The document describes an experiment where researchers introduced point mutations into the DNA sequence of Mizm1 in a reporter plasmid. They then measured expression levels of the original and mutated plasmids when transfected into cells. The mutations reduced expression levels, suggesting the mutations decreased the ability of Mizm1 to activate transcription of the reporter gene. This is consistent with the mutations disrupting binding of proteins necessary for Mizm1's transcriptional activation function.
1 Describe and interpret the data in Figure 23 2 Bas.pdf
1. 1) Describe and interpret the data in Figure 2.3.
2) Based on the data in Figure 2.3, what is a possible effect of the mutations in the Mizm1
DNA sequence? Explain how your hypothesis is consistent with the data. (That is, explain
how your hypothesis about the effect of the mutations could explain the data.) The model
in Figure 2.3 and your answer to Question 2 will be useful for answering this question.
Figure 2.3 . The researchers created versions of the reporter plasmid with two, three, or five point
mutations in the Mizm1 sequence. Sequences are shown at the bottom of the figure. They then
repeated the experiment described for Figure 2.1 with the original two plasmids and the plasmids
with the mutant Mizm1 sequences. Mizm1: GAATTATCGGTAATCCATCGAG Mizm1mut2:
GAATTATGGGTAAACCATCGAG Mizm1mut3: GAATTATGAGTAAACCATCGAG Mizm1mut5:
GAATTAGGAGTAAAGCATCGAG
