Enviar búsqueda
Cargar
Control of immune response by regulatory T cells
•
5 recomendaciones
•
1,745 vistas
VICTOR MAESTRE RAMIREZ
Seguir
Control of immune response by regulatory T cells
Leer menos
Leer más
Salud y medicina
Denunciar
Compartir
Denunciar
Compartir
1 de 45
Descargar ahora
Descargar para leer sin conexión
Recomendados
Tregs
Tregs
amirhossein heydarian
Chapter 36 t reg cells
Chapter 36 t reg cells
Nilesh Kucha
T cell maturation050406
T cell maturation050406
zmekit
T CELL ACTIVATION AND IT'S TERMINATION
T CELL ACTIVATION AND IT'S TERMINATION
premvarma064
T regulatory cell
T regulatory cell
biplabendu talukdar
Immune tolerance
Immune tolerance
Chulalongkorn Allergy and Clinical Immunology Research Group
Tumor Immunology presentation by Sharmista
Tumor Immunology presentation by Sharmista
SharmistaChaitali
IMMUNE RESPONSE TO TUMORS
IMMUNE RESPONSE TO TUMORS
Saajida Sultaana
Recomendados
Tregs
Tregs
amirhossein heydarian
Chapter 36 t reg cells
Chapter 36 t reg cells
Nilesh Kucha
T cell maturation050406
T cell maturation050406
zmekit
T CELL ACTIVATION AND IT'S TERMINATION
T CELL ACTIVATION AND IT'S TERMINATION
premvarma064
T regulatory cell
T regulatory cell
biplabendu talukdar
Immune tolerance
Immune tolerance
Chulalongkorn Allergy and Clinical Immunology Research Group
Tumor Immunology presentation by Sharmista
Tumor Immunology presentation by Sharmista
SharmistaChaitali
IMMUNE RESPONSE TO TUMORS
IMMUNE RESPONSE TO TUMORS
Saajida Sultaana
Tcr
Tcr
Creative Biolabs
B-cell development.pptx
B-cell development.pptx
VaisHali822687
B cell activation and antibody production
B cell activation and antibody production
Chulalongkorn Allergy and Clinical Immunology Research Group
Cytokines
Cytokines
Kayeen Vadakkan
Cytokines
Cytokines
Juliet Abisha
Tolerance and autoimmunity
Tolerance and autoimmunity
Omair Riaz
Tumor immunity
Tumor immunity
madhursejwal
Tumor immunology
Tumor immunology
Pashon Hana
Immunological tolerance and resistance
Immunological tolerance and resistance
Avijit Pramanik
Immunity to virus
Immunity to virus
DUSHYANT KUMAR
Immune response to infection by Virus
Immune response to infection by Virus
Genetica in Biotechnica
Immunology 1, 2, 3
Immunology 1, 2, 3
Ahmed Elshebiny
Theory of immune surveillance
Theory of immune surveillance
ShariqaJan
Innate immunity: An Over view
Innate immunity: An Over view
Muhammad Getso
Autoimmune disorders
Autoimmune disorders
Vamsi Chakradhar
Cytokine and chemokines ppt
Cytokine and chemokines ppt
Manmohan09
Tumor immunity
Tumor immunity
ayeayetun08
T-cell activation
T-cell activation
Microbiology
Antibodies
Antibodies
NCRIMS, Meerut
Cell mediated & humoral immunity
Cell mediated & humoral immunity
prithvi singh
The regulatory t cells (tregs
The regulatory t cells (tregs
eman youssif
Regulatory T Cells and GVHD
Regulatory T Cells and GVHD
spa718
Más contenido relacionado
La actualidad más candente
Tcr
Tcr
Creative Biolabs
B-cell development.pptx
B-cell development.pptx
VaisHali822687
B cell activation and antibody production
B cell activation and antibody production
Chulalongkorn Allergy and Clinical Immunology Research Group
Cytokines
Cytokines
Kayeen Vadakkan
Cytokines
Cytokines
Juliet Abisha
Tolerance and autoimmunity
Tolerance and autoimmunity
Omair Riaz
Tumor immunity
Tumor immunity
madhursejwal
Tumor immunology
Tumor immunology
Pashon Hana
Immunological tolerance and resistance
Immunological tolerance and resistance
Avijit Pramanik
Immunity to virus
Immunity to virus
DUSHYANT KUMAR
Immune response to infection by Virus
Immune response to infection by Virus
Genetica in Biotechnica
Immunology 1, 2, 3
Immunology 1, 2, 3
Ahmed Elshebiny
Theory of immune surveillance
Theory of immune surveillance
ShariqaJan
Innate immunity: An Over view
Innate immunity: An Over view
Muhammad Getso
Autoimmune disorders
Autoimmune disorders
Vamsi Chakradhar
Cytokine and chemokines ppt
Cytokine and chemokines ppt
Manmohan09
Tumor immunity
Tumor immunity
ayeayetun08
T-cell activation
T-cell activation
Microbiology
Antibodies
Antibodies
NCRIMS, Meerut
Cell mediated & humoral immunity
Cell mediated & humoral immunity
prithvi singh
La actualidad más candente
(20)
Tcr
Tcr
B-cell development.pptx
B-cell development.pptx
B cell activation and antibody production
B cell activation and antibody production
Cytokines
Cytokines
Cytokines
Cytokines
Tolerance and autoimmunity
Tolerance and autoimmunity
Tumor immunity
Tumor immunity
Tumor immunology
Tumor immunology
Immunological tolerance and resistance
Immunological tolerance and resistance
Immunity to virus
Immunity to virus
Immune response to infection by Virus
Immune response to infection by Virus
Immunology 1, 2, 3
Immunology 1, 2, 3
Theory of immune surveillance
Theory of immune surveillance
Innate immunity: An Over view
Innate immunity: An Over view
Autoimmune disorders
Autoimmune disorders
Cytokine and chemokines ppt
Cytokine and chemokines ppt
Tumor immunity
Tumor immunity
T-cell activation
T-cell activation
Antibodies
Antibodies
Cell mediated & humoral immunity
Cell mediated & humoral immunity
Destacado
The regulatory t cells (tregs
The regulatory t cells (tregs
eman youssif
Regulatory T Cells and GVHD
Regulatory T Cells and GVHD
spa718
Ppt t reg cells
Ppt t reg cells
Richin Koshy
T reg
T reg
eman youssif
Regulatory t cells
Regulatory t cells
Sayra Medellín
regulatory-t-cells-and-their-implications-in-graft-versus-host-disease-2-pdf-1
regulatory-t-cells-and-their-implications-in-graft-versus-host-disease-2-pdf-1
Dat Tran, MD
T helper17 cells
T helper17 cells
jafar Ali
T cellppt
T cellppt
Sagar Chawan
2015 IEM CAC poster V1.0
2015 IEM CAC poster V1.0
Qi Shao
LPN Basic Immune System Overview
LPN Basic Immune System Overview
carrie9660
Maths archana
Maths archana
ARCHANA VT
Immunology v t-ly
Immunology v t-ly
MUBOSScz
Th17
Th17
Jesus M Quintero
Helper t cell 17
Helper t cell 17
yoyosuky
Tutor hema lulut
Tutor hema lulut
pdspatklinsby
Maternal immunity in fishes
Maternal immunity in fishes
Shyam K Uthaman
Transplantation immunology
Transplantation immunology
Haris Saddique
T Cell Repertoire & Self Tolerance
T Cell Repertoire & Self Tolerance
raj kumar
Basic immunology
Basic immunology
Fadel Muhammad Garishah
Immunology chapter 8
Immunology chapter 8
Sarah Davies
Destacado
(20)
The regulatory t cells (tregs
The regulatory t cells (tregs
Regulatory T Cells and GVHD
Regulatory T Cells and GVHD
Ppt t reg cells
Ppt t reg cells
T reg
T reg
Regulatory t cells
Regulatory t cells
regulatory-t-cells-and-their-implications-in-graft-versus-host-disease-2-pdf-1
regulatory-t-cells-and-their-implications-in-graft-versus-host-disease-2-pdf-1
T helper17 cells
T helper17 cells
T cellppt
T cellppt
2015 IEM CAC poster V1.0
2015 IEM CAC poster V1.0
LPN Basic Immune System Overview
LPN Basic Immune System Overview
Maths archana
Maths archana
Immunology v t-ly
Immunology v t-ly
Th17
Th17
Helper t cell 17
Helper t cell 17
Tutor hema lulut
Tutor hema lulut
Maternal immunity in fishes
Maternal immunity in fishes
Transplantation immunology
Transplantation immunology
T Cell Repertoire & Self Tolerance
T Cell Repertoire & Self Tolerance
Basic immunology
Basic immunology
Immunology chapter 8
Immunology chapter 8
Similar a Control of immune response by regulatory T cells
IDO pathway from bench to clinic
IDO pathway from bench to clinic
Houssein A Sater
Mitochondrial Disease & Immune Systems
Mitochondrial Disease & Immune Systems
mitoaction
2015 11 Inmunoterapia en nsclc
2015 11 Inmunoterapia en nsclc
Martín Lázaro
McGuire - Immune Systems
McGuire - Immune Systems
mitoaction
1.1 philippe sansonetti
1.1 philippe sansonetti
Association LIR
Immunology of tanslanatation and malignancy
Immunology of tanslanatation and malignancy
raghunathp
tumor immunology.pptx
tumor immunology.pptx
Annie Annie
Autoimmunity.pptx
Autoimmunity.pptx
JeniferOtadoyAgustin1
Cancer immunology.pptx
Cancer immunology.pptx
Annie Annie
Seminario biología molecular Daniel Londoño Cañas
Seminario biología molecular Daniel Londoño Cañas
Daniel Londoño
Immunology of helminth infections
Immunology of helminth infections
Abhijit Chaudhury
Biology 106 Journal 3 ( Mader 13) Lvmphatic System and.docx
Biology 106 Journal 3 ( Mader 13) Lvmphatic System and.docx
hartrobert670
07. immunology
07. immunology
Bassant Alaa
Adaptive immunity 2 - Immune regulatory mechanisms through B cell axis
Adaptive immunity 2 - Immune regulatory mechanisms through B cell axis
VICTOR MAESTRE RAMIREZ
Transplantation immunology
Transplantation immunology
Ashwani Kesarwani
Immune response to infectious agents.pptx
Immune response to infectious agents.pptx
ahmed811332
Dr. Santos Manes - Simposio Internacional 'Terapias oncológicas avanzadas'
Dr. Santos Manes - Simposio Internacional 'Terapias oncológicas avanzadas'
Fundación Ramón Areces
Tumor immunology
Tumor immunology
Promila Sheoran
Autoimmunity and autoimmune diseases dr. ihsan alsaimary
Autoimmunity and autoimmune diseases dr. ihsan alsaimary
dr.Ihsan alsaimary
Autoimmunity-and-Autoimmune-disorders.pdf
Autoimmunity-and-Autoimmune-disorders.pdf
Narendrasharma556266
Similar a Control of immune response by regulatory T cells
(20)
IDO pathway from bench to clinic
IDO pathway from bench to clinic
Mitochondrial Disease & Immune Systems
Mitochondrial Disease & Immune Systems
2015 11 Inmunoterapia en nsclc
2015 11 Inmunoterapia en nsclc
McGuire - Immune Systems
McGuire - Immune Systems
1.1 philippe sansonetti
1.1 philippe sansonetti
Immunology of tanslanatation and malignancy
Immunology of tanslanatation and malignancy
tumor immunology.pptx
tumor immunology.pptx
Autoimmunity.pptx
Autoimmunity.pptx
Cancer immunology.pptx
Cancer immunology.pptx
Seminario biología molecular Daniel Londoño Cañas
Seminario biología molecular Daniel Londoño Cañas
Immunology of helminth infections
Immunology of helminth infections
Biology 106 Journal 3 ( Mader 13) Lvmphatic System and.docx
Biology 106 Journal 3 ( Mader 13) Lvmphatic System and.docx
07. immunology
07. immunology
Adaptive immunity 2 - Immune regulatory mechanisms through B cell axis
Adaptive immunity 2 - Immune regulatory mechanisms through B cell axis
Transplantation immunology
Transplantation immunology
Immune response to infectious agents.pptx
Immune response to infectious agents.pptx
Dr. Santos Manes - Simposio Internacional 'Terapias oncológicas avanzadas'
Dr. Santos Manes - Simposio Internacional 'Terapias oncológicas avanzadas'
Tumor immunology
Tumor immunology
Autoimmunity and autoimmune diseases dr. ihsan alsaimary
Autoimmunity and autoimmune diseases dr. ihsan alsaimary
Autoimmunity-and-Autoimmune-disorders.pdf
Autoimmunity-and-Autoimmune-disorders.pdf
Más de VICTOR MAESTRE RAMIREZ
Cloud Management Software Platforms: OpenStack
Cloud Management Software Platforms: OpenStack
VICTOR MAESTRE RAMIREZ
VICTOR MAESTRE RAMIREZ - Planetary Defender on NASA's Double Asteroid Redirec...
VICTOR MAESTRE RAMIREZ - Planetary Defender on NASA's Double Asteroid Redirec...
VICTOR MAESTRE RAMIREZ
Software and Systems Engineering Standards: Verification and Validation of Sy...
Software and Systems Engineering Standards: Verification and Validation of Sy...
VICTOR MAESTRE RAMIREZ
Cloud Data Center Network Construction - IEEE
Cloud Data Center Network Construction - IEEE
VICTOR MAESTRE RAMIREZ
Advanced Machine Learning for Business Professionals
Advanced Machine Learning for Business Professionals
VICTOR MAESTRE RAMIREZ
Intermediate Deep Learning with PyTorch - DataCamp
Intermediate Deep Learning with PyTorch - DataCamp
VICTOR MAESTRE RAMIREZ
Gestión de Incidentes de Cibersegurdad - Centro Criptológico Nacional
Gestión de Incidentes de Cibersegurdad - Centro Criptológico Nacional
VICTOR MAESTRE RAMIREZ
Modernes Leistungsmanagement - Management
Modernes Leistungsmanagement - Management
VICTOR MAESTRE RAMIREZ
Generative AI for Cybersecurity - EC-Council
Generative AI for Cybersecurity - EC-Council
VICTOR MAESTRE RAMIREZ
Deep Learning for Images with PyTorch - Datacamp
Deep Learning for Images with PyTorch - Datacamp
VICTOR MAESTRE RAMIREZ
Werteorientiertes Management - Management
Werteorientiertes Management - Management
VICTOR MAESTRE RAMIREZ
Artificial Intelligence for Business Leaders
Artificial Intelligence for Business Leaders
VICTOR MAESTRE RAMIREZ
Hands-on SQL for Data Science - EC-Council
Hands-on SQL for Data Science - EC-Council
VICTOR MAESTRE RAMIREZ
Becoming a Network Security Engineer - EC-Council
Becoming a Network Security Engineer - EC-Council
VICTOR MAESTRE RAMIREZ
Implementing Docker Containers with Windows Server 2019
Implementing Docker Containers with Windows Server 2019
VICTOR MAESTRE RAMIREZ
Unit Testing for Data Science in Python - DataCamp
Unit Testing for Data Science in Python - DataCamp
VICTOR MAESTRE RAMIREZ
Project Management Foundations: Risk Management
Project Management Foundations: Risk Management
VICTOR MAESTRE RAMIREZ
Project Management Foundations: Communication
Project Management Foundations: Communication
VICTOR MAESTRE RAMIREZ
Project Management Foundations: Teams
Project Management Foundations: Teams
VICTOR MAESTRE RAMIREZ
Project Management Foundations: Budgets
Project Management Foundations: Budgets
VICTOR MAESTRE RAMIREZ
Más de VICTOR MAESTRE RAMIREZ
(20)
Cloud Management Software Platforms: OpenStack
Cloud Management Software Platforms: OpenStack
VICTOR MAESTRE RAMIREZ - Planetary Defender on NASA's Double Asteroid Redirec...
VICTOR MAESTRE RAMIREZ - Planetary Defender on NASA's Double Asteroid Redirec...
Software and Systems Engineering Standards: Verification and Validation of Sy...
Software and Systems Engineering Standards: Verification and Validation of Sy...
Cloud Data Center Network Construction - IEEE
Cloud Data Center Network Construction - IEEE
Advanced Machine Learning for Business Professionals
Advanced Machine Learning for Business Professionals
Intermediate Deep Learning with PyTorch - DataCamp
Intermediate Deep Learning with PyTorch - DataCamp
Gestión de Incidentes de Cibersegurdad - Centro Criptológico Nacional
Gestión de Incidentes de Cibersegurdad - Centro Criptológico Nacional
Modernes Leistungsmanagement - Management
Modernes Leistungsmanagement - Management
Generative AI for Cybersecurity - EC-Council
Generative AI for Cybersecurity - EC-Council
Deep Learning for Images with PyTorch - Datacamp
Deep Learning for Images with PyTorch - Datacamp
Werteorientiertes Management - Management
Werteorientiertes Management - Management
Artificial Intelligence for Business Leaders
Artificial Intelligence for Business Leaders
Hands-on SQL for Data Science - EC-Council
Hands-on SQL for Data Science - EC-Council
Becoming a Network Security Engineer - EC-Council
Becoming a Network Security Engineer - EC-Council
Implementing Docker Containers with Windows Server 2019
Implementing Docker Containers with Windows Server 2019
Unit Testing for Data Science in Python - DataCamp
Unit Testing for Data Science in Python - DataCamp
Project Management Foundations: Risk Management
Project Management Foundations: Risk Management
Project Management Foundations: Communication
Project Management Foundations: Communication
Project Management Foundations: Teams
Project Management Foundations: Teams
Project Management Foundations: Budgets
Project Management Foundations: Budgets
Último
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Dipal Arora
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
Taniya Sharma
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
narwatsonia7
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Ishani Gupta
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Call Girls in Nagpur High Profile
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
parulsinha
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
9953056974 Low Rate Call Girls In Saket, Delhi NCR
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Genuine Call Girls
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
parulsinha
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
tanya dube
Top Rated Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...
Top Rated Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...
chandars293
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Dipal Arora
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Dipal Arora
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Dipal Arora
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Dipal Arora
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Dipal Arora
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
vidya singh
Call Girls Haridwar Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Haridwar Just Call 8250077686 Top Class Call Girl Service Available
Dipal Arora
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
hotbabesbook
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
narwatsonia7
Último
(20)
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Premium Bangalore Call Girls Jigani Dail 6378878445 Escort Service For Hot Ma...
Top Rated Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...
Top Rated Hyderabad Call Girls Erragadda ⟟ 9332606886 ⟟ Call Me For Genuine ...
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kochi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Call Girls Haridwar Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Haridwar Just Call 8250077686 Top Class Call Girl Service Available
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Control of immune response by regulatory T cells
1.
© 2015 Osaka
University. All rights reserved. Control of immune responses by regulatory T cells Shimon Sakaguchi WPI Immunology Frontier Research Center Osaka University Immunological Self-Tolerance Autoimmune Disease Tumor Immunity Chronic microbial infection Allergy Organ transplantation Feto-maternal tolerance Immune system Self Non-self
2.
© 2015 Osaka
University. All rights reserved. Possible Mechanisms of Immunological Self-Tolerance Deletion (Apoptosis) Self 1 Inactivation (Anergy) Self 2 Suppression Self 3 Treg Autoimmune diseases in humans Autoimmune diseases Organ-specific Non-organ-specific
3.
© 2015 Osaka
University. All rights reserved. 5% of the population is afflicted with autoimmune disease Organ-specific Two types of autoimmune disease Non-organ-specific brain Multiple sclerosis(?) thyroid Hashimoto’s thyroiditis primary myxoedema thyrotoxicosis stomach pernicious anaemia adrenal Addison’s disease pancreas Insulin-dependent Diabetes mellitus (TYPE I) muscle dermatomyositis kidney SLE skin scleroderma SLE joints rheumatoid arthritis Grave’s disease Systemic Lupus Erythematosus Overlapping of affected organs as a characteristic of organ-specific autoimmune diseases Reference: Irvine (1979) Medical Immunology Clinical Level Subclinical Level Patients with TYPE I diabetes
4.
© 2015 Osaka
University. All rights reserved. Overlapping of affected organs as a characteristic of organ-specific autoimmune diseases Type 1 diabetes, Thyroiditis NOD mice BB rats Type 1 diabetes, Thyroiditis, Gastritis Thymectomy normal mouse Removal of the thymus
5.
© 2015 Osaka
University. All rights reserved. Induction of autoimmune diseases by manipulating the T cell immune system Mice Tx Day 3 after birth Autoimmune gastritis, oophoritis, thyroiditis, etc. Rats 6 week Tx X-irradiation Autoimmune thyroiditis, Type 1 diabetes Induction of autoimmune diseases by manipulating the T cell immune system Mice Tx Day 3 after birth Autoimmune gastritis, oophoritis, thyroiditis, etc. Rats 6 week Tx X-irradiation Autoimmune thyroiditis, Type 1 diabetes
6.
© 2015 Osaka
University. All rights reserved. Thyroiditis Oophoritis Orchitis Post-thymectomy organ-specific autoimmune diseases BALB/c Day 0-Tx 0/35 1/35(2.9%) 0/35 0/35 Day 3-Tx 0/45 15/45(33.3%) 12/45(26.7%) 0/45 Day 7-Tx 0/35 0/35 0/350/35 A Day 3-Tx 3/50(6.0) 5/50(10.0%) 44/50(88.0%) 8/50(16.0%) C57BL/6 Day 3-Tx 0/20 0/200/200/20 Reference: Sakaguchi et al. J. Exp. Med. 1982 Asano et al., J. Exp. Med. 1996 Gastritis MICE Autoimmune diseases Tx:Thymectomy Findings BALB/c A C57 BLACK Date of thymectomy 1 2 Genetic background of mice
7.
© 2015 Osaka
University. All rights reserved. DAY 0 3 Tx 17/20 Tx Tx Tx Tx Tx 0 10 17 24 31 5x106 T cells 0/5 0/10 0/10 2/10 8/10 Incidence of Autoimmune disease Tx:Thymectomy Prevention of NTx-induced autoimmune disease by T cells from normal adult mice Sakaguchi et al. J. Exp. Med. 1982 60 0-1 3 4 5 6 7-2 1 2Day Regulatory T cells NTx How does NTx cause autoimmune disease? Autoimmune T cells Autoimmune Disease Thymus
8.
© 2015 Osaka
University. All rights reserved. Induction of autoimmune disease in normal animals by depleting a T-cell subpopulation (1) BALB/c CD4+ T-cell suspensions eliminated of CD5high, CD45RClow, or CD25+ cells BALB/c nude Induction of autoimmune disease in normal animals by depleting a T-cell subpopulation (2) Sakaguchi S, et al. J. Immunol. 1995CD25 (IL-2Rα) CD25 (IL-2Rα) CD4
9.
© 2015 Osaka
University. All rights reserved. Induction of autoimmune disease in normal animals by depleting a T-cell (3) Sakaguchi S, et al. J. Exp. Med. 1985 Sakaguchi S, et al. J. Immunol. 1995 Powrie F & Mason D. J. Exp. Med. 1990 Thyroid Sislet Stomach Salivary gland Langerhans islets Overies Testes Inflammatory bowl disease develop very similar autoimmune diseases in various organs BALB/c nude Remove CD25+ cells Then transfer remaining cells into nude mice Induction of autoimmune disease in normal animals by depleting a T-cell subpopulation Gastritis Thyroiditis Insulitis/ (type 1 diabetes) BALB/c Nude (Removed CD25+ cells)
10.
© 2015 Osaka
University. All rights reserved. A. 18 0 0 0 0 0 0 0 0Whole (5x107) Induction of autoimmune disease in nude mice by transferring CD25-CD4+ T cells Exp. group Inoculated cells Total number of mice Number of mice with autoimmune disease Gas Oop Thyr Sial Adr Ins GN Arth C. CD4+CD25- (5x107) 16 14 (87.5) 13 (81.3) 7 (43.8) 5 (31.3) 2 (12.3) 0 3 (18.8) 0 B. 22 22 (100) 22 (100) 16 (72.7) 10 (45.1) 7 (31.8) 2 (9.1) 7 (31.8) 2 (9.1) CD25- (5x107) 6 1 (16.7) 0 0 0 0 0 0 0E. (2x106) CD25- CD25++ (5x107) 10 0 0 0 0 0 0 0D. 0 CD8+CD25- (5x107) Ontogeny of CD25+CD4+ T cells(1) Figure: Asano et al. J. Exp. Med. 1996
11.
© 2015 Osaka
University. All rights reserved. Figure: Asano et al. J. Exp. Med. 1996 Ontogeny of CD25+CD4+ T cells(2) Treg Altered Treg-mediated immunoregulation as a cause of immunological diseases Biological (e.g., MTLV) Chemical (e.g., Cyclosporin A) Physical (e.g., ionizing radiation) Non-genetical insults Genetic anomalies Foxp3 CTLA-4 IL-2, CD25, CD122 Runx1/AML1 CD40 Sakaguchi et al., 1988; Sakaguchi et al., 1989; Sakaguchi et al., 1994; Morse et al., 1999; Kumanogo et al., 2000; Takahashi et al., 2000; Setoguchi et al., 2005; Hori et al., 2003; Ono et al., 2007; Wing et al., 2008; Kitoh et al., 2009 Self Antigen Bone Marrow Thymus Periphery CD25+ CD4+ Genetic anomalies Environmental insults MF B CD25- CD4+ CD4+ Teff Examples CTL
12.
© 2015 Osaka
University. All rights reserved. • Autoimmune disease : T1D (>80%),Thyroiditis, etc. • Inflammatory bowel disease • Allergy (hyper-IgE) Foxp3 mutations abrogate Treg cell development, causing autoimmune/inflammatory diseases (1) IPEX Immune dysregulation, Polyendocrinopathy, Enteropathy, X-linked syndrome Scurfy mice Foxp3 mutations abrogate Treg cell development, causing autoimmune/inflammatory diseases Wild type Scurfy • Lymphoadenopathy • Hyperactivation of CD4+ T cells • X-linked disease
13.
© 2015 Osaka
University. All rights reserved. Induction of autoimmune disease in normal animals by depleting Foxp3+CD25+ Treg cells (1) Thymocytes or Splenic T cells Depletion of CD25+ Tregs Autoimmune diseases Inflammatory bowel disease etc. Cell transfer Normal mouse develop T cell-deficient mouse Induction of autoimmune disease in normal animals by depleting Foxp3+CD25+ Treg cells (2) Thymus Spleen CD25 Foxp3 Sakaguchi S, et al. J. Exp. Med. 1985 Sakaguchi S, et al. J. Immunol. 1995 Itoh M, et al., J. Immunol. 1999
14.
© 2015 Osaka
University. All rights reserved. Inhibition of autoimmune disease and IBD by Foxp3-transduced naïve T cells Foxp3/MIGR1 MIGR1 CD4 GFP LTR Foxp3 IRES GFP LTR Foxp3/MIGR1 LTR IRES GFP LTR MIGR1 Hori, et al., Science. 2003 Inhibition of autoimmune disease and IBD by Foxp3-transduced naïve T cells Colon Stomach +Foxp3/MIGR1 None+MIGR1CD25- CD45RBhi alone gastritisscore 0 1 2 3 colitisscore 0 1 2 3 4 5
15.
© 2015 Osaka
University. All rights reserved. Dominant self-tolerance in rodents and humans Teff Teff Treg Nude or SCID mice No disease Teff Treg Teff Treg Mothers of IPEX patients IPEX patients Whole T cells CD25 T cells Induction of autoimmune disease and IBD by depleting Treg cells Normal Autoimmune disease IBD Hyperreactivity Development of autoimmune disease, IBD, and allergy in IPEX Humans Autoimmune disease IBD Hyperreactivity Sakaguchi, Annu. Rev. Immunol. 2004 Complete depletion of Foxp3+ cells produces fatal autoimmune/ inflammatory diseases
16.
© 2015 Osaka
University. All rights reserved. Complete depletion of Foxp3+ cells produces fatal autoimmune/ inflammatory diseases Non-self Self Allergy Immunopathology Autoimmunity Deficiency or dysfunction of Foxp3+ Treg cells produces a variety of autoimmune, immunopathological, and allergic diseases CD25+ cells Foxp3+ cells Normal Treg Treg deficiency/dysfunction
17.
© 2015 Osaka
University. All rights reserved. Induction of tumor immunity by depleting CD25+CD4+ T cells (n=10 each) Athymic nude mouse Shimizu, et al., J. Immunol. 1999 Tumor cells (RLm1) Cell transfer Induction of allograft tolerance by graft-specific expansion of CD25+CD4+ Treg cells Nishimura, et al., Int. Immunol. 2004 B6 skin graft 1 week CD25+CD4+ T cells Naïve T cells Graft survival BALB/c BALB/c nude
18.
© 2015 Osaka
University. All rights reserved. Induction of allograft tolerance by graft-specific expansion of CD25+CD4+ Treg cells 100806040200 20 40 60 80 100 Days after cell transfer Graftsurvival(%) T cells alone (1:1) T cells & CD25+ T cells (1:3) 120 n=15 n=13 n=29 Nishimura, et al., Int. Immunol. 2004 T cells & CD25+ T cells Self antigen Tumor antigen Allo antigen Bone Marrow Thymus Foxp3 Foxp3 Treg Foxp3 Treg Th1 Th2 Th17 etc., Naïve T cell CTLA-4+ CD25+TGF- CTLA-4+ CD25+ Summary: Section 1
19.
© 2015 Osaka
University. All rights reserved. Control of cytokines and Treg-associated molecules by Foxp3 CD25 GITR CTLA-4 IL-2R ? Foxp3 IL-2 CD25 (IL-2R -chain) CD122 (IL-2R -chain) CTLA-4 GITR - Deficiency Autoimmune/inflammatory disease IL-2 IFN Repression Sakaguchi, Nat. Immunol. 2005 + + + + + Activation Foxp3 Is CD25 (IL-2R -chain) a mere marker for natural Tregs or an essential molecule for their function? Figure: R. Setoguchi et al. JEM 2005 IL-2 IL-2R Treg
20.
© 2015 Osaka
University. All rights reserved. CD25+ CD4+ CD25- CD4+ CD25+ CD4+ CD25- CD4+ IL-2Rβ IL-2R Tregs constitutively express the high affinity IL-2 receptor already in the thymus Figure: Setoguchi et al. J. Exp. Med. 2005 Thymus Spleen IL-2 neutralization by specific mAb reduces Tregs in the thymus and the periphery CD25 CD4 1.7% 0.3% 2.6% 0.6% Saline Anti-IL-2 Setoguchi et al. J. Exp. Med. 2005 Thymus Spleen
21.
© 2015 Osaka
University. All rights reserved. CD25+CD4+ Tregs are physiologically proliferating and IL-2 neutralization selectively inhibits their proliferation 6.47 % 2.22 % 1.79%1.71 % Saline Anti-IL-2 CD25+CD4+ T cells CD25-CD4+ T cells BrdU Induction of autoimmune disease in normal mice by IL-2 neutralization Birth 0 10 20 3 month Anti-IL-2 1mg i.p. Histological Serological analysis Setoguchi et al. J. Exp. Med. 2005 BALB/c Day
22.
© 2015 Osaka
University. All rights reserved. Induction of autoimmune disease in normal mice by IL-2 neutralization Anti-parietal cell autoantibody (OD 405 nm) 0 0.2 0.4 0.6 0.8 1.0 1.2 Saline Anti-IL-2 N=6 N=6 : intact gastric mucosa : histologically evident gastritis Setoguchi et al. J. Exp. Med. 2005 APC CD25lowCD4+ T cells are the principal IL-2 producers in normal naïve mice 25hi 25lo 25- CD4 CD25 IL-2IL-2R 0 4 8 12 16 25hi 25lo 25- IL-2(pg/ml) Setoguchi et al. J. Exp. Med. 2005 NKT CD8+ NK
23.
© 2015 Osaka
University. All rights reserved. Crucial roles of IL-2 for self-tolerance Foxp3+ Tregs Th17 differentiation AICD of T cells NK cells, CD8+ T cells, esp. memory IL-2 CTLA-4 Two models of CTLA-4-mediated immune regulation APC (B) CD28 B7 Treg Teff B7 APCAPC (A) CTLA-4 CD28 APC B7 Teff B7 (A) (B)
24.
© 2015 Osaka
University. All rights reserved. Treg-specific CTLA-4 conditional KO mice Targeted Foxp3 allele 11.2 0.4 44.42.4 CTLA-4 Cond KOWT littermate Foxp3 CTLA-4 13.35.8 Gated on CD4+ T cells K. Wing et al., Science 2008 Exon Exon PGK Neo PA FRTFRT IRES Cre PA 10 11 12 13 Targeted CTLA-4 allele IoxP IoxP FRT 2 3 PGK Neo PA FRT 1 2 3 4 Reduced survival of BALB/c CTLA-4 CKO mice CTLA-4 CTLA-4 CTLA-4 Foxp3 Foxp3 Foxp3 FIC/Y CTLA-4 CKO CTLA-4 KO
25.
© 2015 Osaka
University. All rights reserved. Autoimmune gastritis in CTLA-4 CKO mice Anti-parietalcellAb(unit) WT FIC CKO FIC/Y CTLA-4 CKO Autoimmune myocarditis in CTLA-4 CKO mice
26.
© 2015 Osaka
University. All rights reserved. Hyperproduction of IgE in CTLA-4 CKO miceIgE IgG Induction of effective tumor immunity by Treg-specific CTLA-4 deficiency Tumor cells: RLm1 leukemia K. Wing et al., Science 2008
27.
© 2015 Osaka
University. All rights reserved. Cancer regression and autoimmunity induced by cytotoxic T lymphocyte-associsted antigen 4 blockade in patients with etastatic melanoma Phan G. Q., Yang J. C., Sherry R. M., et al. Cancer regression and autoimmunity induced by cytotoxic T lymphocyte-associated antigen 4 blockade in patients with metastatic melanoma. Proceedings of the National Academy of Sciences of the United States of America. 2003;100(14):8372–8377. doi: 10.1073/pnas.1533209100
28.
© 2015 Osaka
University. All rights reserved. Patient characteristics, clinical response, and toxicity 1 52/M Lung I, S 2 PR(15+) Enteroco;it is; dermatiyis 2 40/F Supraclavicular lymph node C, I, S 1 NR Dermatitis, vitiligo 3 39/M Lung, mediastinum, subcutaneous S 6 NR(Mixed) 4 55/F Skin, subcutaneous I, S 1 NR Pulmonary infiltrates 5 67/M Liver, retroperitoneum, subcutaneous C, I, R, S 4 NR ANA+ 6 59/M Lung, subcutaneous I, S 4 NR Vitiligo 7 48/M Lung, brain, adrenal, subcutaneous I, S 2 NR 8 48/M Lung, liver, adrenal, mesentery, subcutaneous C, I, S 2 NR 9 53/M Mediastinum, mesentery, skin I, R, S 2 NR Colitis 10 62/M Lung, hilum C, I, S 2 NR(mixed) 11 54/M Lung, brain, subcutaneous C, S 5 CR(12+) Hypophysitis 12 43/M Subdiaphragm, muscle, subcutaneous I, S 3 NR Hepatitis; ANA+ 13 49/F Lung, subcutaneous C, I, S 4 CR(11+) Dematitis 14 63/M Lung, pelvic, lymph node S 4 NR Patient Age/sex Disease sites Prior therapy NO. of cycles received Response (mos.) Toxicity (grade III / IV) Tregs down-regulate CD86 on CD86-transfected L cells, whereas CTLA-4 CKO Tregs do not CD80/CD86 CTLA-4 K. Wing et al., Science 2008 APC Treg APC? Trogocytosis Transendocytosis Down-regulation of CD80/CD86 expression by APC Soluble CTLA-4 IDO induction
29.
© 2015 Osaka
University. All rights reserved. APC Foxp3, CTLA-4, and IL-2 in Treg-mediated suppression IL-2 IL-2R Treg Suppression Foxp3 CTLA-4 IL-2IL-2 TCR CD80/86 MHC IL-10 etc. Responder T Ono et al., Nature 2007 Onishi et al., PNAS 2008 Wing et al., Science 2008 Kitoh et al., Immunity 2009 Miyara et al., Immunity 2009 Ohkura et al., Immunity 2012 Yamaguchi et al., PNAS 2013 How are Foxp3+ Treg function and lineage stability maintained in the immune system? Bone Marrow Thymus Foxp3 Foxp3 Treg Foxp3 Treg Th1 Th2 Th17 etc., Naïve T cell CTLA-4+ CD25+ TGF- CTLA-4+ CD25+ Self antigen Tumor antigen Allo antigen
30.
© 2015 Osaka
University. All rights reserved. TGF -induced Foxp3+ iTregs are functionally and phenotypically unstable iTreg or nTreg (Thy1.1+) CD45RBhighCD4+ (Thy1.2+) Rag-/- Ohkura et al., Immunity 2012 nTreg iTreg TGF -induced Foxp3+ iTregs are functionally and phenotypically unstable Survivalrate(%) 100 50 0 10 20 30 Days iTreg+naïve T nTreg+naïve T iTreg nTreg Histology (Colon) Naïve T alone Unstable expression of Treg-associated molecules in iTregs in vivo Ohkura et al., Immunity 2012
31.
© 2015 Osaka
University. All rights reserved. Multiple factors and modifications construct a specific epigenome DNA histone chromatin chromosome DNA modification Histone modification Chromatin remodeling Epigenome Dnmt1 TET TFs Polycomb HDAC HAT HMT SWI/SNF BRG1 BAF EZH2 JHDM1 LSD1 etc. AGTTGACGTACGGCAATA AGTTGACGTACGGCAATA Me Me : DNA methylation DNA methylation heterochromatin euchromatin chromatin structures close → repressive → permissive chromatin structures open Highly heritable RNA pol II Relatively stable Linked to gene expression
32.
© 2015 Osaka
University. All rights reserved. Treg-specific DNA demethylated sites are present only in limited regions of the genome Methylated DNA immunoprecipitation (MeDIP) sequencing DNA sequencing and Annotation on the genome CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 Total methylated regions (156,743) Treg-specific DNA demethylated sites are present only in limited regions of the genome ~300 regions (0.19%) Treg-specific demethylated regions Ohkura et al., Immunity, 2012, Morikawa et al., PNAS, 2014 Treg Naïve T Foxp3
33.
© 2015 Osaka
University. All rights reserved. Detailed CpG methylation examined by bisulfite sequencing Genomic DNA CGATCCGAAACGCCCCGTTACG Bisulfite treatment CGATUCGAAACGUUUCGTTACG UGATUUGAAAUGUUUUGTTAUG Methylated DNA Unmethylated DNA Target gene Treg Naïve T Foxp3 Treg Naïve T Foxp3 Detailed CpG methylation examined by bisulfite sequencing Heat map exhibition of methylation status (%) ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ○ ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ○ ● ● ● ● ○ ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ○ ● ● ● ● ● ○ ● ● ● ● ● ● ● 1 2 3 4 5 6 7 8 9 10 11 12 ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ 1 2 3 4 5 6 7 8 9 10 11 12 n=8 CGatcCGaaaCGcccCGttaCG CpG demethylation 100%0% n=8
34.
© 2015 Osaka
University. All rights reserved. Foxp3 Cd25 Eos Ctla4 Tregs possess specific epigenetic patterns Tconv nTreg Homology Bisul Tconv nTreg MeDIP Tconv nTreg Homology Bisul Tconv nTreg MeDIP Tconv nTreg Homology Bisul Tconv nTreg MeDIP Tconv nTreg Homology Bisul Tconv nTreg MeDIP Stim Specificity and stability of Treg-type epigenetic changes The Treg-type epigenetic pattern is highly specific for natural Tregs Stim Cont Stim Cont Cont Stim Cont 24h 72h CpG demethylation 100%0% Cont iTreg Cont iTregTconv nTreg TGF- Retinoic acid Th1 Th2 Th17 Central memory Effector memory TCR stimulation induced Treg Other T cell subsets IL-2 expanded Tconv Control Tconv nTreg transduced Foxp3 Vector Tconv transduced 24h 72h
35.
© 2015 Osaka
University. All rights reserved. Treg-type epigenetic change begins in the thymus and is progressively established towards the periphery Thymus CD25 Foxp3 Spleen CD25 Foxp3 Ohkura et al., Immunity 2012 0 50 100 Thymic DP Thymic Foxp3+ Splenic Foxp3+ Foxp3 CD25 GITR CTLA-4 Eos CpGdemethylation(%) Thymic CD4SP Foxp3- Foxp3+ Splenic CD4+ T Foxp3- Foxp3+ Thymic DP CpG demethylation 100%0% CD25- CD25+ Wild-type CD25+ Scurfy Foxp3 mRNA 1.00.50 Foxp3 mRNA Foxp3 protein Foxp3 demethylation No No Yes CD25+ CD25- Scurfy Treg-type epigenetic changes occur in Scurfy mice Treg-type epigenetic change is not a consequence of Foxp3 protein expression Foxp3-null (scurfy) A frame-shift mutation of Foxp3
36.
© 2015 Osaka
University. All rights reserved. Foxp3 CD25 GITR CTLA-4 Eos Thymus Spleen Thymus GFP- GFP+ Spleen GFP- GFP+ GFP- GFP+ GFP- GFP+ (GFP-marked Treg) (GFP-marked Foxp3-null Treg) DP Thymus DP Thymus DP CpGdemethylation(%) 0 50 100 0 50 100 Thymus GFP+ Spleen GFP+ DEREG♂ DEREG/Scurfy♂ Treg-type epigenetic change is established without Foxp3 CpG demethylation 100%0% Foxp3-null TregsnTregs Ohkura et al., Immunity 2012 DP Thymus GFP+ Spleen GFP+ nTregs Foxp3-null Tregs Treg-specific DNA hypomethylated regions (TSDR) and Foxp3-binding regions are mostly different in nTreg cells Morikawa et al., PNAS 2014 Foxp3-biding regions TSDR Foxp3 CNS2
37.
© 2015 Osaka
University. All rights reserved. Foxp3 expression and Treg-type epigenetic changes together establish Treg function and phenotype nTregs Foxp3 Epigenome nTregs T cell subpopulations delineated by CD25, Foxp3, and the Treg-cell-type epigenome CD4+ Foxp3 Treg epigenome+ CD25+ Natural Treg In vivo iTreg Potential Treg Stable Treg Foxp3+ TconvIn vitro iTreg Unstable Treg-like Tconv Activated Tconv
38.
© 2015 Osaka
University. All rights reserved. FoxP3+ Treg subsets in humans Correlation between CD25 and FOXP3 expression in CD25+FoxP3+CD4+ T cells in human PBMCs FoxP3 CD45RA II I III CD25 FoxP3 CD25- I III II CD25+ CD25++ CD25+++
39.
© 2015 Osaka
University. All rights reserved. Fr. I (FoxP3loCD45RAhi) and Fr. II (FoxP3hiCD45Rlo) cells are suppressive while Fr. III (FoxP3loCD45RAlo) cells are not CFSE CD45RA CD45RA CD25 CD4+ T cells I II Foxp3 III I II III Responder alone Fr. l + Responder Fr. ll + Responder Fr. lll + Responder I IIIII FOXP3 CD45RA Miyara et al. Immunity 2009 Fr. I and Fr. II Tregs are cytokine hypo-producing, while Fr. III cells are not I II III
40.
© 2015 Osaka
University. All rights reserved. FoxP3 CD45RACTLA-4 Fr. II (Foxp3hiCD45RA-) Tregs are highly proliferative and express CTLA-4 Effector Tregs Miyara et al. Immunity 2009 I II III FoxP3 CD45RAKi-67 Naïve Tregs Differentiation and interactions among FoxP3+ subsets Proliferative Fr.I Fr.IIFr.III CD45RA FoxP3 Epigenome+ Die by apoptosis Naïve Tregs Effector Tregs Thymus CTLA-4+ CCR4+
41.
© 2015 Osaka
University. All rights reserved. Healthy donor CD45RA FOXP3 FoxP3+ subsets in normal and disease states nTreg eTreg Non Treg CD45RA FoxP3 Miyara et al. Immunity 2009 CD45RA FOXP3 Healthy donor Sarcoidosis donor Active SLE patient PBMC 0.9% 3.6% CD4 gated 3.25%43.6% CD45RA Foxp3 CD4 Foxp3 Predominant infiltration of effector Tregs into tumor tissues Treg fractions %ofCD4+Tcells Naïve Effector Naïve Effector TILPBMC Tregs: TIL 14.0%16.8% Foxp3 0.8% 37.6% CD4 gatedMelanoma Sugiyama et al., PNAS 2013 CD4 Foxp3 CD45RA Foxp3
42.
© 2015 Osaka
University. All rights reserved. Treg-targeting cancer immunotherapy without evoking autoimmunity Effector Treg depletion by anti-CCR4 plus Tumor antigen (e.g., cancer/testis antigen) vaccination Blood and lymph nodes Tumor tissue CCR4+ CTLA-4+ PD-1+ nTreg eTreg Non Treg CD45RA FoxP3 eTreg CD45RA FoxP3 Depletion of tumor-infiltrating FoxP3+ Tregs as an immunotherapy of cancer Nishikawa and Sakaguchi, Int. J. Cancer 2010 CCR4 CCL22 Treg migration Self-Ag / Tumor Ag TGF-β Tolerogenic Dendritic cell Treg expansion Suppression Tumor infiltrating macrophage Tumor cell NK NKT CTL Th
43.
© 2015 Osaka
University. All rights reserved. CCR4(MFI) PBMC CD4+ T-cell subsets 85 I II III IV Effector Tregs express CCR4, whereas naïve Tregs do not I II III IV I II III IV Sugiyama et al., PNAS 2013 CD45RA Foxp3 Cellnumber CCR4 One stone for two birds: Anti-CCR4 mAb depletes both ATLL cells and effector Tregs Pre-treatment 2nd round injection CD4 CD8CD45RA CD8 Foxp3 CD45RA ATLL patient 6.2% CD4 80.7% 1.1% 1.4% 98.5% 80.0% Foxp3 Anti-CCR4 mAb treatment
44.
© 2015 Osaka
University. All rights reserved. Anti-CCR4 mAb treatment is able to evoke in vivo anti-tumor responses in ATLL patients Sugiyama et al., PNAS, 2013. 0.24% 0.46% 0.16% 0.83% 0.51% 0.96% 33.3% 2.9% 10.7% 2.97%0.14% Pre-treatment Post-treatment IFN-γ TNF-α B*3501/NY-ESO-1 94-102Tetramer CD8 Control 0.01% NY-ESO-1 staining Small intestine (positive) Negative control Differential control of FoxP3+ subsets for immune enhancement (e.g., to evoke tumor and microbial immunity) • Reduction of Fr.II by specific mAbs or chemicals • Blockade of Treg differentiation from Fr.I to Fr.II • Blockade of cell differentiation from Fr.III to Fr.II (?) Naïve TregsFr.I Fr.IIFr.III CD45RA FoxP3 Effector Tregs Thymus Biologicals Small molecules ?
45.
© 2015 Osaka
University. All rights reserved. Differential control of FoxP3+ subsets for immune suppression (e.g., to control autoimmunity, allergy, etc.) • Antigen-specific expansion of Fr.I • Facilitation of Treg differentiation from Fr.I to Fr.II • Induction of cell differentiation from Fr.III to Fr.II (?) ? Naïve TregsFr.I Fr.IIFr.III CD45RA FoxP3 Effector Tregs Thymus Biologicals Small molecules ? CTLA-4 CCR4 Control of immune responses by Foxp3+CD25+CD4+ Tregs CD25 Autoimmune Disease Tumor Immunity Microbial infection Allergy Organ transplantation Feto-maternal tolerance Bone Marrow Thymus Foxp3 APC Teff Treg APC Teff Teff Production of Tregs Deletion
Descargar ahora