SlideShare una empresa de Scribd logo
1 de 13
Identification of a possible tumor suppressor microRNA in leukemia Kara A. Scheibner, PhD Center for Stem Cell Biology and Regenerative Medicine October 2, 2009 Experimental Therapeutics Retreat
Lab Objectives ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
microRNAs ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
MicroRNA regulation (and deregulation) of hematopoiesis miR-17-92 cluster: expression decreases during monocyte development; highly expressed in pre B and T precursor cells and decreases after maturation miR-146: drives naïve T cells to become T1 helper cells over Th2 cells miR-223: expressed specifically in the granulocyte lineage; decreases as cells move from MEPs to erythrocytes miR-221/222: downregulated during erythropoiesis (Modified from Baltimore et al, 2008)
[object Object],[object Object],[object Object],MicroRNAs expressed in HSPCs Georgantas et al 2007 74 miRs expressed in CD34 +  BM 35 miRs expressed in CD34 +  mobilized blood 32 3 42
[object Object],[object Object],miR-27a, its cluster members, and paraglogs miR-23b miR-27b miR-24-1 C9orf3 FANCC TSS (-31Kb) Human chromosome 9q22.32 (9:96,742,096-97,033,095) (290999 bp) UUCACAGUGGCUAAGUUC U GC AUCACAUUGCCAGGGAUU A CC UGGCUCAGUUCAGCAGGAAACAG   miR-23a miR-27a miR-24-2 ZSWIM4 NANOS3 C19orf57 Human chromosome 19p13.2 (19:13,769,268-13,875,567) (106,299 bp) TSS (-400-600bp) UUCACAGUGGCUAAGUUCCGC AUCACAUUGCCAGGGAUUUCC UGGCUCAGUUCAGCAGGAAACAG  miR-181C miR-181D
Low expression levels of miR-27a in leukemia cells compared to HSPCs…….a hint? miRNA microarray data qRT-PCR data Does the fact that miR-27a expression is low or absent in multiple leukemia cell lines and patient samples mean anything in the etiology of the disease? 0 0.2 0.4 0.6 0.8 1 1.2 1.4 RQ value (normalized to CD34+ cells) CD34+ K562 TF-1 KOPN8 HEK293T ALL #1 ALL #2 miR-23a miR-23b miR-27a miR-27b 34,913 TF1 47,337 REH 38,099 K562 113,257 CD34+ (HSPCs) miR-27a expression Cell type
miR-27a as a tumor suppressor miRNA Decreased cell growth Increased death by apoptosis Increased cell death Altered cell cycle profile 0 50000 100000 150000 200000 250000 300000 350000 400000 450000 0 1 2 3 4 5 6 7 Days Cell number K562 FUGW miR-27 #1 miR-27 #5 miR-27 #6 miR-27 #11 0 5 10 15 20 25 30 35 40 Control #9 miR-27a #3 % total cell death Experiment 1 Experiment 2 0 5 10 15 20 25 30 35 % annexinV+/7AAD- GFP- Control #10 miR-27a #3 mirR-27a #4 miR-27a #7 0 10 20 30 40 50 60 70 80 G1 S G2 % cells GFP- miR-27a #1 miR-27a #2 miR-27a #3 miR-27a #4 miR-27a #5 miR-27a #6
Target genes ,[object Object],[object Object],[object Object],[object Object],[object Object],921 conserved targets, with a total of 1004 conserved sites and 362 poorly conserved sites. Human | miR-27ab
miR-27a binds in vitro to its predicted site in the 3’UTR of YWHAQ ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],0 2 4 6 8 10 12 14 16 18 20 pcDNA-Luc YWHAQ-27a YWHAQ-27a + miR-27a normalized luciferase counts HEK293T cells ,[object Object],[object Object],[object Object]
Other miR-27a predicted targets Wnt/ β -catenin pathway Wnt3a 3’UTR Wnt3a Frizzled 4/7 Dishevelled 2 LRP6
How could this in vitro data be relevant in a clinical setting? ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Need for clinical and non-clinical samples ,[object Object],[object Object]

Más contenido relacionado

La actualidad más candente

MiRaGE: Inference of gene expression regulation via microRNA transfection II
MiRaGE: Inference of gene expression regulation via microRNA transfection IIMiRaGE: Inference of gene expression regulation via microRNA transfection II
MiRaGE: Inference of gene expression regulation via microRNA transfection II
Y-h Taguchi
 
Poster_PCR_2016-2
Poster_PCR_2016-2Poster_PCR_2016-2
Poster_PCR_2016-2
Shefali Das
 
FLT3 INHIBITORS
FLT3 INHIBITORSFLT3 INHIBITORS
FLT3 INHIBITORS
spa718
 
An gef mi_scriptffpe
An gef mi_scriptffpeAn gef mi_scriptffpe
An gef mi_scriptffpe
Elsa von Licy
 
1-s2.0-S2211124714001612-main
1-s2.0-S2211124714001612-main1-s2.0-S2211124714001612-main
1-s2.0-S2211124714001612-main
Anirudh Prahallad
 

La actualidad más candente (19)

Lepow Day Poster 2
Lepow Day Poster 2Lepow Day Poster 2
Lepow Day Poster 2
 
microRNA discovery and biomarker development in clinical samples
microRNA discovery and biomarker development in clinical samplesmicroRNA discovery and biomarker development in clinical samples
microRNA discovery and biomarker development in clinical samples
 
miRNA and Diabetes
miRNA and DiabetesmiRNA and Diabetes
miRNA and Diabetes
 
Breast Cancer research paper
Breast Cancer research paperBreast Cancer research paper
Breast Cancer research paper
 
MiRaGE: Inference of gene expression regulation via microRNA transfection II
MiRaGE: Inference of gene expression regulation via microRNA transfection IIMiRaGE: Inference of gene expression regulation via microRNA transfection II
MiRaGE: Inference of gene expression regulation via microRNA transfection II
 
Identification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hivIdentification and characterization of micro rn as expressed in hiv
Identification and characterization of micro rn as expressed in hiv
 
Poster_PCR_2016-2
Poster_PCR_2016-2Poster_PCR_2016-2
Poster_PCR_2016-2
 
My PhD Thesis seminar - April 2007
My PhD Thesis seminar - April 2007My PhD Thesis seminar - April 2007
My PhD Thesis seminar - April 2007
 
CH_BBM Poster 2014
CH_BBM Poster 2014CH_BBM Poster 2014
CH_BBM Poster 2014
 
FLT3 INHIBITORS
FLT3 INHIBITORSFLT3 INHIBITORS
FLT3 INHIBITORS
 
Oncotarget
OncotargetOncotarget
Oncotarget
 
Artesunate improves drug resistance of lung carcinomas via regulation of mi r...
Artesunate improves drug resistance of lung carcinomas via regulation of mi r...Artesunate improves drug resistance of lung carcinomas via regulation of mi r...
Artesunate improves drug resistance of lung carcinomas via regulation of mi r...
 
journal.pbio.2000998
journal.pbio.2000998journal.pbio.2000998
journal.pbio.2000998
 
Methyl flyer lo
Methyl flyer loMethyl flyer lo
Methyl flyer lo
 
BRECIS SITC conference 2015_Julie Decock
BRECIS SITC conference 2015_Julie DecockBRECIS SITC conference 2015_Julie Decock
BRECIS SITC conference 2015_Julie Decock
 
Cis-regulatory somatic mutations and gene-expression alteration in B-cell lym...
Cis-regulatory somatic mutations and gene-expression alteration in B-cell lym...Cis-regulatory somatic mutations and gene-expression alteration in B-cell lym...
Cis-regulatory somatic mutations and gene-expression alteration in B-cell lym...
 
An gef mi_scriptffpe
An gef mi_scriptffpeAn gef mi_scriptffpe
An gef mi_scriptffpe
 
Lnc rna neat1 is involved in temozolomide resistance by regulating mgmt in gl...
Lnc rna neat1 is involved in temozolomide resistance by regulating mgmt in gl...Lnc rna neat1 is involved in temozolomide resistance by regulating mgmt in gl...
Lnc rna neat1 is involved in temozolomide resistance by regulating mgmt in gl...
 
1-s2.0-S2211124714001612-main
1-s2.0-S2211124714001612-main1-s2.0-S2211124714001612-main
1-s2.0-S2211124714001612-main
 

Destacado

Making new moves in education&learning
Making new moves in education&learningMaking new moves in education&learning
Making new moves in education&learning
Austeja Zvaginyte
 

Destacado (17)

7. phi̇losopher catagory temsonhae
7. phi̇losopher  catagory  temsonhae7. phi̇losopher  catagory  temsonhae
7. phi̇losopher catagory temsonhae
 
Making new moves in education&learning
Making new moves in education&learningMaking new moves in education&learning
Making new moves in education&learning
 
Test
TestTest
Test
 
A Strategic Response to MOOCs: What Role Should Governments Play?
A Strategic Response to MOOCs: What Role Should Governments Play? A Strategic Response to MOOCs: What Role Should Governments Play?
A Strategic Response to MOOCs: What Role Should Governments Play?
 
Shu
ShuShu
Shu
 
The Perils of Fish Farming
The Perils of Fish FarmingThe Perils of Fish Farming
The Perils of Fish Farming
 
What Ifs?: Education Provocations
What Ifs?: Education ProvocationsWhat Ifs?: Education Provocations
What Ifs?: Education Provocations
 
Localisation of openMOOCs
Localisation of openMOOCsLocalisation of openMOOCs
Localisation of openMOOCs
 
Genre lesson (1)
Genre lesson (1)Genre lesson (1)
Genre lesson (1)
 
Father-Daughter Relationship and Identity in Munro’s Boys and Girls (draft)
Father-Daughter Relationship and Identity in Munro’s Boys and Girls (draft)Father-Daughter Relationship and Identity in Munro’s Boys and Girls (draft)
Father-Daughter Relationship and Identity in Munro’s Boys and Girls (draft)
 
Layar & Hoppala
Layar & HoppalaLayar & Hoppala
Layar & Hoppala
 
Plot structure
Plot structurePlot structure
Plot structure
 
Maurya gupta empires
Maurya gupta empiresMaurya gupta empires
Maurya gupta empires
 
Códigos QR, los Invasores del Espacio
Códigos QR, los Invasores del EspacioCódigos QR, los Invasores del Espacio
Códigos QR, los Invasores del Espacio
 
9 things to know about wearable technology in health and fitness
9 things to know about wearable technology in health and fitness9 things to know about wearable technology in health and fitness
9 things to know about wearable technology in health and fitness
 
Emerging OER Discipline
Emerging OER DisciplineEmerging OER Discipline
Emerging OER Discipline
 
OERs - Open for Business or Closing or Down Sale?
OERs - Open for Business or Closing or Down Sale?OERs - Open for Business or Closing or Down Sale?
OERs - Open for Business or Closing or Down Sale?
 

Similar a Scheibner

MicroRNA Profiling in Serum from Donors with Germ Cell Cancer
MicroRNA Profiling in Serum from Donors with Germ Cell CancerMicroRNA Profiling in Serum from Donors with Germ Cell Cancer
MicroRNA Profiling in Serum from Donors with Germ Cell Cancer
Thermo Fisher Scientific
 
Whitepaper serumplasma
Whitepaper serumplasmaWhitepaper serumplasma
Whitepaper serumplasma
Elsa von Licy
 
Mi rna functional analysis 2013
Mi rna functional analysis 2013Mi rna functional analysis 2013
Mi rna functional analysis 2013
Elsa von Licy
 
Art%3 a10.1186%2fs12935 015-0185-1
Art%3 a10.1186%2fs12935 015-0185-1Art%3 a10.1186%2fs12935 015-0185-1
Art%3 a10.1186%2fs12935 015-0185-1
John Valdivia
 

Similar a Scheibner (20)

MicroRNA Profiling in Serum from Donors with Germ Cell Cancer
MicroRNA Profiling in Serum from Donors with Germ Cell CancerMicroRNA Profiling in Serum from Donors with Germ Cell Cancer
MicroRNA Profiling in Serum from Donors with Germ Cell Cancer
 
microRNA Message to T Cell Acute Lymphoblastic Leukemia
microRNA Message to T Cell Acute Lymphoblastic Leukemia microRNA Message to T Cell Acute Lymphoblastic Leukemia
microRNA Message to T Cell Acute Lymphoblastic Leukemia
 
Dr. Croce on Causes and Consequences of microRNA Dysregulation in Cancer
Dr. Croce on Causes and Consequences of microRNA Dysregulation in CancerDr. Croce on Causes and Consequences of microRNA Dysregulation in Cancer
Dr. Croce on Causes and Consequences of microRNA Dysregulation in Cancer
 
Micro RNA (miRNA) en route to the clinic as next generation medicine
Micro RNA (miRNA) en route to the clinic as next generation medicineMicro RNA (miRNA) en route to the clinic as next generation medicine
Micro RNA (miRNA) en route to the clinic as next generation medicine
 
POSTER DEFINITIU-PADRI
POSTER DEFINITIU-PADRIPOSTER DEFINITIU-PADRI
POSTER DEFINITIU-PADRI
 
mi RNA en route to the clinic
mi RNA en route to the   clinic mi RNA en route to the   clinic
mi RNA en route to the clinic
 
lung cancer biomarkers
lung cancer biomarkerslung cancer biomarkers
lung cancer biomarkers
 
Mirna and its applications
Mirna and its applicationsMirna and its applications
Mirna and its applications
 
Whitepaper serumplasma
Whitepaper serumplasmaWhitepaper serumplasma
Whitepaper serumplasma
 
Mi rna functional analysis 2013
Mi rna functional analysis 2013Mi rna functional analysis 2013
Mi rna functional analysis 2013
 
Art%3 a10.1186%2fs12935 015-0185-1
Art%3 a10.1186%2fs12935 015-0185-1Art%3 a10.1186%2fs12935 015-0185-1
Art%3 a10.1186%2fs12935 015-0185-1
 
Seminario Biologia Molecular
Seminario Biologia Molecular Seminario Biologia Molecular
Seminario Biologia Molecular
 
micro RNA
micro RNAmicro RNA
micro RNA
 
Pathways07 mi rna
Pathways07 mi rnaPathways07 mi rna
Pathways07 mi rna
 
Non coding RNA as targets in drug discovery.pptx
Non coding RNA as targets in drug discovery.pptxNon coding RNA as targets in drug discovery.pptx
Non coding RNA as targets in drug discovery.pptx
 
Mi rna array 2013
Mi rna array 2013Mi rna array 2013
Mi rna array 2013
 
miRNA profiling from blood challenges and recommendations - Download the article
miRNA profiling from blood challenges and recommendations - Download the articlemiRNA profiling from blood challenges and recommendations - Download the article
miRNA profiling from blood challenges and recommendations - Download the article
 
Total RNA Discovery for RNA Biomarker Development Webinar
Total RNA Discovery for RNA Biomarker Development WebinarTotal RNA Discovery for RNA Biomarker Development Webinar
Total RNA Discovery for RNA Biomarker Development Webinar
 
An mi script-serum
An mi script-serumAn mi script-serum
An mi script-serum
 
Micro RNA biogenesis pathways in cancer - Article.
Micro RNA biogenesis pathways in cancer - Article.Micro RNA biogenesis pathways in cancer - Article.
Micro RNA biogenesis pathways in cancer - Article.
 

Más de University of Maryland Baltimore

Más de University of Maryland Baltimore (20)

Twaddell
TwaddellTwaddell
Twaddell
 
Sausville
SausvilleSausville
Sausville
 
Wang
WangWang
Wang
 
Penn
PennPenn
Penn
 
Ross - ET Overview
Ross - ET OverviewRoss - ET Overview
Ross - ET Overview
 
Lapidus
LapidusLapidus
Lapidus
 
Meiller
MeillerMeiller
Meiller
 
Hosame Gcc09 Retreat 15min 100209
Hosame   Gcc09 Retreat 15min 100209Hosame   Gcc09 Retreat 15min 100209
Hosame Gcc09 Retreat 15min 100209
 
Edelman - Clinical Trials
Edelman - Clinical TrialsEdelman - Clinical Trials
Edelman - Clinical Trials
 
Fenselau
FenselauFenselau
Fenselau
 
Edelman- NCI
Edelman- NCIEdelman- NCI
Edelman- NCI
 
Dorsey
DorseyDorsey
Dorsey
 
Daniel
DanielDaniel
Daniel
 
Aurelian
AurelianAurelian
Aurelian
 
Badros
BadrosBadros
Badros
 
Coop
CoopCoop
Coop
 
Ma
MaMa
Ma
 
Swaan
SwaanSwaan
Swaan
 
Fang
FangFang
Fang
 
Retreat Agenda
Retreat AgendaRetreat Agenda
Retreat Agenda
 

Último

An Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdfAn Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdf
SanaAli374401
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptx
heathfieldcps1
 
Making and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdfMaking and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdf
Chris Hunter
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
negromaestrong
 

Último (20)

Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
An Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdfAn Overview of Mutual Funds Bcom Project.pdf
An Overview of Mutual Funds Bcom Project.pdf
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot Graph
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptx
 
How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric  nursing HISTORY  COLLECTION  .docxpsychiatric  nursing HISTORY  COLLECTION  .docx
psychiatric nursing HISTORY COLLECTION .docx
 
Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
Making and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdfMaking and Justifying Mathematical Decisions.pdf
Making and Justifying Mathematical Decisions.pdf
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
 
PROCESS RECORDING FORMAT.docx
PROCESS      RECORDING        FORMAT.docxPROCESS      RECORDING        FORMAT.docx
PROCESS RECORDING FORMAT.docx
 

Scheibner

  • 1. Identification of a possible tumor suppressor microRNA in leukemia Kara A. Scheibner, PhD Center for Stem Cell Biology and Regenerative Medicine October 2, 2009 Experimental Therapeutics Retreat
  • 2.
  • 3.
  • 4. MicroRNA regulation (and deregulation) of hematopoiesis miR-17-92 cluster: expression decreases during monocyte development; highly expressed in pre B and T precursor cells and decreases after maturation miR-146: drives naïve T cells to become T1 helper cells over Th2 cells miR-223: expressed specifically in the granulocyte lineage; decreases as cells move from MEPs to erythrocytes miR-221/222: downregulated during erythropoiesis (Modified from Baltimore et al, 2008)
  • 5.
  • 6.
  • 7. Low expression levels of miR-27a in leukemia cells compared to HSPCs…….a hint? miRNA microarray data qRT-PCR data Does the fact that miR-27a expression is low or absent in multiple leukemia cell lines and patient samples mean anything in the etiology of the disease? 0 0.2 0.4 0.6 0.8 1 1.2 1.4 RQ value (normalized to CD34+ cells) CD34+ K562 TF-1 KOPN8 HEK293T ALL #1 ALL #2 miR-23a miR-23b miR-27a miR-27b 34,913 TF1 47,337 REH 38,099 K562 113,257 CD34+ (HSPCs) miR-27a expression Cell type
  • 8. miR-27a as a tumor suppressor miRNA Decreased cell growth Increased death by apoptosis Increased cell death Altered cell cycle profile 0 50000 100000 150000 200000 250000 300000 350000 400000 450000 0 1 2 3 4 5 6 7 Days Cell number K562 FUGW miR-27 #1 miR-27 #5 miR-27 #6 miR-27 #11 0 5 10 15 20 25 30 35 40 Control #9 miR-27a #3 % total cell death Experiment 1 Experiment 2 0 5 10 15 20 25 30 35 % annexinV+/7AAD- GFP- Control #10 miR-27a #3 mirR-27a #4 miR-27a #7 0 10 20 30 40 50 60 70 80 G1 S G2 % cells GFP- miR-27a #1 miR-27a #2 miR-27a #3 miR-27a #4 miR-27a #5 miR-27a #6
  • 9.
  • 10.
  • 11. Other miR-27a predicted targets Wnt/ β -catenin pathway Wnt3a 3’UTR Wnt3a Frizzled 4/7 Dishevelled 2 LRP6
  • 12.
  • 13.