SlideShare una empresa de Scribd logo
1 de 72
Next Generation Genomics: Petascale data in the life sciences ,[object Object]
Wellcome Trust Sanger Institute
[email_address]
Outline ,[object Object]
Managing Data
Sharing Data
Adventures in the Cloud
The Sanger Institute ,[object Object]
~700 employees.
Based in Hinxton Genome Campus, Cambridge, UK. ,[object Object],[object Object]
We have active cancer, malaria, pathogen and genomic variation / human health studies. ,[object Object],[object Object]
DNA sequencing
Next-generation Sequencing Life sciences is drowning in data from our new sequencing machines. Traditional sequencing: ,[object Object],Next-generation: sequencing. ,[object Object],Machines are cheap(ish) and small. ,[object Object]
Big labs can afford lots of them.
Economic Trends: ,[object Object]
23 labs.
$500 Million. ,[object Object],[object Object]
1 machine.
$10,000.
Large centres are now doing studies with 1000s and 10,000s of genomes. ,[object Object],[object Object]
$500 genome is probable  within 5 years.
Output Trends ,[object Object]
The scary graph Instrument upgrades Peak Yearly capillary sequencing
Managing Growth ,[object Object]
Intermediate analysis typically need 10x disk space of the raw data. ,[object Object],[object Object]
Sequencing cost: T d =12 months
Sequencing Informatics
DNA Sequencing  TCTTTATTTTAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTG AAGGTATGTTCATGTACATTGTTTAGTTGAAGAGAGAAATTCATATTATTAATTA TGGTGGCTAATGCCTGTAATCCCAACTATTTGGGAGGCCAAGATGAGAGGATTGC ATAAAAAAGTTAGCTGGGAATGGTAGTGCATGCTTGTATTCCCAGCTACTCAGGAGGCTG TGCACTCCAGCTTGGGTGACACAG  CAACCCTCTCTCTCTAAAAAAAAAAAAAAAAAGG AAATAATCAGTTTCCTAAGATTTTTTTCCTGAAAAATACACATTTGGTTTCA ATGAAGTAAATCG  ATTTGCTTTCAAAACCTTTATATTTGAATACAAATGTACTCC 250 Million * 75-108 Base fragments Human Genome (3GBases)
Alignment ,[object Object]
Use more sophisticated algorithms that can do fuzzy matching. ,[object Object]
Typical algorithms are maq, bwa, ssaha, blast. ,[object Object],[object Object]
Larger insertions/deletions/mutations. ,[object Object],[object Object],Reference:  ...TTTGCTGAAACCCAAGTGACGCCATCCAGCGTGACCACTGCATTTTTCTCGGTCATCACCAGCATTCTC.... Query:   CAAGTGACGCCATCCAGCGTGACCACTGCATTTTTCT A GGTCATCACCAGCA
Assembly ,[object Object]
Harder than it looks. ,[object Object],[object Object],[object Object]
Starting scaffold which can then be refined. ,[object Object]
Cancer Genomes ,[object Object]
Mutation Details ,[object Object]
58 rearrangements
334 copy number segments
Analysing Cancer Genomes ,[object Object]
Initial mutation disrupts the normal DNA repair/replication processes.
Corruption spreads through the rest of the genome. ,[object Object],[object Object],[object Object],[object Object]
Clinicians will use this information to tailor therapies.
International Cancer Genome Project ,[object Object]
Past Collaborations Data Sequencing Centre + DCC Sequencing centre Sequencing centre Sequencing centre Sequencing centre
Future Collaborations Collaborations are short term: 18 months-3 years. Sequencing centre Sequencing centre Sequencing centre Sequencing centre Federated access
Genomics Data Unstructured data (flat files) Data size per Genome Structured data (databases) Clinical Researchers, non-infomaticians Sequencing informatics  specialists Intensities / raw data (2TB) Alignments (200 GB) Sequence + quality data (500 GB) Variation data (1GB) Individual  features  (3MB)
Where can grid technologies help us? ,[object Object]
Sharing data.
Making our software resources available.
Managing Data
Bulk Data Structured data (databases) Unstructured data (flat files) Data size per Genome Sequencing informatics  specialists Intensities / raw data (2TB) Alignments (200 GB) Sequence + quality data (500 GB) Variation data (1GB) Individual  features  (3MB)
Bulk Data Management ,[object Object]
Sequencing machines fed into an automated analysis pipeline.
All the data was tracked, analysed and archived appropriately. ,[object Object],[object Object]
Identifiable data -> private/controlled  archives.
Some data held back until journal publication.
Compute farm analysis/QC pipeline Alignment/assembly suckers Data pull ... Final Repository (Oracle) 100TB / yr staging area 500 TB  Seq 1 Seq 38
It turn out we were looking in the wrong place ,[object Object]
Investigators take the mass of finished sequence data out of the archives, onto our compute farms and “do stuff”. ,[object Object],[object Object]
... Data pull ... ? Compute farm analysis/QC pipeline assembly/alignment suckers Final Repository (Oracle) 100TB / yr staging area 500TB Seq 1 Seq 38 Compute Farm Compute farm disk Collaberators / 3 rd  party sequencing Unmanged LIMS managed data
Accidents waiting to happen... From:  <User A>  (who left 12 months ago) I find the  <project>   directory is removed . The original directory is &quot;/scratch/ <User B> (who left 6 months ago) &quot; ..where is it ? If this problem cannot be solved ,I am afriaid that  <project>  cannot be released.
An idea whose time had come ,[object Object]
Problem exacerbated with student turnover (summer students, PhD students on rotation). ,[object Object],[object Object],[object Object],[object Object]
We want an institute wide, standardised system. ,[object Object]
iRODS ,[object Object]
Produced by DICE (Data Intensive Cyber Environments) groups at U. North Carolina, Chapel Hill.
Successor to SRB.
iRODS ICAT Catalogue database Rule Engine Implements policies Irods Server Data on disk User interface WebDAV, icommands,fuse Irods Server Data in database
Basic Features ,[object Object]
Add query-able metadata to files. ,[object Object],[object Object],[object Object],[object Object]
Fast parallel data transfers across local and wide area network links.

Más contenido relacionado

La actualidad más candente

Challenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data GenomicsChallenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data GenomicsYasin Memari
 
Spark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van HamSpark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van HamSpark Summit
 
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...Amazon Web Services
 
VariantSpark a library for genomics by Lynn Langit
VariantSpark a library for genomics by Lynn LangitVariantSpark a library for genomics by Lynn Langit
VariantSpark a library for genomics by Lynn LangitData Con LA
 
Cluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesCluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesGuy Coates
 
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim Poterba
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim PoterbaScaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim Poterba
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim PoterbaDatabricks
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Spark Summit
 
2015 aem-grs-keynote
2015 aem-grs-keynote2015 aem-grs-keynote
2015 aem-grs-keynotec.titus.brown
 
Scalable Genome Analysis With ADAM
Scalable Genome Analysis With ADAMScalable Genome Analysis With ADAM
Scalable Genome Analysis With ADAMfnothaft
 
Spark meetup london share and analyse genomic data at scale with spark, adam...
Spark meetup london  share and analyse genomic data at scale with spark, adam...Spark meetup london  share and analyse genomic data at scale with spark, adam...
Spark meetup london share and analyse genomic data at scale with spark, adam...Andy Petrella
 
Hail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton Seed
Hail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton SeedHail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton Seed
Hail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton SeedSpark Summit
 
BioBankCloud: Machine Learning on Genomics + GA4GH @ Med at Scale
BioBankCloud: Machine Learning on Genomics + GA4GH  @ Med at ScaleBioBankCloud: Machine Learning on Genomics + GA4GH  @ Med at Scale
BioBankCloud: Machine Learning on Genomics + GA4GH @ Med at ScaleAndy Petrella
 
Data analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsData analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsmikaelhuss
 
VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...Denis C. Bauer
 
The Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific DiscoveryThe Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific DiscoveryIntel IT Center
 

La actualidad más candente (20)

Challenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data GenomicsChallenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data Genomics
 
Spark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van HamSpark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van Ham
 
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
 
VariantSpark a library for genomics by Lynn Langit
VariantSpark a library for genomics by Lynn LangitVariantSpark a library for genomics by Lynn Langit
VariantSpark a library for genomics by Lynn Langit
 
Cluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesCluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomes
 
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim Poterba
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim PoterbaScaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim Poterba
Scaling Genetic Data Analysis with Apache Spark with Jon Bloom and Tim Poterba
 
Genome Big Data
Genome Big DataGenome Big Data
Genome Big Data
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
 
2015 illinois-talk
2015 illinois-talk2015 illinois-talk
2015 illinois-talk
 
2016 bergen-sars
2016 bergen-sars2016 bergen-sars
2016 bergen-sars
 
2015 aem-grs-keynote
2015 aem-grs-keynote2015 aem-grs-keynote
2015 aem-grs-keynote
 
Scalable Genome Analysis With ADAM
Scalable Genome Analysis With ADAMScalable Genome Analysis With ADAM
Scalable Genome Analysis With ADAM
 
Spark meetup london share and analyse genomic data at scale with spark, adam...
Spark meetup london  share and analyse genomic data at scale with spark, adam...Spark meetup london  share and analyse genomic data at scale with spark, adam...
Spark meetup london share and analyse genomic data at scale with spark, adam...
 
Hail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton Seed
Hail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton SeedHail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton Seed
Hail: SCALING GENETIC DATA ANALYSIS WITH APACHE SPARK: Keynote by Cotton Seed
 
BioBankCloud: Machine Learning on Genomics + GA4GH @ Med at Scale
BioBankCloud: Machine Learning on Genomics + GA4GH  @ Med at ScaleBioBankCloud: Machine Learning on Genomics + GA4GH  @ Med at Scale
BioBankCloud: Machine Learning on Genomics + GA4GH @ Med at Scale
 
Data analysis & integration challenges in genomics
Data analysis & integration challenges in genomicsData analysis & integration challenges in genomics
Data analysis & integration challenges in genomics
 
VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...
 
The Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific DiscoveryThe Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
 
2014 bangkok-talk
2014 bangkok-talk2014 bangkok-talk
2014 bangkok-talk
 
2014 sage-talk
2014 sage-talk2014 sage-talk
2014 sage-talk
 

Destacado

2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen China
2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen China2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen China
2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen ChinaAllen Day, PhD
 
Declaring a TB outbreak over with genomics
Declaring a TB outbreak over with genomicsDeclaring a TB outbreak over with genomics
Declaring a TB outbreak over with genomicsJennifer Gardy
 
" Use of genomics for understanding and improving adaptation to climate chang...
" Use of genomics for understanding and improving adaptation to climate chang..." Use of genomics for understanding and improving adaptation to climate chang...
" Use of genomics for understanding and improving adaptation to climate chang...ExternalEvents
 
Groundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic toolsGroundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic toolsICRISAT
 
Genetic enhancement of groundnut for resistance to aflatoxin contamination
Genetic enhancement of groundnut for resistance to aflatoxin contaminationGenetic enhancement of groundnut for resistance to aflatoxin contamination
Genetic enhancement of groundnut for resistance to aflatoxin contaminationILRI
 
20170315 Cloud Accelerated Genomics - Tel Aviv / Phoenix
20170315 Cloud Accelerated Genomics - Tel Aviv / Phoenix20170315 Cloud Accelerated Genomics - Tel Aviv / Phoenix
20170315 Cloud Accelerated Genomics - Tel Aviv / PhoenixAllen Day, PhD
 
Big Data in Healthcare Made Simple: Where It Stands Today and Where It’s Going
Big Data in Healthcare Made Simple: Where It Stands Today and Where It’s GoingBig Data in Healthcare Made Simple: Where It Stands Today and Where It’s Going
Big Data in Healthcare Made Simple: Where It Stands Today and Where It’s GoingHealth Catalyst
 

Destacado (7)

2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen China
2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen China2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen China
2014.06.16 - BGI - Genomics BigData Workloads - Shenzhen China
 
Declaring a TB outbreak over with genomics
Declaring a TB outbreak over with genomicsDeclaring a TB outbreak over with genomics
Declaring a TB outbreak over with genomics
 
" Use of genomics for understanding and improving adaptation to climate chang...
" Use of genomics for understanding and improving adaptation to climate chang..." Use of genomics for understanding and improving adaptation to climate chang...
" Use of genomics for understanding and improving adaptation to climate chang...
 
Groundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic toolsGroundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic tools
 
Genetic enhancement of groundnut for resistance to aflatoxin contamination
Genetic enhancement of groundnut for resistance to aflatoxin contaminationGenetic enhancement of groundnut for resistance to aflatoxin contamination
Genetic enhancement of groundnut for resistance to aflatoxin contamination
 
20170315 Cloud Accelerated Genomics - Tel Aviv / Phoenix
20170315 Cloud Accelerated Genomics - Tel Aviv / Phoenix20170315 Cloud Accelerated Genomics - Tel Aviv / Phoenix
20170315 Cloud Accelerated Genomics - Tel Aviv / Phoenix
 
Big Data in Healthcare Made Simple: Where It Stands Today and Where It’s Going
Big Data in Healthcare Made Simple: Where It Stands Today and Where It’s GoingBig Data in Healthcare Made Simple: Where It Stands Today and Where It’s Going
Big Data in Healthcare Made Simple: Where It Stands Today and Where It’s Going
 

Similar a Next generation genomics: Petascale data in the life sciences

Computation and Knowledge
Computation and KnowledgeComputation and Knowledge
Computation and KnowledgeIan Foster
 
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchDavid Ruau
 
Bioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptxBioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptxxRowlet
 
Sequencing Genomics: The New Big Data Driver
Sequencing Genomics:The New Big Data DriverSequencing Genomics:The New Big Data Driver
Sequencing Genomics: The New Big Data DriverLarry Smarr
 
Better science through superior software
Better science through superior softwareBetter science through superior software
Better science through superior softwareMichael R. Crusoe
 
2012 hpcuserforum talk
2012 hpcuserforum talk2012 hpcuserforum talk
2012 hpcuserforum talkc.titus.brown
 
Mining Big Data using Genetic Algorithm
Mining Big Data using Genetic AlgorithmMining Big Data using Genetic Algorithm
Mining Big Data using Genetic AlgorithmIRJET Journal
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astrowebuploader
 
Next Generation Sequencing in Big Data
Next Generation Sequencing in Big DataNext Generation Sequencing in Big Data
Next Generation Sequencing in Big Dataijtsrd
 
(Em)Powering Science: High-Performance Infrastructure in Biomedical Science
(Em)Powering Science: High-Performance Infrastructure in Biomedical Science(Em)Powering Science: High-Performance Infrastructure in Biomedical Science
(Em)Powering Science: High-Performance Infrastructure in Biomedical ScienceAri Berman
 
High-Performance Networking Use Cases in Life Sciences
High-Performance Networking Use Cases in Life SciencesHigh-Performance Networking Use Cases in Life Sciences
High-Performance Networking Use Cases in Life SciencesAri Berman
 
eScience: A Transformed Scientific Method
eScience: A Transformed Scientific MethodeScience: A Transformed Scientific Method
eScience: A Transformed Scientific MethodDuncan Hull
 
2014 11-13-sbsm032-reproducible research
2014 11-13-sbsm032-reproducible research2014 11-13-sbsm032-reproducible research
2014 11-13-sbsm032-reproducible researchYannick Wurm
 
Managing & Processing Big Data for Cancer Genomics, an insight of Bioinformatics
Managing & Processing Big Data for Cancer Genomics, an insight of BioinformaticsManaging & Processing Big Data for Cancer Genomics, an insight of Bioinformatics
Managing & Processing Big Data for Cancer Genomics, an insight of BioinformaticsRaul Chong
 
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...Bonnie Hurwitz
 
Jax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuJax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuAnne Deslattes Mays
 

Similar a Next generation genomics: Petascale data in the life sciences (20)

Computation and Knowledge
Computation and KnowledgeComputation and Knowledge
Computation and Knowledge
 
Cool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical ResearchCool Informatics Tools and Services for Biomedical Research
Cool Informatics Tools and Services for Biomedical Research
 
2014 aus-agta
2014 aus-agta2014 aus-agta
2014 aus-agta
 
2016 davis-plantbio
2016 davis-plantbio2016 davis-plantbio
2016 davis-plantbio
 
Bioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptxBioinformatics_1_ChenS.pptx
Bioinformatics_1_ChenS.pptx
 
2015 genome-center
2015 genome-center2015 genome-center
2015 genome-center
 
Cloud bioinformatics 2
Cloud bioinformatics 2Cloud bioinformatics 2
Cloud bioinformatics 2
 
Sequencing Genomics: The New Big Data Driver
Sequencing Genomics:The New Big Data DriverSequencing Genomics:The New Big Data Driver
Sequencing Genomics: The New Big Data Driver
 
Better science through superior software
Better science through superior softwareBetter science through superior software
Better science through superior software
 
2012 hpcuserforum talk
2012 hpcuserforum talk2012 hpcuserforum talk
2012 hpcuserforum talk
 
Mining Big Data using Genetic Algorithm
Mining Big Data using Genetic AlgorithmMining Big Data using Genetic Algorithm
Mining Big Data using Genetic Algorithm
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astro
 
Next Generation Sequencing in Big Data
Next Generation Sequencing in Big DataNext Generation Sequencing in Big Data
Next Generation Sequencing in Big Data
 
(Em)Powering Science: High-Performance Infrastructure in Biomedical Science
(Em)Powering Science: High-Performance Infrastructure in Biomedical Science(Em)Powering Science: High-Performance Infrastructure in Biomedical Science
(Em)Powering Science: High-Performance Infrastructure in Biomedical Science
 
High-Performance Networking Use Cases in Life Sciences
High-Performance Networking Use Cases in Life SciencesHigh-Performance Networking Use Cases in Life Sciences
High-Performance Networking Use Cases in Life Sciences
 
eScience: A Transformed Scientific Method
eScience: A Transformed Scientific MethodeScience: A Transformed Scientific Method
eScience: A Transformed Scientific Method
 
2014 11-13-sbsm032-reproducible research
2014 11-13-sbsm032-reproducible research2014 11-13-sbsm032-reproducible research
2014 11-13-sbsm032-reproducible research
 
Managing & Processing Big Data for Cancer Genomics, an insight of Bioinformatics
Managing & Processing Big Data for Cancer Genomics, an insight of BioinformaticsManaging & Processing Big Data for Cancer Genomics, an insight of Bioinformatics
Managing & Processing Big Data for Cancer Genomics, an insight of Bioinformatics
 
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
 
Jax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbuJax bio dataworldcongress.ngs.20181128finalwithoutbu
Jax bio dataworldcongress.ngs.20181128finalwithoutbu
 

Último

Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...Orbitshub
 
[BuildWithAI] Introduction to Gemini.pdf
[BuildWithAI] Introduction to Gemini.pdf[BuildWithAI] Introduction to Gemini.pdf
[BuildWithAI] Introduction to Gemini.pdfSandro Moreira
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...apidays
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century educationjfdjdjcjdnsjd
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxRustici Software
 
FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024The Digital Insurer
 
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...Jeffrey Haguewood
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobeapidays
 
Spring Boot vs Quarkus the ultimate battle - DevoxxUK
Spring Boot vs Quarkus the ultimate battle - DevoxxUKSpring Boot vs Quarkus the ultimate battle - DevoxxUK
Spring Boot vs Quarkus the ultimate battle - DevoxxUKJago de Vreede
 
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...apidays
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyKhushali Kathiriya
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MIND CTI
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAndrey Devyatkin
 
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Victor Rentea
 
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWEREMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWERMadyBayot
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024The Digital Insurer
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoffsammart93
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...apidays
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native ApplicationsWSO2
 

Último (20)

Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
 
[BuildWithAI] Introduction to Gemini.pdf
[BuildWithAI] Introduction to Gemini.pdf[BuildWithAI] Introduction to Gemini.pdf
[BuildWithAI] Introduction to Gemini.pdf
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptx
 
FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024
 
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
 
Spring Boot vs Quarkus the ultimate battle - DevoxxUK
Spring Boot vs Quarkus the ultimate battle - DevoxxUKSpring Boot vs Quarkus the ultimate battle - DevoxxUK
Spring Boot vs Quarkus the ultimate battle - DevoxxUK
 
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : Uncertainty
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
 
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
 
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWEREMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native Applications
 

Next generation genomics: Petascale data in the life sciences