Polymerase Chain Reaction

1. Polymerase chain reaction
Prepared by: Sara Abudahab
University of Jordan
Department of Clinical Pharmacy

2. Outline
• History
• Principles of PCR:
• Purpose
• Components
• Steps
• Advantages and disadvantages of PCR
• Gel Electrophoresis
• Applications of PCR

3. History
• PCR is a coping machine for
DNA molecules
• Invented by Kary Mullis and his
colleagues in the 1983
• Nobel prize 1993

4. Principles of PCR
• Purpose
• Components
• Steps

5. Purpose of PCR
• Purpose of PCR Technique in vitro (test tube) is
amplification of specific DNA sequences
• PCR allows a "target" DNA sequence to be
selectively amplified, several million-fold in just a
few hours.

6. Exponential Amplification:
the DNA sequence between primers doubles after each cycle

7. PCR Components

8. DNATemplate
Amount
Human genomic DNA should be up to 500ng
Bacterial DNA1-10ng
Plasmid DNA 0.1-1ng

9. Primers
• Typical primers are 18-28 bases in length
• Having 50-60% GC composition
• Have a balanced distribution of G/C andA/T rich
domains
• Are not complementary to each other at the 3' ends to
avoid primer- dimer forming artifacts.
• Not self complementary “Hairpin” formation

10. DNA Polymerase
• The most widely characterized
polymerase is that from
Thermus aquaticus (Taq)
• Thermophilic bacterium lives in
hot springs
• Consist of a single polypeptide
chain has an optimum
polymerization temperature of
70 – 80 C (72 C).

11. Four Normal Deoxynucleosides Triphosphate
• Always use balanced
solution of all four dNTPs
to minimize polymerase
error rate.

12. Buffer
The standard PCR buffer contains:
• MgCl2
• Tris-HCl
• KCl
• Gelatin or Bovine Serum Albumin

13. PCR Master Mix
• PCR Master Mix is a premixed, ready-to-use
solution containing:
• Taq DNA Polymerase
• dNTPs
• MgCl2
• Reaction buffers
At optimal concentrations for efficient amplification
of DNA templates by PCR.

14. Video

15. PCR steps
Each cycle includes three successive steps:

17. Number of Cycles
• The number of cycles required for optimum
amplification varies depending on the amount of the
starting material.
• Most PCR should, therefore, include only 25 – 35
cycles. As cycle increases, nonspecific products can
accumulate.
• After 20- 40 cycles of heating and cooling build up over
a million copies of original DNAmolecules.

18. Advantages and disadvantages
Advantages of PCR
Useful non- invasive procedure.
Simplicity of the procedure.
Sensitivity of the PCR
Disadvantages of PCR
False positive results (cross contamination).
False negative results

19. Gel Electrophoresis

20. Agarose Gel Electrophoresis
• It is a method used in biochemistry and molecular
biology to separate DNA, or RNA molecules based
upon charge, size and shape.
• To determine the presence or amount of DNA
• To determine the sizes of DNA fragments

21. Preparation of Gel

22. Ready for loading

23. Loading PCR samples

25. Running the electrophoresis
DNA has an overall negative charge. Because of Phosphate group.

26. Separation

27. Factors that affect the mobility of molecules
in the gel
• Charge
• Size
• Shape
• Buffer conditions
• Gel concentration and
• Voltage

28. Reading results
• Under the UV light
• Many dyes are used:
Ethidium Bromide Dye
Green stain Dye
Red Safe Dye

29. DNA ladder
• DNA Ladder consists of known
DNA sizes used to determine the
size of an unknown DNA
sample.

30. PCR Application

31. Paternity Testing
 Genetic material is inherited from both parents, half
from mother and half from father.
 Matching genetic fingerprinting of suspected parents
with that of children.
 DNA sample from buccal saliva or blood is collected
and extracted from the alleged child. Then the
extracted DNA is subjected to PCR, thousands of
copies of amplified DNA is obtained.

33. Diagnosis of Infectious Disease
 DNA from the infected parts of a person may be
subjected to PCR with primer specific gene of the
pathogen and diagnosis can be done on amplification
of DNA.
 These PCR-based tests have advantage over
conventional antibody-based diagnostic methods
that determine the body's immune response to a
pathogen.
 As patients can take weeks to develop antibodies
against an contagious agent but this is fast and
efficient.

34. Detecting HIV
 HIV DNA collected from white blood cells of patient.

35. Detecting HIV
• RT-PCR based tests have been developed to
enumerate the amount of virus in a person's blood
‘viral load' there by allowing physicians to check
their patients' disease progression

37. Mutation detection in Inherited disease
 Any point mutation, a deletion or an insertion and
expanded tandem repeat can be detected by PCR.
 It is a highly sensitive tool in the diagnosis of various
diseases in human.

38. Figure : Gap-PCR for α-thalassemia deletions.
(αα/αα) (--MED/--MED) (αα/--MED)

39. Gene Expression Analysis
 Testing gene expression can be done by PCR
 Important enzyme used in this method is reverse
transcriptase.
 Gene expression can be test by using the RNA.
 The more abundant transcripts from highly transcribed
genes (now in the form of cDNA) will yield more
product than more weakly transcribed genes.

40. DNA Fingerprinting
 PCR's main advantage in forensics is that forensic
scientists can use it to amplify or make copies of
regions of the genome that vary widely between
different individuals, called VNTRs (variable number
tandem repeats).
 By comparing the length of different VNTRs they can
determine whether the sample may be a match
with the suspect's DNA.

42. DNA cloning
 PCR can be utilized for DNA cloning - It can
concentrate fragments for insertion into a vector from
a bigger genome, which may be accessible in little
amounts
 PCR cloning is a rapid method for cloning genes, and
is often used for projects that require higher
throughput than traditional cloning methods can
accommodate. It allows for the cloning of DNA
fragments that are not available in large amounts.

44. DNA sequencing
 The DNA to be sequenced is used in the single
stranded form and DNA polymerase synthesizes new
complementary DNA strand.
 Nucleic acids are labeled
 Detection of cDNA and along the original DNA
sequence

46. Our Research
Novel SNPs of UGT1A1 and UGT1A7 genes in
Circassians and Chechens subpopulations
compared to the Jordanian population.

47. What is UGT?

48. UGT1A7 location
Location (UCSC) Chr 2: 233.68 – 233.77 Mb

49. Irinotecan
• Is used alone or in combination with other
medications to treat colon or rectal cancer

50. UGT1A7*3 Mutation
ATGGCTCGTGCAGGGTGGACTGGCCTCCTTCCACTATATGTGTGTCTACTGC
TGACCTGTGGCTTTGCCAAGGCAGGGAAGCTGCTGGTAGTGCCCATGGATG
GGAGCCACTGGTTCACCATGCAGTCGGTGGTGGAGAAACTCATCCTCAGG
GGGCATGAGGTGGTCGTAGTCATGCCAGAGGTGAGTTGGCAACTGGGAAG
ATCACTGAATTGCACAGTGAAGACTTACTCAACCTCATACACTCTGGAGGA
TCAGGACCGGGAGTTCATGGTTTTTGCCGATGCTCGCTGGACGGCACCATT
GCGAAGTGCATTTTCTCTATTAACAAGTTCATCCAATGGTATTTTTGACTTAT
TTTTTTCAAATTGCAGGAGTTTGTTTAA(T)GACAAAAAATTAGTAGAATAC
TTAAAGGAGAGTTGTTTTGATGCAGTGTTTCTCGATCCTTTTGATGCCTGTG
GCTTAATTGTTGCCAAATATTTCTCCCTCCCCTCTGTGGTCTTCGCCAGGGG
AATATTTTGCCACTATCTTGAAGAAGGTGCACAGTGCCCTGCTCCTCTTTCC
TATGTCCCCAGACTTCTCTTAGGGTTCTCAGACGCCATGACTTTCAAGGAG
AGAGTACGGAACCACATCATGCACTTGGAGGAACATTTATTTTGCCCCTATT
TTTTCAAAAATGTCTTAGAAATAGCCTCTGAAATTCTCCAAACCCCTGTCAC
GGCATATGATCTCTACAGCCACACATCAATTTGGTTGTTGCGAACTGACTTT
GTTTTGGAGTATCCCAAACCCGTGATGCCCAATATGATCTTCATTGGTGGTAT
CAACTGTCATCAGGGAAAGCCAGTGCCTATG

51. 16 samples of Chechen

52. Sequencing results