelphaswalela
 
DNA Replication
DNA ReplicationDNA Replication
DNA ReplicationSanjai
 
Lec10 level3-dednastructureandreplication-130202043426-phpapp02
Lec10 level3-dednastructureandreplication-130202043426-phpapp02Lec10 level3-dednastructureandreplication-130202043426-phpapp02
Lec10 level3-dednastructureandreplication-130202043426-phpapp02Cleophas Rwemera
 
B sc biotech i fob unit 2 gene, dna and rna
B sc biotech i fob unit 2 gene, dna and rnaB sc biotech i fob unit 2 gene, dna and rna
B sc biotech i fob unit 2 gene, dna and rnaRai University
 
DNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptxDNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptxMEENUDOLIA1
 
Structure of DNA replication & protein synthesis
Structure of DNA replication & protein synthesisStructure of DNA replication & protein synthesis
Structure of DNA replication & protein synthesisTina John
 
replicationfinal.ppt
replicationfinal.pptreplicationfinal.ppt
replicationfinal.pptCYBEROCTAPAS
 
DNA_Notes_[Compatibility_Mode].pdf
DNA_Notes_[Compatibility_Mode].pdfDNA_Notes_[Compatibility_Mode].pdf
DNA_Notes_[Compatibility_Mode].pdfMuhammadAjmalAli
 

Similar a DNA DNA Structure and Function (20)

Deoxyribonucleic Acid ppt
Deoxyribonucleic Acid pptDeoxyribonucleic Acid ppt
Deoxyribonucleic Acid ppt
 
Dna structure & central dogma
Dna structure & central dogmaDna structure & central dogma
Dna structure & central dogma
 
Nucleic acids
Nucleic acidsNucleic acids
Nucleic acids
 
Biomolecular pharmacy
Biomolecular pharmacyBiomolecular pharmacy
Biomolecular pharmacy
 
Dna structure
Dna structureDna structure
Dna structure
 
Lec 10 level 3-de (dna structure and replication)
Lec 10  level 3-de (dna structure and replication)Lec 10  level 3-de (dna structure and replication)
Lec 10 level 3-de (dna structure and replication)
 
Chem 45 Biochemistry: Stoker chapter 22 Nucleic Acids
Chem 45 Biochemistry: Stoker chapter 22 Nucleic AcidsChem 45 Biochemistry: Stoker chapter 22 Nucleic Acids
Chem 45 Biochemistry: Stoker chapter 22 Nucleic Acids
 
Lecture_Nucleic acids.ppt
Lecture_Nucleic acids.pptLecture_Nucleic acids.ppt
Lecture_Nucleic acids.ppt
 
DNA Replication
DNA ReplicationDNA Replication
DNA Replication
 
Dna notes
Dna notesDna notes
Dna notes
 
Lec10 level3-dednastructureandreplication-130202043426-phpapp02
Lec10 level3-dednastructureandreplication-130202043426-phpapp02Lec10 level3-dednastructureandreplication-130202043426-phpapp02
Lec10 level3-dednastructureandreplication-130202043426-phpapp02
 
Notes ch12 DNA
Notes ch12 DNANotes ch12 DNA
Notes ch12 DNA
 
genetic material.ppt
genetic material.pptgenetic material.ppt
genetic material.ppt
 
B sc biotech i fob unit 2 gene, dna and rna
B sc biotech i fob unit 2 gene, dna and rnaB sc biotech i fob unit 2 gene, dna and rna
B sc biotech i fob unit 2 gene, dna and rna
 
DNA replication1.ppt
DNA replication1.pptDNA replication1.ppt
DNA replication1.ppt
 
DNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptxDNA_RNA_11_.ppt.pptx
DNA_RNA_11_.ppt.pptx
 
Structure of DNA replication & protein synthesis
Structure of DNA replication & protein synthesisStructure of DNA replication & protein synthesis
Structure of DNA replication & protein synthesis
 
replicationfinal.ppt
replicationfinal.pptreplicationfinal.ppt
replicationfinal.ppt
 
DNA_Notes_[Compatibility_Mode].pdf
DNA_Notes_[Compatibility_Mode].pdfDNA_Notes_[Compatibility_Mode].pdf
DNA_Notes_[Compatibility_Mode].pdf
 
NUCLEIC ACIDSsss.ppt
NUCLEIC ACIDSsss.pptNUCLEIC ACIDSsss.ppt
NUCLEIC ACIDSsss.ppt
 

Más de Sagar Savale

Scale up and Post Approval Chenges (SUPAC).pdf
Scale up and Post Approval Chenges (SUPAC).pdfScale up and Post Approval Chenges (SUPAC).pdf
Scale up and Post Approval Chenges (SUPAC).pdfSagar Savale
 
Sagar K Savale _ Publons.pdf
Sagar K Savale _ Publons.pdfSagar K Savale _ Publons.pdf
Sagar K Savale _ Publons.pdfSagar Savale
 
Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...
Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...
Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...Sagar Savale
 
Omicron covid variant: a short overview
Omicron covid variant: a short overviewOmicron covid variant: a short overview
Omicron covid variant: a short overviewSagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate Sagar Savale
 
E - certificate ijsrem.com sagar kishor savale
E - certificate ijsrem.com sagar kishor savaleE - certificate ijsrem.com sagar kishor savale
E - certificate ijsrem.com sagar kishor savaleSagar Savale
 
Certificate of completion time management fundamentals with microsoft office
Certificate of completion time management fundamentals with microsoft officeCertificate of completion time management fundamentals with microsoft office
Certificate of completion time management fundamentals with microsoft officeSagar Savale
 
Certificate of completion the data science of healthcare, medicine, and publi...
Certificate of completion the data science of healthcare, medicine, and publi...Certificate of completion the data science of healthcare, medicine, and publi...
Certificate of completion the data science of healthcare, medicine, and publi...Sagar Savale
 
Certificate of completion microsoft project quick tips
Certificate of completion microsoft project quick tipsCertificate of completion microsoft project quick tips
Certificate of completion microsoft project quick tipsSagar Savale
 
Certificate of completion improving your judgment for better decision-making
Certificate of completion improving your judgment for better decision-makingCertificate of completion improving your judgment for better decision-making
Certificate of completion improving your judgment for better decision-makingSagar Savale
 
Certificate of completion data visualization_ best practices
Certificate of completion data visualization_ best practicesCertificate of completion data visualization_ best practices
Certificate of completion data visualization_ best practicesSagar Savale
 

Más de Sagar Savale (20)

Scale up and Post Approval Chenges (SUPAC).pdf
Scale up and Post Approval Chenges (SUPAC).pdfScale up and Post Approval Chenges (SUPAC).pdf
Scale up and Post Approval Chenges (SUPAC).pdf
 
Sagar K Savale _ Publons.pdf
Sagar K Savale _ Publons.pdfSagar K Savale _ Publons.pdf
Sagar K Savale _ Publons.pdf
 
Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...
Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...
Sagar Savale (0000-0001-5467-2038) - ORCID _ Connecting Research and Research...
 
Omicron covid variant: a short overview
Omicron covid variant: a short overviewOmicron covid variant: a short overview
Omicron covid variant: a short overview
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
LinkedIn Certificate
LinkedIn Certificate LinkedIn Certificate
LinkedIn Certificate
 
E - certificate ijsrem.com sagar kishor savale
E - certificate ijsrem.com sagar kishor savaleE - certificate ijsrem.com sagar kishor savale
E - certificate ijsrem.com sagar kishor savale
 
Certificate of completion time management fundamentals with microsoft office
Certificate of completion time management fundamentals with microsoft officeCertificate of completion time management fundamentals with microsoft office
Certificate of completion time management fundamentals with microsoft office
 
Certificate of completion the data science of healthcare, medicine, and publi...
Certificate of completion the data science of healthcare, medicine, and publi...Certificate of completion the data science of healthcare, medicine, and publi...
Certificate of completion the data science of healthcare, medicine, and publi...
 
Certificate of completion microsoft project quick tips
Certificate of completion microsoft project quick tipsCertificate of completion microsoft project quick tips
Certificate of completion microsoft project quick tips
 
Certificate of completion improving your judgment for better decision-making
Certificate of completion improving your judgment for better decision-makingCertificate of completion improving your judgment for better decision-making
Certificate of completion improving your judgment for better decision-making
 
Certificate of completion data visualization_ best practices
Certificate of completion data visualization_ best practicesCertificate of completion data visualization_ best practices
Certificate of completion data visualization_ best practices
 

Último

Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...narwatsonia7
 
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls ServiceKesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Servicemakika9823
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...astropune
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableNehru place Escorts
 
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsBangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsGfnyt
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Dipal Arora
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomdiscovermytutordmt
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...narwatsonia7
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...Taniya Sharma
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...narwatsonia7
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...chandars293
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...astropune
 

Último (20)

Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
 
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls ServiceKesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
 
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCREscort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
 
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsBangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Kochi Just Call 9907093804 Top Class Call Girl Service Available
 
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 6297143586 𖠋 Will You Mis...
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
 

DNA DNA Structure and Function

  • 1. DNA (Deoxyribonucleic acid) Mr. Sagar Kishor Savale [Department of Pharmacy (Pharmaceutics)] 2015-016 avengersagar16@gmail.com Department of Pharmacy (Pharmaceutics) | Sagar savale 20-12-2015 1
  • 2. History Of DNA • Discovery of the DNA double helix Frederick Griffith – Discovers that a factor in diseased bacteria can transform harmless bacteria into deadly bacteria in (1928) Rosalind Franklin - X-ray photo of DNA in (1952) Watson and Crick - described the DNA molecule from Franklin’s X-ray in (1953) • Watson & Crick proposed • DNA had specific pairing between the nitrogen bases: • ADENINE – THYMINE • CYTOSINE - GUANINE • DNA was made of 2 long stands of nucleotides arranged in a specific way called the “Complementary Rule” 20-12-2015 2
  • 3. C T A A T CG GC A C G AT AT A T TA C TA 0.34 nm 3.4 nm (a) Key features of DNA structure G 1 nm G (c) Space-filling model T 20-12-2015 3
  • 4. DNA • DNA = deoxyribonucleic acid. • DNA carries the genetic information in the cell – i.e. it carries the instructions for making all the structures and materials the body needs to function. • DNA is capable of self-replication. • Most of the cell’s DNA is carried in the nucleus – a small amount is contained in the mitochondria. • • Importance of DNA • Molecule 20-12-2015 4
  • 7. • 2’-deoxyribose sugar • Four bases: • Adenine, A • Guanine, G • Thymine, T • Cytosine, C • Purine bases Adenine and guanine Two carbon rings • Pyrimidine bases Thymine and cytosine A single carbon ring Base part Sugar part DNA = deoxyribonucleic acid. 20-12-2015 7
  • 11. DNA Structure • DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous base Sugar Polynucleotide Sugar-phosphate backbone DNA nucleotide Phosphate group Nitrogenous base (A, G, C, or T) Thymine (T) Sugar (deoxyribose) 20-12-2015 11
  • 12. DNA has four kinds of bases, A, T, C, and G Pyrimidines Thymine (T) Cytosine (C) Purines Adenine (A) Guanine (G) 20-12-2015 12
  • 14. DNA is a Double Helix • Nucleotides • A, G, T, C • Sugar and phosphate form the backbone • Bases lie between the backbone • Held together by H-bonds between the bases • A-T – 2 H bonds • G-C – 3 H bonds 20-12-2015 14
  • 16. H - Bonds • The bases attract each other because of hydrogen bonds. • Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA. • The bonds between cytosine and guanine are shown here with dotted lines. • When making hydrogen bonds, cytosine always pairs up with guanine • Adenine always pairs up with thymine • Adenine is bonded to thymine here C C C C N N O N C C C C N N O N N N C C C C C N N O O C 20-12-2015 16
  • 17. • Hydrogen bonds between bases hold the strands together: A and T, C and G Ribbon model Partial chemical structure Computer model Hydrogen bond 20-12-2015 17
  • 19. Chargraff’s Rule •Adenine and Thymine always join together • A T • Cytosine and Guanine always join together • C G 20-12-2015 19
  • 21. • Each strand is a template for a new strand helicase DNA polymerase 20-12-2015 21
  • 22. The ladder model • The structure of DNA can be understood more easily by untwisting the double helix and displaying the molecule as if it were a ladder. • The side rails of the ladder (the “backbone”) are alternating phosphate and sugar molecules. The rungs are paired nitrogen base molecules held together by a hydrogen bond. Nucleotide Base pair Backbone 20-12-2015 22
  • 23. The base pairing rule • Each “rung” of the DNA ladder is formed from two nitrogen bases. • There are four bases – adenine (A), thymine (T), cytosine (C), and guanine (G). • The base adenine always bonds with thymine (A-T), and cytosine always bonds with guanine (C-G). • The binding of two nucleotides forms a base pair. In DNA, cytosine and guanine are bound together by 3 hydrogen bonds, whereas adenine and thymine are bound by 2 hydrogen bonds. Location of DNA Most of the DNA occurs in the cell nucleus; however, each mitochondrion contains 37 genes – this is referred to as mitochondrial DNA. 20-12-2015 23
  • 24. The function of DNA Genes • A chromosome consists of segments of DNA known as genes. • Genes contain the instructions for the construction of a particular protein, or RNA. • It is estimated that there are about 20,000–25,000 genes in the human genome (i.e. about 3 billion base pairs). • Genetic information is carried in the linear sequence of nucleotides in DNA • Genetic information contains instructions to synthesize proteins • DNA forms double helix with two complimentary strands holding together by hydrogen bonds between A-T (2 bonds) and G-C (3 bonds) • DNA duplication occurs using one strand of parental DNA as template to form complimentary pairs with a new DNA strand. • DNA is in nucleus in eucaryotes 20-12-2015 24
  • 25. Introns and exons • Genes consist of introns and exons • Exons are sections of coding DNA – i.e. they contain instructions for making proteins. • Introns are sections of non-coding DNA (once called "junk DNA") – i.e. they do not contain instructions for making proteins but are now believed to serve other important functions. 20-12-2015 25
  • 26. The Genetic Code • Describes how nucleotide sequence is converted to protein sequence • Unit of three nucleotides = a codon • A codon codes for a specific amino acid (structural component of protein) • The four bases can form 64 different codons • 20 amino acids are found from the nature • Regulatory codons 20-12-2015 26
  • 27. Reading the code • The sequence of bases is read in groups of three called codons. • Thus the sequence: AAGCCGTTTAGAGAGATTCCT Is read as: AAG CCG TTT AGA GAG ATT CCT • Each codon represents one of the 20 different amino acids. 20-12-2015 27
  • 28. DNA chromatin chromatin fibers fibers connected to chromosome scaffold Condenced scaffold Chromosome 20-12-2015 28
  • 30. Genes as Information Transfer • A gene is the sequence of nucleotides within a portion of DNA that codes for a peptide or a functional RNA • Sum of all genes = genome 20-12-2015 30
  • 31. Replication of DNA • Semiconservative • Daughter DNA is a double helix with 1 parent strand and 1 new strand • Found that 1 strand serves as the template for new strand 20-12-2015 31
  • 34. DNA Template Each strand of the parent DNA is used as a template to make the new daughter strand DNA replication makes 2 new complete double helices each with 1 old and 1 new strand 20-12-2015 34
  • 35. Replication Origin • Site where replication begins • 1 in E. coli • 1,000s in human • Strands are separated to allow replication machinery contact with the DNA • Many A-T base pairs because easier to break 2 H-bonds that 3 H-bonds • Note anti-parallel chains 20-12-2015 35
  • 36. Replication Fork • Bidirectional movement of the DNA replication machinery 20-12-2015 36
  • 37. DNA Polymerase • An enzyme that catalyzes the addition of a nucleotide to the growing DNA chain • Nucleotide enters as a nucleotide tri-PO4 • 3’–OH of sugar attacks first phosphate of tri- PO4 bond on the 5’ C of the new nucleotide • releasing pyrophosphate (PPi) + energy • Bidirectional synthesis of the DNA double helix • Corrects mistaken base pairings • Requires an established polymer (small RNA primer) before addition of more nucleotides • Other proteins and enzymes necessary 20-12-2015 37
  • 38. How is DNA Synthesized • Original theory • Begin adding nucleotides at origin • Add subsequent bases following pairing rules • Expect both strands to be synthesized simultaneously • This is NOT how it is accomplished 20-12-2015 38
  • 40. • Actually how DNA is synthesized • Simple addition of nucleotides along one strand, as expected • Called the leading strand • DNA polymerase reads 3’  5’ along the leading strand from the RNA primer • Synthesis proceeds 5’  3’ with respect to the new daughter strand • Remember how the nucleotides are added 5’  3’ • Actually how DNA is synthesized • Other daughter strand is also synthesized 5’3’ because that is only way that DNA can be assembled • However the template is also being read 5’3’ • Compensate for this by feeding the DNA strand through the polymerase, and primers and make many short segments that are later joined (ligated) together • Called the lagging strand 20-12-2015 40
  • 43. Starting Synthesis • DNA polymerase can only ADD nucleotides to a growing polymer • Another enzyme, primase, synthesizes a short RNA chain called a primer • DNA/RNA hybrid for this short stretch • Base pairing rules followed (BUT A-U) • Later removed, replaced by DNA and the backbone is sealed (ligated) • Primers • Simple addition of primer along leading strand • RNA primer synthesized 5’  3’, then polymerization with DNA • Many primers are needed along the lagging strand • 1 primer per small fragment of new DNA made along the lagging strand • Called Okazaki fragments • Removal of Primers Other enzymes needed to excise (remove) the primers Nuclease – removes the RNA primer nucleotide by nucleotide Repair polymerase – replaces RNA with DNA DNA ligase – seals the sugar-phosphate backbone by creating phosphodiester bond Requires Mg2+ and ATP 20-12-2015 43
  • 50. A summary of transcription and translation in a eukaryotic cell TRANSCRIPTION RNA is transcribed from a DNA template. DNA RNA polymerase RNA transcript RNA PROCESSING In eukaryotes, the RNA transcript (pre- mRNA) is spliced and modified to produce mRNA, which moves from the nucleus to the cytoplasm. Exon RNA transcript (pre-mRNA) Intron NUCLEUS FORMATION OF INITIATION COMPLEX After leaving the nucleus, mRNA attaches to the ribosome. CYTOPLASM mRNA Growing polypeptide Ribosomal subunits Aminoacyl-tRNA synthetase Amino acid tRNA AMINO ACID ACTIVATION Each amino acid attaches to its proper tRNA with the help of a specific enzyme and ATP. Activated amino acid TRANSLATION A succession of tRNAs add their amino acids to the polypeptide chain as the mRNA is moved through the ribosome one codon at a time. (When completed, the polypeptide is released from the ribosome.) AnticodonA A A U G G U U U A U G E A Ribosome 1 5 5 3 Codon 2 3 4 5 20-12-2015 50
  • 51. Chromosomes • 23 chromosome pairs  46 chromosomes • 44 autosomes, 2 sex chromosomes • X and Y –chromosomes • XX  female • XY  Male 20-12-2015 51
  • 53. Sex Determination in Humans 20-12-2015 53
  • 54. References • www.wikipedia.org • www.sciencedirect.com • www.medscape.com • www.biolife.com • www.nature.com • www.Googlescoler.com • www.pubmed.com 20-12-2015 54