SlideShare una empresa de Scribd logo
1 de 15
Descargar para leer sin conexión
O uso da plataforma HPC na
descoberta de doenças genéticas
David Santos Marco Antonio. PhD
Profa. Maria Rita Passos Bueno
Laboratório de Genética do Desenvolvimento Humano
Departamento de Genética e Biologia Evolutiva
Instituto de Biociências - USP
Finding the variability that could
explain genetic disorders.
DNA : Chromosome : Genes
DNA: A T C G
Chromosomes:
1 – 22
X and/or Y
Mitochondrial
DNA : Chromosome : Genes
http://en.wikipedia.org/wiki/Human_genome
DNA : Chromosome : Genes
Human genetic variation in populations
• Genes on the same order
• Mapped using reference genome: hg19, GRCh38.
• Variability among relatives/populations.
• Susceptibility to diseases.
• Improvements.
Falar sobre populações
1000Genomes
Human genetic variation in populations
Haplogroups YMitochondrial DNA
Disorder Mutation Chromosome
22q11.2 deletion syndrome D 22q
Angelman syndrome DCP 15
Canavan disease 17p
Charcot–Marie–Tooth disease
Color blindness P X
Cri du chat D 5
Cystic fibrosis P 7q
Down syndrome C 21
Duchenne muscular dystrophy D Xp
Haemochromatosis P 6
Haemophilia P X
Klinefelter syndrome C X
Neurofibromatosis 17q/22q/?
Phenylketonuria P 12q
Polycystic kidney disease P 16 (PKD1) or 4 (PKD2)
Prader–Willi syndrome DC 15
Sickle-cell disease P 11p
Tay–Sachs disease P 15
Turner syndrome C X
 P – Point mutation: InDel.
 D – Deletion of gene.
 C – Whole chromosome
extra/missing.
 T – Nucleotide repeat disorders.
Human Genetic Diseases
Genomic Sequencing
• Terabytes of data/sequencing.
• Storage.
• Processing.
• Lots of RAM.
Ben Moore
Genomic Sequencing
Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
Recalibration
Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
RecalibrationVariant Calling
Data Processing
STEPS
Variant Calling
dbSNP
SIFT
PolyPhen OMIM
exac03
6500
Exomes1000
Genomes
Clinical
Relevant Data
High Computational Cost
• Storage.
• RAM.
• CPU.
• Reprocessing.
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
Fastq format
Research
• Authism
• Cranio-fascial development
• Richieri-Costa
• Down
Diseases Models
• Human
• Zebra fish
• Drosophila
• Microbiome
Acknowledgements
• LCCA
• Guys in LCCA
• Guys in LCCA
• Profa. Maria Rita Passos Bueno
• Laboratório de Genética do Desenvolvimento Humano
• Instituto de Biociências.
• USP

Más contenido relacionado

La actualidad más candente

Bio263 Who is our Closest Relative
Bio263 Who is  our Closest RelativeBio263 Who is  our Closest Relative
Bio263 Who is our Closest RelativeMark Pallen
 
oncolytic herpes simplex virus
oncolytic herpes simplex virusoncolytic herpes simplex virus
oncolytic herpes simplex virusCandySwift_NY
 
Antiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are efAntiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are efSiddhesh Sapre
 
Repeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveysRepeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveysmgray11
 
Doddinobelprizepresentation
DoddinobelprizepresentationDoddinobelprizepresentation
Doddinobelprizepresentationsdoddi11
 
Phytothreats: WP4 overview
Phytothreats: WP4 overviewPhytothreats: WP4 overview
Phytothreats: WP4 overviewForest Research
 
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...Vijay Elipay
 
Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis Charith Kumara
 
Oncolytic Virotherapy
Oncolytic VirotherapyOncolytic Virotherapy
Oncolytic VirotherapyStella Evelyn
 
Presentacio¦ün nicole 2
Presentacio¦ün nicole 2Presentacio¦ün nicole 2
Presentacio¦ün nicole 2Nicole Rivera
 
The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites Family Tree DNA
 
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus SchultzPistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus SchultzPistoia Alliance
 
Bio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming humanBio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming humanMark Pallen
 
NetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaNetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaAlexander Pico
 
Hum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafricaHum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafricaMark Pallen
 

La actualidad más candente (20)

Htlv 1
Htlv 1Htlv 1
Htlv 1
 
Bio263 Who is our Closest Relative
Bio263 Who is  our Closest RelativeBio263 Who is  our Closest Relative
Bio263 Who is our Closest Relative
 
oncolytic herpes simplex virus
oncolytic herpes simplex virusoncolytic herpes simplex virus
oncolytic herpes simplex virus
 
Antiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are efAntiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are ef
 
Repeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveysRepeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveys
 
Doddinobelprizepresentation
DoddinobelprizepresentationDoddinobelprizepresentation
Doddinobelprizepresentation
 
Artigo - Bárbara
Artigo - BárbaraArtigo - Bárbara
Artigo - Bárbara
 
Phytothreats: WP4 overview
Phytothreats: WP4 overviewPhytothreats: WP4 overview
Phytothreats: WP4 overview
 
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
 
Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis
 
Oncolytic Virotherapy
Oncolytic VirotherapyOncolytic Virotherapy
Oncolytic Virotherapy
 
Viruses and cancer
Viruses and cancerViruses and cancer
Viruses and cancer
 
GKA deel 1 college 15
GKA deel 1 college 15GKA deel 1 college 15
GKA deel 1 college 15
 
Presentacio¦ün nicole 2
Presentacio¦ün nicole 2Presentacio¦ün nicole 2
Presentacio¦ün nicole 2
 
The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites
 
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus SchultzPistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
 
Retroviruses and HIV
Retroviruses and HIVRetroviruses and HIV
Retroviruses and HIV
 
Bio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming humanBio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming human
 
NetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaNetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu Xia
 
Hum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafricaHum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafrica
 

Destacado

"The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P..."The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P...lccausp
 
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...lccausp
 
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...lccausp
 
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.lccausp
 
"The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen..."The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen...lccausp
 
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...lccausp
 
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre..."Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...lccausp
 
Ud.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevoUd.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevobiologiahipatia
 
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...lccausp
 

Destacado (9)

"The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P..."The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P...
 
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
 
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
 
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
 
"The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen..."The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen...
 
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
 
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre..."Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
 
Ud.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevoUd.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevo
 
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
 

Similar a Finding genetic disorders using HPC platforms

Abraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentationAbraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentationMoshe Kenigshtein
 
GA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project IntroductionGA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project Introductionmhaendel
 
Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514Marios Kyriazis
 
Comparitive genomic hybridisation
Comparitive genomic hybridisationComparitive genomic hybridisation
Comparitive genomic hybridisationnamrathrs87
 
Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015Chris Mungall
 
Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...Lynn Schriml
 
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...Databricks
 
Gabbay Award Lecture
Gabbay Award LectureGabbay Award Lecture
Gabbay Award Lectureahandyside
 
Human genetic technologies
Human genetic technologiesHuman genetic technologies
Human genetic technologiesAparna Chaudhary
 
Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Semel Admin
 
POSTGENETICS MEDICINE
POSTGENETICS MEDICINEPOSTGENETICS MEDICINE
POSTGENETICS MEDICINEinemet
 
DNA Methylation & C Value.pdf
DNA Methylation & C Value.pdfDNA Methylation & C Value.pdf
DNA Methylation & C Value.pdfsoniaangeline
 
TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)jmoore89
 
Describe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfDescribe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfarenamobiles123
 

Similar a Finding genetic disorders using HPC platforms (20)

Genetics
GeneticsGenetics
Genetics
 
Abraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentationAbraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentation
 
Human genome project 1
Human genome project 1Human genome project 1
Human genome project 1
 
GA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project IntroductionGA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project Introduction
 
Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514
 
Biomol
BiomolBiomol
Biomol
 
Biomol
BiomolBiomol
Biomol
 
Biomol
BiomolBiomol
Biomol
 
Comparitive genomic hybridisation
Comparitive genomic hybridisationComparitive genomic hybridisation
Comparitive genomic hybridisation
 
Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015
 
Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...
 
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
 
Gabbay Award Lecture
Gabbay Award LectureGabbay Award Lecture
Gabbay Award Lecture
 
Human genetic technologies
Human genetic technologiesHuman genetic technologies
Human genetic technologies
 
Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016
 
POSTGENETICS MEDICINE
POSTGENETICS MEDICINEPOSTGENETICS MEDICINE
POSTGENETICS MEDICINE
 
DNA Methylation & C Value.pdf
DNA Methylation & C Value.pdfDNA Methylation & C Value.pdf
DNA Methylation & C Value.pdf
 
TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)
 
Describe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfDescribe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdf
 
Genes
GenesGenes
Genes
 

Último

(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...Taniya Sharma
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...Garima Khatri
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Call Girls in Nagpur High Profile
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableNehru place Escorts
 
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...indiancallgirl4rent
 
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsBangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsGfnyt
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...CALL GIRLS
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiAlinaDevecerski
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...narwatsonia7
 
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...narwatsonia7
 
Russian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls Jaipur
Russian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls JaipurRussian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls Jaipur
Russian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls Jaipurparulsinha
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomdiscovermytutordmt
 
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiLow Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiSuhani Kapoor
 

Último (20)

(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
💎VVIP Kolkata Call Girls Parganas🩱7001035870🩱Independent Girl ( Ac Rooms Avai...
 
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Jabalpur Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Aurangabad Just Call 9907093804 Top Class Call Girl Service Available
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
 
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
Book Paid Powai Call Girls Mumbai 𖠋 9930245274 𖠋Low Budget Full Independent H...
 
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls AvailableVip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
Vip Call Girls Anna Salai Chennai 👉 8250192130 ❣️💯 Top Class Girls Available
 
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
(Rocky) Jaipur Call Girl - 09521753030 Escorts Service 50% Off with Cash ON D...
 
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual NeedsBangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
Bangalore Call Girl Whatsapp Number 100% Complete Your Sexual Needs
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
Call Girls Service Surat Samaira ❤️🍑 8250192130 👄 Independent Escort Service ...
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
 
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Faridabad Just Call 9907093804 Top Class Call Girl Service Available
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
 
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
 
Russian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls Jaipur
Russian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls JaipurRussian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls Jaipur
Russian Call Girls in Jaipur Riya WhatsApp ❤8445551418 VIP Call Girls Jaipur
 
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel roomLucknow Call girls - 8800925952 - 24x7 service with hotel room
Lucknow Call girls - 8800925952 - 24x7 service with hotel room
 
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiLow Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
 

Finding genetic disorders using HPC platforms