SlideShare una empresa de Scribd logo
1 de 15
Bioinformatica e genomica comparata: nuove strategie
sperimentali e computazionali per la produzione e
analisi di dati NGS finalizzati a sviluppare processi e
prodotti innovativi per la salute dell’uomo, l’ambiente e
l’agroalimentare.
Ernesto Picardi
University of Bari
IBBE-CNR

http://www.pesolelab.it/
ernesto.picardi@uniba.it
	
  

BiP-­‐Day	
  5/12/2013	
  
Next-­‐Genera*on	
  Sequencing	
  	
  
Several NGS platforms are now available on the market, which are progressively
improved in term of throughput and cost- and time-efficiency.

Ion Proton	
  

Roche / 454 Genome
Sequencer FLX titanium
(800 bp, 800 Mb / run)

PacBio	
  

Illumina / Solexa
Genetic Analyzer HiSeq 2000
(150x2 bp, 600 Gb / run)

Applied Biosystems
SOLiD 4 SystemTM
(100x2 bp, 400 Gb / run)
Worldwide	
  distribu*on	
  of	
  NGS	
  pla;orms	
  

>2558	
  total	
  machines	
  (>1000	
  	
  US,	
  >300	
  	
  China,	
  ..,	
  >50	
  Italy)	
  
Source:	
  omicsmap.com	
  
Our	
  first	
  experience	
  

RNA-­‐Seq	
  reads:	
  
-­‐  Roche	
  454	
  (GS-­‐20):	
  >120000	
  conBgs	
  (assembled	
  reads	
  from	
  4	
  Bssues)	
  
-­‐  Illumina/Solexa:	
  >	
  200	
  M	
  reads	
  (from	
  2	
  Bssues)	
  
-­‐  SOLiD	
  :	
  >	
  320	
  M	
  reads	
  (from	
  4	
  Bssues)	
  

Jaillon	
  et	
  al.	
  2007	
  Nature	
  	
  
Available	
  compu*ng	
  facili*es	
  at	
  UNIBA/IBBE-­‐CNR	
  

HP	
  Proliant	
  Server	
  
-­‐  256	
  GB	
  RAM	
  
-­‐  40	
  cores	
  
-­‐  2	
  RAIDs	
  (24	
  +	
  36	
  TB)	
  

HP	
  Proliant	
  Server	
  
-­‐  2	
  TB	
  RAM	
  
-­‐  80	
  cores	
  
-­‐  2	
  RAIDs	
  (36	
  +	
  48	
  TB)	
  
-­‐  4	
  GPUs	
  

Tape	
  library	
  
3	
  Xserve	
  Apple	
  
-­‐  16x3	
  GB	
  RAM	
  
-­‐  RAID	
  3	
  TB	
  	
  

External	
  
Partners	
  
Available	
  NGS	
  pla;orms	
  at	
  UNIBA/IBBE	
  
Illumina	
  MiSeq	
  
-­‐  >	
  50	
  M	
  reads/run	
  
-­‐  Paired	
  2x300	
  

•  DNA sequencing (DNA-Seq)
-­‐ 	
  genome	
  resequencing	
  (SNPs,	
  CNV,	
  GWAS)	
  
-­‐ 	
  de	
  novo	
  sequencing	
  	
  
-­‐ 	
  idenBficaBon	
  of	
  genome	
  structural	
  variants	
  	
  (cancer	
  genome)	
  
-­‐ 	
  Epigenomics	
  (chromaBn	
  state	
  and	
  genome	
  methylaBon)	
  
-­‐ 	
  Metagenomics	
  (Microbiota	
  analysis	
  of	
  clinical	
  /environmental	
  samples)	
  
	
  
•  RNA sequencing (RNA-Seq)
-­‐ 	
  QualitaBve	
  and	
  quanBtaBve	
  analysis	
  of	
  the	
  Transcriptome	
  	
  
-­‐ 	
  IdenBficaBon	
  and	
  characterizaBon	
  of	
  miRNAs	
  and	
  other	
  ncRNAs	
  	
  
-­‐	
  RNA	
  ediBng	
  
-­‐ 	
  Metatrancriptomics	
  (funcBonal	
  analysis	
  of	
  environmental	
  samples)	
  

Illumina	
  HiSeq1500	
  
-­‐  >	
  300	
  GB/run	
  
-­‐  Paired	
  2x100	
  	
  
DNA	
  sequencing:	
  variant	
  analysis
	
  
ProducBon	
  of	
  DNA-­‐Seq	
  reads	
  for	
  the	
  idenBficaBon	
  of	
  SNPs	
  or	
  Indels	
  in	
  normal	
  and/or	
  
pathological	
  condiBons,	
  and	
  development	
  of	
  dedicated	
  socware.	
  

QC	
  (quality	
  control)	
  	
  
Align	
  to	
  reference	
  
genome	
  
Variant	
  (SNP	
  &	
  
INDEL)	
  calling	
  	
  

Epstein-­‐Barr	
  genotyping	
  
In	
  mulBple	
  sclerosis	
  
(30	
  samples	
  –	
  0.2	
  M	
  reads/sample	
  )	
  
A	
  “family	
  trio”	
  for	
  variants	
  linked	
  
to	
  the	
  Majewski	
  syndrome	
  –	
  like	
  
disease	
  (>260	
  M	
  reads	
  Illumina)	
  

Variant	
  annotation	
  

Functional	
  validation	
  

Somatic	
  mutations	
  in	
  human	
  
tissues	
  (3	
  donors/	
  6	
  tissues)	
  
	
  (18	
  WXSs	
  >	
  1080	
  M	
  reads	
  Illumina)	
  
DNA	
  sequencing:	
  de	
  novo	
  sequencing
	
  
Using	
  the	
  Illumina	
  MiSeq	
  plaform	
  we	
  have	
  sequenced	
  >20	
  full	
  prokaryoBc	
  genomes	
  
generaBng	
  on	
  average	
  2	
  M	
  reads	
  per	
  sample.	
  	
  
Illumina	
  MiSeq	
  Reads	
  
In	
  collaboraBon	
  with:	
  
-­‐  Doh.	
  Parisi	
  (IsBtuto	
  ZooprofillaBco)	
  
-­‐  Prof.	
  Palmieri	
  (UNIBA-­‐IBBE)	
  
-­‐  Doh.	
  Ceci	
  (IBBE)	
  
-­‐  Prof.	
  Golyshin	
  (Bangor	
  Univ.	
  UK)	
  
Read	
  Assembling	
  	
  

ConBgs	
  
DNA	
  sequencing:	
  sequencing	
  of	
  mtDNA
	
  
Assembly	
  of	
  full	
  mtDNAs	
  in	
  human	
  by	
  WXS	
  and	
  WGS	
  experiments.	
  	
  

	
  In	
  collaboraBon	
  with:	
  
Prof.	
  Akmonelli	
  

Picardi	
  and	
  Pesole	
  2012	
  Nature	
  Methods	
  	
  
DNA	
  sequencing:	
  metagenomics
	
  
Deep	
   sequencing	
   of	
   environmental	
   samples	
   to	
   funcBonally	
   characterize	
   the	
   biodiversity	
  
(no	
  need	
  for	
  laboratory	
  culBvaBon	
  and/or	
  isolaBon	
  of	
  individual	
  specimens).	
  	
  
BioMaS	
  
(BioinformaBc	
  analysis	
  of	
  Metagenomic	
  ampliconS)	
  
hhp://webgateway.ba.infn.it:9999/	
  	
  
Raw	
  Data	
  
Merged	
  and	
  Denoised	
  
Sequences	
  
Dereplicated	
  
Sequences	
  
DB	
  matching	
  

TANGO	
  
Specimen	
  
assessment	
  

In	
  collaboraBon	
  with:	
  
Prof.	
  Valiente	
  (Catalogna	
  Univ.)	
  	
  

CorrelaBon	
  between	
  Invasive	
  
Species	
  and	
  the	
  microbial	
  
composiBon	
  (>	
  15	
  M	
  reads)	
  
Microbiota	
  variaBon	
  in	
  
colorectal	
  cancer	
  
(>	
  125	
  M	
  reads)	
  
Development	
  of	
  	
  
BioinformaBc	
  tools	
  

MICROMAP
RNA	
  sequencing:	
  RNA-­‐Seq	
  analysis
	
  
Development	
  of	
  dedicated	
  computaBonal	
  tools	
  to	
  automate	
  the	
  analysis	
  of	
  RNA-­‐Seq	
  
samples.	
  

Transcriptome	
  variaBons	
  
in	
  6	
  ALS	
  samples	
  	
  
(>120	
  M	
  reads	
  Illumina/sample)	
  
Transcriptome	
  variaBons	
  
in	
  6	
  human	
  Bssues	
  	
  
(>150	
  M	
  reads	
  Illumina/sample)	
  
Transcriptome	
  variaBons	
  
in	
  Alzheimer	
  disease	
  (15	
  samples)	
  
(>150	
  M	
  reads	
  Illumina/sample)	
  
RNA	
  sequencing:	
  miRNA-­‐Seq	
  analysis
	
  
ProducBon	
  of	
  miRNA-­‐Seq	
  data	
  and	
  development	
  of	
  ad	
  hoc	
  tools	
  to	
  analyse	
  reads	
  in	
  
mulBple	
  experimental	
  condiBons.	
  

miRNA	
  expression	
  in	
  
6	
  ALS	
  samples	
  	
  
(>5	
  M	
  reads	
  Illumina/sample)	
  
miRNA	
  expression	
  
in	
  6	
  human	
  Bssues	
  	
  
(>5	
  M	
  reads	
  Illumina/sample)	
  
miRNA	
  expression	
  in	
  
	
  aging	
  and	
  Alzheimer	
  disease	
  
(15	
  samples)	
  (>3	
  M	
  reads	
  sample)	
  

Dr	
  David	
  Horner	
  
RNA	
  sequencing:	
  RNA	
  edi*ng
	
  
Development	
  of	
  the	
  first	
  toolkit	
  to	
  detect	
  RNA	
  ediBng	
  by	
  massive	
  sequencing	
  data	
  
(RNA-­‐Seq,	
  DNA-­‐Seq	
  and	
  miRNA-­‐Seq).	
  

Picardi and Pesole 2013 Bioinformatics
r1
r2
r3
r4
r5

r1
r2
r3
r4
r5

GGGTGCCTTTATGCAGCAAGGATGCGATATT!
GGGTGTCTTTATGCAGCAAGGATGCGATACTTCGC!
GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG!
GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG!
GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG!
..............A.....................!
TGGGTGCCTTTATGCAGCAAGGATGCGATATTTCGCC gDNA!
..............G.....................!
GGGTGCCTTTATGCGGCAAGGATGCGATATT!
GGGTGTCTTTATGCAGCAAGGATGCGATACTTCGC!
GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG!
GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG!
GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG!

RNA	
  ediBng	
  in	
  ALS	
  
(RNA-­‐Seq:	
  >120	
  M	
  reads/sample	
  
WXS:	
  >	
  30	
  M	
  reads/sample)	
  
RNA	
  ediBng	
  in	
  human	
  Bssues	
  
(RNA-­‐Seq:	
  >120	
  M	
  reads/sample	
  
WGS:	
  >	
  300	
  M	
  reads/sample)	
  
RNA	
  ediBng	
  in	
  Alzheimer	
  disease	
  
Fluidigm	
  tech.	
  and	
  Illumina	
  Seq.	
  
(>2000x	
  per	
  ediBng	
  candidate)	
  

Italy – Israel Actions
Other	
  NGS-­‐related	
  experiences
	
  
-­‐	
  Gene	
  expression	
  in	
  collaboraBon	
  
with	
  Prof.	
  Giorgino	
  (UNIBA)	
  

-­‐	
  Gene/exon	
  expression	
  in	
  renal	
  
carcinoma	
  

OMNIA	
  LH75	
  

Automated	
  qPCR	
  for	
  
validaBon	
  of	
  molecular	
  
biomarkers	
  
Acknowledgments	
  	
  

PRIN2009	
  
PRIN2010	
  
PRIN2013	
  

MICROMAP

CNR-­‐Aging	
  program	
  

http://www.arisla.org/

http://www.epigen.it/

Italy – Israel Actions

Más contenido relacionado

La actualidad más candente

Aug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansAug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansGenomeInABottle
 
Bioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisBioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisDespoina Kalfakakou
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...QBiC_Tue
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsGolden Helix Inc
 
Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014LutzFr
 
Emergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciencesEmergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalscienceskarenbbs
 
Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...
Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...
Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...Thermo Fisher Scientific
 
Next-generation genomics: an integrative approach
Next-generation genomics: an integrative approachNext-generation genomics: an integrative approach
Next-generation genomics: an integrative approachHong ChangBum
 
20170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_10120170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_101Ino de Bruijn
 
Digital DNA-seq Technology: Targeted Enrichment for Cancer Research
Digital DNA-seq Technology: Targeted Enrichment for Cancer ResearchDigital DNA-seq Technology: Targeted Enrichment for Cancer Research
Digital DNA-seq Technology: Targeted Enrichment for Cancer ResearchQIAGEN
 
DNA Sequencing from Single Cell
DNA Sequencing from Single CellDNA Sequencing from Single Cell
DNA Sequencing from Single CellQIAGEN
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencingDayananda Salam
 
overview on Next generation sequencing in breast csncer
overview on Next generation sequencing in breast csnceroverview on Next generation sequencing in breast csncer
overview on Next generation sequencing in breast csncerSeham Al-Shehri
 
Sequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TMSequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TMThermo Fisher Scientific
 
New Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overviewNew Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overviewPaolo Dametto
 
A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...Alexander Jueterbock
 
Understanding and controlling for sample and platform biases in NGS assays
Understanding and controlling for sample and platform biases in NGS assaysUnderstanding and controlling for sample and platform biases in NGS assays
Understanding and controlling for sample and platform biases in NGS assaysCandy Smellie
 

La actualidad más candente (20)

T-bioinfo overview
T-bioinfo overviewT-bioinfo overview
T-bioinfo overview
 
Aug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plansAug2014 abrf interlaboratory study plans
Aug2014 abrf interlaboratory study plans
 
Bioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysisBioinformatics tools for NGS data analysis
Bioinformatics tools for NGS data analysis
 
Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...Data Management for Quantitative Biology - Data sources (Next generation tech...
Data Management for Quantitative Biology - Data sources (Next generation tech...
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and Variants
 
Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014Bioinformatics workshop Sept 2014
Bioinformatics workshop Sept 2014
 
Emergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciencesEmergingroleo fmi rnainmedicalsciences
Emergingroleo fmi rnainmedicalsciences
 
Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...
Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...
Speeding up sequencing: Sequencing in an hour enables sample to answer in a w...
 
Next-generation genomics: an integrative approach
Next-generation genomics: an integrative approachNext-generation genomics: an integrative approach
Next-generation genomics: an integrative approach
 
20170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_10120170209 ngs for_cancer_genomics_101
20170209 ngs for_cancer_genomics_101
 
Digital DNA-seq Technology: Targeted Enrichment for Cancer Research
Digital DNA-seq Technology: Targeted Enrichment for Cancer ResearchDigital DNA-seq Technology: Targeted Enrichment for Cancer Research
Digital DNA-seq Technology: Targeted Enrichment for Cancer Research
 
DNA Sequencing from Single Cell
DNA Sequencing from Single CellDNA Sequencing from Single Cell
DNA Sequencing from Single Cell
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
Clinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation SequencingClinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation Sequencing
 
overview on Next generation sequencing in breast csncer
overview on Next generation sequencing in breast csnceroverview on Next generation sequencing in breast csncer
overview on Next generation sequencing in breast csncer
 
Sequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TMSequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TM
 
NGS and the molecular basis of disease: a practical view
NGS and the molecular basis of disease: a practical viewNGS and the molecular basis of disease: a practical view
NGS and the molecular basis of disease: a practical view
 
New Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overviewNew Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overview
 
A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...A decade into Next Generation Sequencing on marine non-model organisms: curre...
A decade into Next Generation Sequencing on marine non-model organisms: curre...
 
Understanding and controlling for sample and platform biases in NGS assays
Understanding and controlling for sample and platform biases in NGS assaysUnderstanding and controlling for sample and platform biases in NGS assays
Understanding and controlling for sample and platform biases in NGS assays
 

Destacado

Practical Guide to the $1000 Genome (2014)
Practical Guide to the $1000 Genome (2014)Practical Guide to the $1000 Genome (2014)
Practical Guide to the $1000 Genome (2014)AllSeq
 
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.mkim8
 
NGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsNGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsAnnelies Haegeman
 
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...VHIR Vall d’Hebron Institut de Recerca
 
NGx Sequencing 101-platforms
NGx Sequencing 101-platformsNGx Sequencing 101-platforms
NGx Sequencing 101-platformsAllSeq
 
Illumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencingIllumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencingCristian Cosentino, PhD
 
Next-generation sequencing from 2005 to 2020
Next-generation sequencing from 2005 to 2020Next-generation sequencing from 2005 to 2020
Next-generation sequencing from 2005 to 2020Christian Frech
 
Operating Systems - File Management
Operating Systems -  File ManagementOperating Systems -  File Management
Operating Systems - File ManagementDamian T. Gordon
 
The Application of Next Generation Sequencing (NGS) in cancer treatment
The Application of Next Generation Sequencing (NGS) in cancer treatmentThe Application of Next Generation Sequencing (NGS) in cancer treatment
The Application of Next Generation Sequencing (NGS) in cancer treatmentPremadarshini Sai
 
The Ultimate Guide to Creating Visually Appealing Content
The Ultimate Guide to Creating Visually Appealing ContentThe Ultimate Guide to Creating Visually Appealing Content
The Ultimate Guide to Creating Visually Appealing ContentNeil Patel
 
Dear NSA, let me take care of your slides.
Dear NSA, let me take care of your slides.Dear NSA, let me take care of your slides.
Dear NSA, let me take care of your slides.Emiland
 
What I Carry: 10 Tools for Success
What I Carry: 10 Tools for SuccessWhat I Carry: 10 Tools for Success
What I Carry: 10 Tools for SuccessJonathon Colman
 
Learning c - An extensive guide to learn the C Language
Learning c - An extensive guide to learn the C LanguageLearning c - An extensive guide to learn the C Language
Learning c - An extensive guide to learn the C LanguageAbhishek Dwivedi
 
What Makes Great Infographics
What Makes Great InfographicsWhat Makes Great Infographics
What Makes Great InfographicsSlideShare
 
Masters of SlideShare
Masters of SlideShareMasters of SlideShare
Masters of SlideShareKapost
 

Destacado (20)

Practical Guide to the $1000 Genome (2014)
Practical Guide to the $1000 Genome (2014)Practical Guide to the $1000 Genome (2014)
Practical Guide to the $1000 Genome (2014)
 
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.
 
Introduction to next generation sequencing
Introduction to next generation sequencingIntroduction to next generation sequencing
Introduction to next generation sequencing
 
NGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsNGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platforms
 
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
NGS Applications I (UEB-UAT Bioinformatics Course - Session 2.1.2 - VHIR, Bar...
 
NGx Sequencing 101-platforms
NGx Sequencing 101-platformsNGx Sequencing 101-platforms
NGx Sequencing 101-platforms
 
Illumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencingIllumina GAIIx for high throughput sequencing
Illumina GAIIx for high throughput sequencing
 
Next-generation sequencing from 2005 to 2020
Next-generation sequencing from 2005 to 2020Next-generation sequencing from 2005 to 2020
Next-generation sequencing from 2005 to 2020
 
WCM (World Class Manufacturing)
WCM (World Class Manufacturing)WCM (World Class Manufacturing)
WCM (World Class Manufacturing)
 
Operating Systems - File Management
Operating Systems -  File ManagementOperating Systems -  File Management
Operating Systems - File Management
 
The Application of Next Generation Sequencing (NGS) in cancer treatment
The Application of Next Generation Sequencing (NGS) in cancer treatmentThe Application of Next Generation Sequencing (NGS) in cancer treatment
The Application of Next Generation Sequencing (NGS) in cancer treatment
 
Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS
Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGSCurso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS
Curso de Genómica - UAT (VHIR) 2012 - Análisis de datos de NGS
 
The Ultimate Guide to Creating Visually Appealing Content
The Ultimate Guide to Creating Visually Appealing ContentThe Ultimate Guide to Creating Visually Appealing Content
The Ultimate Guide to Creating Visually Appealing Content
 
Ngs intro_v6_public
 Ngs intro_v6_public Ngs intro_v6_public
Ngs intro_v6_public
 
Dear NSA, let me take care of your slides.
Dear NSA, let me take care of your slides.Dear NSA, let me take care of your slides.
Dear NSA, let me take care of your slides.
 
What I Carry: 10 Tools for Success
What I Carry: 10 Tools for SuccessWhat I Carry: 10 Tools for Success
What I Carry: 10 Tools for Success
 
My Heroes
My HeroesMy Heroes
My Heroes
 
Learning c - An extensive guide to learn the C Language
Learning c - An extensive guide to learn the C LanguageLearning c - An extensive guide to learn the C Language
Learning c - An extensive guide to learn the C Language
 
What Makes Great Infographics
What Makes Great InfographicsWhat Makes Great Infographics
What Makes Great Infographics
 
Masters of SlideShare
Masters of SlideShareMasters of SlideShare
Masters of SlideShare
 

Similar a Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimen

Microarrays;application
Microarrays;applicationMicroarrays;application
Microarrays;applicationFyzah Bashir
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochureAffymetrix
 
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...VHIR Vall d’Hebron Institut de Recerca
 
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...Integrated DNA Technologies
 
132 gene expression in atherosclerotic plaques
132 gene expression in atherosclerotic plaques132 gene expression in atherosclerotic plaques
132 gene expression in atherosclerotic plaquesSHAPE Society
 
Comparison between RNASeq and Microarray for Gene Expression Analysis
Comparison between RNASeq and Microarray for Gene Expression AnalysisComparison between RNASeq and Microarray for Gene Expression Analysis
Comparison between RNASeq and Microarray for Gene Expression AnalysisYaoyu Wang
 
Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013
Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013
Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013Functional Genomics Data Society
 
Impact_of_gene_length_on_DEG
Impact_of_gene_length_on_DEGImpact_of_gene_length_on_DEG
Impact_of_gene_length_on_DEGLong Pei
 
NAISTビッグデータシンポジウム - バイオ久保先生
NAISTビッグデータシンポジウム - バイオ久保先生NAISTビッグデータシンポジウム - バイオ久保先生
NAISTビッグデータシンポジウム - バイオ久保先生ysuzuki-naist
 
Microarry andd NGS.pdf
Microarry andd NGS.pdfMicroarry andd NGS.pdf
Microarry andd NGS.pdfnedalalazzwy
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation SequencingAamir Wahab
 
Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...
Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...
Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...Pilar Mozas
 
Cmb2003 lecture 12 2013
Cmb2003 lecture 12 2013Cmb2003 lecture 12 2013
Cmb2003 lecture 12 2013Ben Mitchel
 

Similar a Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimen (20)

Microarrays;application
Microarrays;applicationMicroarrays;application
Microarrays;application
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochure
 
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
NGS Applications II (UEB-UAT Bioinformatics Course - Session 2.1.3 - VHIR, Ba...
 
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
Characterizing Alzheimer’s Disease candidate genes and transcripts with targe...
 
132 gene expression in atherosclerotic plaques
132 gene expression in atherosclerotic plaques132 gene expression in atherosclerotic plaques
132 gene expression in atherosclerotic plaques
 
132 gene expression in atherosclerotic plaques
132 gene expression in atherosclerotic plaques132 gene expression in atherosclerotic plaques
132 gene expression in atherosclerotic plaques
 
Micro array study for gene expression in vp
Micro array study for gene expression in vpMicro array study for gene expression in vp
Micro array study for gene expression in vp
 
RNA-seq Analysis
RNA-seq AnalysisRNA-seq Analysis
RNA-seq Analysis
 
Comparison between RNASeq and Microarray for Gene Expression Analysis
Comparison between RNASeq and Microarray for Gene Expression AnalysisComparison between RNASeq and Microarray for Gene Expression Analysis
Comparison between RNASeq and Microarray for Gene Expression Analysis
 
Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013
Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013
Alvis Brazma, Array Express Gene Expression Atlas, fged_seattle_2013
 
Impact_of_gene_length_on_DEG
Impact_of_gene_length_on_DEGImpact_of_gene_length_on_DEG
Impact_of_gene_length_on_DEG
 
NAISTビッグデータシンポジウム - バイオ久保先生
NAISTビッグデータシンポジウム - バイオ久保先生NAISTビッグデータシンポジウム - バイオ久保先生
NAISTビッグデータシンポジウム - バイオ久保先生
 
SNp mining in crops
SNp mining in cropsSNp mining in crops
SNp mining in crops
 
Microarry andd NGS.pdf
Microarry andd NGS.pdfMicroarry andd NGS.pdf
Microarry andd NGS.pdf
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
Jan2016 pac bio giab
Jan2016 pac bio giabJan2016 pac bio giab
Jan2016 pac bio giab
 
Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...
Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...
Sequencing and functional genomics Unit_Biomedical Research Center of Aragon_...
 
MGG2003-cDNA-AFLP
MGG2003-cDNA-AFLPMGG2003-cDNA-AFLP
MGG2003-cDNA-AFLP
 
Cmb2003 lecture 12 2013
Cmb2003 lecture 12 2013Cmb2003 lecture 12 2013
Cmb2003 lecture 12 2013
 
Epigenetics 2013
Epigenetics 2013Epigenetics 2013
Epigenetics 2013
 

Más de eventi-ITBbari

BiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario SaverioBiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario Saverioeventi-ITBbari
 
BiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano AngelicaBiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano Angelicaeventi-ITBbari
 
BiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole GrazianoBiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole Grazianoeventi-ITBbari
 
BiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola MariangelaBiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola Mariangelaeventi-ITBbari
 
BiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo PasqualeBiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo Pasqualeeventi-ITBbari
 
BiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito GiacintoBiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito Giacintoeventi-ITBbari
 
BiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta RitaBiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta Ritaeventi-ITBbari
 
BiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci MichelangeloBiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci Michelangeloeventi-ITBbari
 
BiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima RosannaBiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima Rosannaeventi-ITBbari
 
BiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza TeresaBiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza Teresaeventi-ITBbari
 
IBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy
IBM Italia, Bari – La Bioinformatica nelle prospettive della BioeconomyIBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy
IBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomyeventi-ITBbari
 
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...eventi-ITBbari
 
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...eventi-ITBbari
 
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...eventi-ITBbari
 
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems MedicineNicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicineeventi-ITBbari
 
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...eventi-ITBbari
 
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...eventi-ITBbari
 
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...eventi-ITBbari
 
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...eventi-ITBbari
 
Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”eventi-ITBbari
 

Más de eventi-ITBbari (20)

BiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario SaverioBiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario Saverio
 
BiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano AngelicaBiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano Angelica
 
BiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole GrazianoBiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole Graziano
 
BiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola MariangelaBiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola Mariangela
 
BiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo PasqualeBiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo Pasquale
 
BiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito GiacintoBiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito Giacinto
 
BiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta RitaBiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta Rita
 
BiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci MichelangeloBiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci Michelangelo
 
BiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima RosannaBiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima Rosanna
 
BiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza TeresaBiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza Teresa
 
IBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy
IBM Italia, Bari – La Bioinformatica nelle prospettive della BioeconomyIBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy
IBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy
 
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
 
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
 
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
 
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems MedicineNicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
 
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
 
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
 
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
 
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
 
Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”
 

Último

Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...aartirawatdelhi
 
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Dipal Arora
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...parulsinha
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...astropune
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...narwatsonia7
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...narwatsonia7
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...vidya singh
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...perfect solution
 
Call Girls Haridwar Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Haridwar Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Haridwar Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Haridwar Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...narwatsonia7
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 

Último (20)

Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
 
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Nagpur Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
Call Girls Bhubaneswar Just Call 9907093804 Top Class Call Girl Service Avail...
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟  9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...Top Rated Bangalore Call Girls Mg Road ⟟   9332606886 ⟟ Call Me For Genuine S...
Top Rated Bangalore Call Girls Mg Road ⟟ 9332606886 ⟟ Call Me For Genuine S...
 
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
Manyata Tech Park ( Call Girls ) Bangalore ✔ 6297143586 ✔ Hot Model With Sexy...
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
 
Call Girls Haridwar Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Haridwar Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Haridwar Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Haridwar Just Call 9907093804 Top Class Call Girl Service Available
 
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...Top Rated Bangalore Call Girls Richmond Circle ⟟  9332606886 ⟟ Call Me For Ge...
Top Rated Bangalore Call Girls Richmond Circle ⟟ 9332606886 ⟟ Call Me For Ge...
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bangalore Just Call 9907093804 Top Class Call Girl Service Available
 

Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimen

  • 1. Bioinformatica e genomica comparata: nuove strategie sperimentali e computazionali per la produzione e analisi di dati NGS finalizzati a sviluppare processi e prodotti innovativi per la salute dell’uomo, l’ambiente e l’agroalimentare. Ernesto Picardi University of Bari IBBE-CNR http://www.pesolelab.it/ ernesto.picardi@uniba.it   BiP-­‐Day  5/12/2013  
  • 2. Next-­‐Genera*on  Sequencing     Several NGS platforms are now available on the market, which are progressively improved in term of throughput and cost- and time-efficiency. Ion Proton   Roche / 454 Genome Sequencer FLX titanium (800 bp, 800 Mb / run) PacBio   Illumina / Solexa Genetic Analyzer HiSeq 2000 (150x2 bp, 600 Gb / run) Applied Biosystems SOLiD 4 SystemTM (100x2 bp, 400 Gb / run)
  • 3. Worldwide  distribu*on  of  NGS  pla;orms   >2558  total  machines  (>1000    US,  >300    China,  ..,  >50  Italy)   Source:  omicsmap.com  
  • 4. Our  first  experience   RNA-­‐Seq  reads:   -­‐  Roche  454  (GS-­‐20):  >120000  conBgs  (assembled  reads  from  4  Bssues)   -­‐  Illumina/Solexa:  >  200  M  reads  (from  2  Bssues)   -­‐  SOLiD  :  >  320  M  reads  (from  4  Bssues)   Jaillon  et  al.  2007  Nature    
  • 5. Available  compu*ng  facili*es  at  UNIBA/IBBE-­‐CNR   HP  Proliant  Server   -­‐  256  GB  RAM   -­‐  40  cores   -­‐  2  RAIDs  (24  +  36  TB)   HP  Proliant  Server   -­‐  2  TB  RAM   -­‐  80  cores   -­‐  2  RAIDs  (36  +  48  TB)   -­‐  4  GPUs   Tape  library   3  Xserve  Apple   -­‐  16x3  GB  RAM   -­‐  RAID  3  TB     External   Partners  
  • 6. Available  NGS  pla;orms  at  UNIBA/IBBE   Illumina  MiSeq   -­‐  >  50  M  reads/run   -­‐  Paired  2x300   •  DNA sequencing (DNA-Seq) -­‐   genome  resequencing  (SNPs,  CNV,  GWAS)   -­‐   de  novo  sequencing     -­‐   idenBficaBon  of  genome  structural  variants    (cancer  genome)   -­‐   Epigenomics  (chromaBn  state  and  genome  methylaBon)   -­‐   Metagenomics  (Microbiota  analysis  of  clinical  /environmental  samples)     •  RNA sequencing (RNA-Seq) -­‐   QualitaBve  and  quanBtaBve  analysis  of  the  Transcriptome     -­‐   IdenBficaBon  and  characterizaBon  of  miRNAs  and  other  ncRNAs     -­‐  RNA  ediBng   -­‐   Metatrancriptomics  (funcBonal  analysis  of  environmental  samples)   Illumina  HiSeq1500   -­‐  >  300  GB/run   -­‐  Paired  2x100    
  • 7. DNA  sequencing:  variant  analysis   ProducBon  of  DNA-­‐Seq  reads  for  the  idenBficaBon  of  SNPs  or  Indels  in  normal  and/or   pathological  condiBons,  and  development  of  dedicated  socware.   QC  (quality  control)     Align  to  reference   genome   Variant  (SNP  &   INDEL)  calling     Epstein-­‐Barr  genotyping   In  mulBple  sclerosis   (30  samples  –  0.2  M  reads/sample  )   A  “family  trio”  for  variants  linked   to  the  Majewski  syndrome  –  like   disease  (>260  M  reads  Illumina)   Variant  annotation   Functional  validation   Somatic  mutations  in  human   tissues  (3  donors/  6  tissues)    (18  WXSs  >  1080  M  reads  Illumina)  
  • 8. DNA  sequencing:  de  novo  sequencing   Using  the  Illumina  MiSeq  plaform  we  have  sequenced  >20  full  prokaryoBc  genomes   generaBng  on  average  2  M  reads  per  sample.     Illumina  MiSeq  Reads   In  collaboraBon  with:   -­‐  Doh.  Parisi  (IsBtuto  ZooprofillaBco)   -­‐  Prof.  Palmieri  (UNIBA-­‐IBBE)   -­‐  Doh.  Ceci  (IBBE)   -­‐  Prof.  Golyshin  (Bangor  Univ.  UK)   Read  Assembling     ConBgs  
  • 9. DNA  sequencing:  sequencing  of  mtDNA   Assembly  of  full  mtDNAs  in  human  by  WXS  and  WGS  experiments.      In  collaboraBon  with:   Prof.  Akmonelli   Picardi  and  Pesole  2012  Nature  Methods    
  • 10. DNA  sequencing:  metagenomics   Deep   sequencing   of   environmental   samples   to   funcBonally   characterize   the   biodiversity   (no  need  for  laboratory  culBvaBon  and/or  isolaBon  of  individual  specimens).     BioMaS   (BioinformaBc  analysis  of  Metagenomic  ampliconS)   hhp://webgateway.ba.infn.it:9999/     Raw  Data   Merged  and  Denoised   Sequences   Dereplicated   Sequences   DB  matching   TANGO   Specimen   assessment   In  collaboraBon  with:   Prof.  Valiente  (Catalogna  Univ.)     CorrelaBon  between  Invasive   Species  and  the  microbial   composiBon  (>  15  M  reads)   Microbiota  variaBon  in   colorectal  cancer   (>  125  M  reads)   Development  of     BioinformaBc  tools   MICROMAP
  • 11. RNA  sequencing:  RNA-­‐Seq  analysis   Development  of  dedicated  computaBonal  tools  to  automate  the  analysis  of  RNA-­‐Seq   samples.   Transcriptome  variaBons   in  6  ALS  samples     (>120  M  reads  Illumina/sample)   Transcriptome  variaBons   in  6  human  Bssues     (>150  M  reads  Illumina/sample)   Transcriptome  variaBons   in  Alzheimer  disease  (15  samples)   (>150  M  reads  Illumina/sample)  
  • 12. RNA  sequencing:  miRNA-­‐Seq  analysis   ProducBon  of  miRNA-­‐Seq  data  and  development  of  ad  hoc  tools  to  analyse  reads  in   mulBple  experimental  condiBons.   miRNA  expression  in   6  ALS  samples     (>5  M  reads  Illumina/sample)   miRNA  expression   in  6  human  Bssues     (>5  M  reads  Illumina/sample)   miRNA  expression  in    aging  and  Alzheimer  disease   (15  samples)  (>3  M  reads  sample)   Dr  David  Horner  
  • 13. RNA  sequencing:  RNA  edi*ng   Development  of  the  first  toolkit  to  detect  RNA  ediBng  by  massive  sequencing  data   (RNA-­‐Seq,  DNA-­‐Seq  and  miRNA-­‐Seq).   Picardi and Pesole 2013 Bioinformatics r1 r2 r3 r4 r5 r1 r2 r3 r4 r5 GGGTGCCTTTATGCAGCAAGGATGCGATATT! GGGTGTCTTTATGCAGCAAGGATGCGATACTTCGC! GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCAGCAAGGATGCGATATTTCG! ..............A.....................! TGGGTGCCTTTATGCAGCAAGGATGCGATATTTCGCC gDNA! ..............G.....................! GGGTGCCTTTATGCGGCAAGGATGCGATATT! GGGTGTCTTTATGCAGCAAGGATGCGATACTTCGC! GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG! GGGTGCCTTTATGCGGCAAGGATGCGATATTTCG! RNA  ediBng  in  ALS   (RNA-­‐Seq:  >120  M  reads/sample   WXS:  >  30  M  reads/sample)   RNA  ediBng  in  human  Bssues   (RNA-­‐Seq:  >120  M  reads/sample   WGS:  >  300  M  reads/sample)   RNA  ediBng  in  Alzheimer  disease   Fluidigm  tech.  and  Illumina  Seq.   (>2000x  per  ediBng  candidate)   Italy – Israel Actions
  • 14. Other  NGS-­‐related  experiences   -­‐  Gene  expression  in  collaboraBon   with  Prof.  Giorgino  (UNIBA)   -­‐  Gene/exon  expression  in  renal   carcinoma   OMNIA  LH75   Automated  qPCR  for   validaBon  of  molecular   biomarkers  
  • 15. Acknowledgments     PRIN2009   PRIN2010   PRIN2013   MICROMAP CNR-­‐Aging  program   http://www.arisla.org/ http://www.epigen.it/ Italy – Israel Actions