LA  REVOLUCIÓ   GENÈTICA : REVELACIÓ DELS SECRETS DE LA VIDA
<ul><li>Quina és l’essència de la vida? </li></ul><ul><li>Per què els éssers vius són com són? </li></ul><ul><li>Com és tr...
<ul><li>Tot el que ens envolta és pot classificar segons: </li></ul><ul><li>matèria inert </li></ul><ul><li>éssers vius </...
Els fills heteten caràcters dels seu pares <ul><li>Els éssers vius som capaços de fer còpies de nosaltres mateixos gràcies...
Els éssers vius evolucionen
Darwin: selecció natural <ul><li>La  selecció natural  és el procés que dirigeix l' evolució  de les  espècies , d'acord a...
<ul><li>Així doncs, és sobre aquest conjunt de caràcters sobre els que opera la selecció natural. Els individus més ben ad...
 
Selecció artificial <ul><li>La selecció natural permet la supervivència dels més aptes i determina progressivament la seva...
Mendel: la diferència és als gens <ul><li>Què és un gen? </li></ul><ul><li>Un  gen  és una seqüència linial de  nucleòtids...
Què és un gen Un gen és un tros d’ADN que conté la informació per fabricar una proteïna Anàlogament són les instruccions p...
Com es transmet la informació Abans de dividir-se, la cèl·lula fa còpies de tota la informació per repartir-la entre les c...
Experiment de Mendel <ul><li>Va entrecreuar varietats pures per a un sol caràcter.  </li></ul><ul><li>Per cada varietat va...
Primera llei de Mendel  ( uniformitat de l’F1) X P P F1
Segona llei de Mendel ( Segregació independent dels caràcters) X Fecundem les plantes filles entre elles F1 F2 3 de cada 4...
<ul><li>Va observar també que si els pares difereixen en més d’un caràcter, cada caràcter es transmet amb independència de...
Experiments de Mendel amb pèsols
La conclusió de Mendel <ul><li>ELS FACTORS HEREDITARIS MANTENEN LA SEVA INDIVIDUALITAT AL LLARG DE LES GENERACIONS I ES TR...
On viatgen els caràcters ( gens ) Heretem els caràcters amb la reproducció, ens assemblem als progenitors perquè cadascun ...
On viatgen els caràcters ( gens ) Per cada caràcter hi ha dos gens un patern i un matern. Si només se’n manifesta un diem ...
b b M  M b M M b Fenotip: ulls marrons Genotip Heterozigot (M b)
NOMENCLATURA <ul><li>FENOTIP: és el caràcter manisfestat en el nou individu. </li></ul><ul><li>GENOTIP: és el conjunt de f...
exemple Comenta les imatges segons el que explica la diapositiva anterior
RESUMINT Youtube Leyes de Mendel y excepciones teóricas
On són els gens? Dintre del nucli de la cèl·lula hi ha l’ADN organitzat en el que es diu Cromatina ( ADN + Proteïnes) Hi h...
Cèl·lula epitelial al MET  (microscopi electrònic de transmissió) NUCLI CITOPLASMA MEMBRANA
Cèl·lula epitelial al MET  (microscopi electrònic de transmissió) Membrana nuclear Nucleol Cromatina
Constància numèrica dels cromosomes Mosca 5  Centeno 14  Cebra 19  Paloma 16  Caracol 24  Gusano 36  Gato 38  Cerdo 40  Ra...
El nombre de cromosomes humà és sempre constant, qualsevol error pot provocar un síndrome. Actualment a les dones embarass...
El descobriment del ADN Miescher   1871  va aïllar  del núcli de les cèl·lules de  la pus una substància àcida rica en fòs...
De què són fets els gens i com es copien El segle XX va ser molt important en el coneixement del material genètic Griffith...
La doble hèlix Rosalind Franklin  aconsegueix fotografies de difracció de raigs X de la molècula d’ADN Edwin Chargaff 1950...
La doble hèlix James Watson i Francis Crick recullen totes les  troballes prèvies i proposen el model de la doble hèlix. I...
Composició dels àcids nucleics Les molècules anteriors s’uneixen per formar nucleòtids, hi ha 8 tipus de nucleòtids, depen...
ADN L’ADN està format per la unió de dexoxirribonucleòtids , formats per: Els nucleòtids formen cadenes unint-se per l`àci...
ADN Dues cadenes s’uneixen  en sentit contrari encaixant les bases de manera complementària A=T i C=G
ADN La doble cadena s’enrotlla en una doble hèlix dextrogira donant una forma semblant a una escala de caragol a on les ba...
ARN L’ARN és un àcid nucleic que també es troba dintre de la cèl·lula. Està format per nucleòtids de RIBOSA i com a Bases ...
Tipus d’ARN
Dogma central de la Biologia Molecular REPLICACIÓ TRANSCRIPCIÓ TRADUCCIÓ
Dogma central de la Biologia Molecular TRANSCRIPCIÓ TRADUCCIÓ REPLICACIÓ
La duplicació de l’ADN El model de la doble hèlix  no només explica les fotos de Franckin i les regles de chargaff, també ...
Per a què serveixen els gens L’ADN conté els gens, sabem on és i que és capaç de fer còpies de sí mateix, però , com està ...
Les proteïnes  es caracteritzen per la seqüència d’AA, molècules més petites que les composen. Hi ha 20 AA diferents que f...
Per a què serveixen els gens Aquests són els 20 AA que formen TOTES les proteïnes
La traducció El codi genètic, és el conjunt d’instruccions que serveixen per fabricar  les proteïnes a partir de l’ordre o...
El codi genètic L’hemoglobina S o defectuosa no funciona bé i fa que els gl.vermells tinguin frma de falç
Síntesi de proteïnes
El genoma humà Al 2003 es va publicar per primera vegada la seqüència del genoma humà Només el 5% del nostre genoma són ge...
El genoma humà Enacra no es sap quina és la funció de tant d’ADN sense sentit, saber la seqüència està molt lluny d’entend...
Noves ciències Genòmica : Part de la Biologia que s’encarrega de l’estudi dels genomes. S’estudien patologies complexes pe...
Genètica del desenvolupament La genètica del desenvolupament pretèn entendre els mecanismes o regles que governen el desen...
Genètica del desenvolupament Desenvolupament  d’un organisme animal Fecundació Proliferació Diferenciació Quines aplicacio...
L’epigenètica L’epigenètica és la branca de la genètica que estudia quines característiques d’un individu  no  estan deter...
Manipulació dels gens un a un: biotecnologia L’evolució de la ciència i la tecnologia permeten el desenvolupament de la te...
Manipulació dels gens un a un: biotecnologia La diabetis és una malaltia que es caracteritza per una manca de síntesi de l...
Manipulació dels gens un a un: biotecnologia Altres molècules aconseguides per ingenieria genètica <ul><li>Interferó humà ...
La reacció en cadena de la polimerasa PCR Tècnica inventada al 1986 per Kary B. Mullis.  Permet ampliar ràpidament mostres...
BIOTECNOLOGIA 1 2 6 3 5 4
Próxima SlideShare
Cargando en…5
×

La revolució genètica

2.202 visualizaciones

Publicado el

tema 4 genètica cmc

  • Sé el primero en comentar

La revolució genètica

  1. 1. LA REVOLUCIÓ GENÈTICA : REVELACIÓ DELS SECRETS DE LA VIDA
  2. 2. <ul><li>Quina és l’essència de la vida? </li></ul><ul><li>Per què els éssers vius són com són? </li></ul><ul><li>Com és transmet la informació genètica ? </li></ul>
  3. 3. <ul><li>Tot el que ens envolta és pot classificar segons: </li></ul><ul><li>matèria inert </li></ul><ul><li>éssers vius </li></ul>
  4. 4. Els fills heteten caràcters dels seu pares <ul><li>Els éssers vius som capaços de fer còpies de nosaltres mateixos gràcies a l’emmagatzematge i la transmissió d’informació. </li></ul><ul><li>Com s’emmagatzema aquesta informació? </li></ul><ul><li>On? </li></ul><ul><li>Com s’utilitza? </li></ul>
  5. 5. Els éssers vius evolucionen
  6. 6. Darwin: selecció natural <ul><li>La selecció natural és el procés que dirigeix l' evolució de les espècies , d'acord amb el darwinisme , que és la teoria evolucionista acceptada actualment. </li></ul><ul><li>Segons Charles Darwin en qualsevol població , els individus són diferents entre ells. Els individus d'una població tenen caràcters que són heretables a la descendència . </li></ul>
  7. 7. <ul><li>Així doncs, és sobre aquest conjunt de caràcters sobre els que opera la selecció natural. Els individus més ben adaptats al seu ambient tindran major descendència ja que s'hi adaptaran millor i per tant amb aquell caràcter tendirà a fer-se més freqüent a cada generació. </li></ul>
  8. 9. Selecció artificial <ul><li>La selecció natural permet la supervivència dels més aptes i determina progressivament la seva aparença. </li></ul><ul><li>Quan hi ha intervenció en aquesta selecció l’anomenem selecció artificial. </li></ul>
  9. 10. Mendel: la diferència és als gens <ul><li>Què és un gen? </li></ul><ul><li>Un gen és una seqüència linial de nucleòtids d' ADN o ARN que és essencial per a una funció específica, ja sigui en el desenvolupament de l'ésser o en el manteniment d'una funció fisiològica normal. És considerat com la unitat d'emmagatzemament d'informació i unitat d'herència al transmetre aquesta informació a la descendència . </li></ul>
  10. 11. Què és un gen Un gen és un tros d’ADN que conté la informació per fabricar una proteïna Anàlogament són les instruccions per construir alguna cosa.
  11. 12. Com es transmet la informació Abans de dividir-se, la cèl·lula fa còpies de tota la informació per repartir-la entre les cèl·lules filles
  12. 13. Experiment de Mendel <ul><li>Va entrecreuar varietats pures per a un sol caràcter. </li></ul><ul><li>Per cada varietat va comprovar que els fills de la primera generació eren tots iguals. Tots s’assemblaven a un caràcter del pare o de la mare. </li></ul><ul><li>Després va entrecreuar els fills entre ells i va comprovar que els nets eren de dos tipus diferents. </li></ul>
  13. 14. Primera llei de Mendel ( uniformitat de l’F1) X P P F1
  14. 15. Segona llei de Mendel ( Segregació independent dels caràcters) X Fecundem les plantes filles entre elles F1 F2 3 de cada 4 1 de cada 4
  15. 16. <ul><li>Va observar també que si els pares difereixen en més d’un caràcter, cada caràcter es transmet amb independència dels altres </li></ul><ul><li>CADA CARÀCTER ÉS TRANSMET DE MANERA INDEPENDENT I POT DONAR LLOC A INDIVIDUS DIFERENTS DELS PARES. </li></ul>Color de les flors, color de les llavors, alçada de la mata…són caràcters diferents que es transmeten independentment
  16. 17. Experiments de Mendel amb pèsols
  17. 18. La conclusió de Mendel <ul><li>ELS FACTORS HEREDITARIS MANTENEN LA SEVA INDIVIDUALITAT AL LLARG DE LES GENERACIONS I ES TRANSMETEN INDEPENDENTMENT ELS UNS DELS ALTRES. </li></ul><ul><li>GEN: UNITAT D’INFORMACIÓ HEREDITÀRIA. </li></ul>
  18. 19. On viatgen els caràcters ( gens ) Heretem els caràcters amb la reproducció, ens assemblem als progenitors perquè cadascun ens dóna un gen per a cada caràcter, aquests gens viatgen als gàmetes
  19. 20. On viatgen els caràcters ( gens ) Per cada caràcter hi ha dos gens un patern i un matern. Si només se’n manifesta un diem que aquest és dominant sobre l’altre.
  20. 21. b b M M b M M b Fenotip: ulls marrons Genotip Heterozigot (M b)
  21. 22. NOMENCLATURA <ul><li>FENOTIP: és el caràcter manisfestat en el nou individu. </li></ul><ul><li>GENOTIP: és el conjunt de factors hereditaris que es reben dels progenitors. </li></ul><ul><li>El fenotip d’una persona és sempre conseqüència del genotip més els factors ambientals. Per exemple. És evident que el genotip que determina la coloració de la pell de qualsevol organisme és sempre el mateix, però la seva expressió dependrà, entre altres factors, de la nostra exposició a la llum solar. </li></ul>
  22. 23. exemple Comenta les imatges segons el que explica la diapositiva anterior
  23. 24. RESUMINT Youtube Leyes de Mendel y excepciones teóricas
  24. 25. On són els gens? Dintre del nucli de la cèl·lula hi ha l’ADN organitzat en el que es diu Cromatina ( ADN + Proteïnes) Hi ha 2m d’ADN en cada cèl·lula distribuida en 46 troços , que quan es superenrotllen (durant la divisió cel·lular) formen els cromosomes.
  25. 26. Cèl·lula epitelial al MET (microscopi electrònic de transmissió) NUCLI CITOPLASMA MEMBRANA
  26. 27. Cèl·lula epitelial al MET (microscopi electrònic de transmissió) Membrana nuclear Nucleol Cromatina
  27. 28. Constància numèrica dels cromosomes Mosca 5 Centeno 14 Cebra 19 Paloma 16 Caracol 24 Gusano 36 Gato 38 Cerdo 40 Ratón 40 Trigo 42 Rata 42 Conejo 44 Hamster 44 Liebre 46 Hombre 46 Simio 48 Oveja 54 Vaca 60 Caballo 64 Camello 74 Llama 74 Perro 78 Pollo 78 L’espècie humana té 46 cromosomes , emparellats de dos en dos, té llevors 23 parelles, un cromosoma de cada parella el rebem del pare i l’altre de la mare. La parella 23 són els heterocromosomes o cromosomes sexuals
  28. 29. El nombre de cromosomes humà és sempre constant, qualsevol error pot provocar un síndrome. Actualment a les dones embarassades amb risc se’ls fa una anàlisi cromosòmica del fetus que es diu amniocentensi De la prova s’obtenen cèl·lules de les que es poden aïllar els cromosomes fetals i es fa un cariotip
  29. 30. El descobriment del ADN Miescher 1871 va aïllar del núcli de les cèl·lules de la pus una substància àcida rica en fòsfor a la que va anomenar &quot;nucleína&quot;. Un any més tard, en 1872, va aïllar del cap dels espermatozoides del salmó un compost al que va anomenar &quot;protamina&quot; y que va resultar ser una substancia àcida i una altra bàsica. El nombre de àcid nuclèic procedeix del de &quot;nucleína&quot; proposat per Miescher. Fent anàlisis químics es descobreix en els components de l’àcid nucleic
  30. 31. De què són fets els gens i com es copien El segle XX va ser molt important en el coneixement del material genètic Griffith 1928 Va descobrir una substància que porta informació Oswald Avery 1944. descobreix que aquesta substànci és ADN
  31. 32. La doble hèlix Rosalind Franklin aconsegueix fotografies de difracció de raigs X de la molècula d’ADN Edwin Chargaff 1950 analitza l’ADN i troba una sèrie de regularitats La proporción de Adenina (A) es igual a la de Timina (T) La proporción de Guanina (G) es igual a la de Citosina (C) La proporción de bases púricas (A+G) es igual a la de las bases pirimidínicas (T+C)
  32. 33. La doble hèlix James Watson i Francis Crick recullen totes les troballes prèvies i proposen el model de la doble hèlix. I reben el premi Nobel de medecina al 1962 per Poels seus descobrimients en relació amb l’estructura molecular dels àcids nucleícs i la seva significació par la transmisió de la informació en la matèria viva.
  33. 34. Composició dels àcids nucleics Les molècules anteriors s’uneixen per formar nucleòtids, hi ha 8 tipus de nucleòtids, dependent de la pensosa (ribosa o desoxirribosa) i de la Base Nitrogenada ( Adenina, Timina, Guanina, Citosina, Uracil) A; T; G, C, U RIBOSA DESOXIRRIBOSA
  34. 35. ADN L’ADN està format per la unió de dexoxirribonucleòtids , formats per: Els nucleòtids formen cadenes unint-se per l`àcid fosfòric Els nucleòtids formen cadenes unint-se per l`àcid fosfòric
  35. 36. ADN Dues cadenes s’uneixen en sentit contrari encaixant les bases de manera complementària A=T i C=G
  36. 37. ADN La doble cadena s’enrotlla en una doble hèlix dextrogira donant una forma semblant a una escala de caragol a on les baranes són la desoxirribosa i els fosfats i els esglaons són les bases nitrogenades.
  37. 38. ARN L’ARN és un àcid nucleic que també es troba dintre de la cèl·lula. Està format per nucleòtids de RIBOSA i com a Bases nitogenades : A; C; G; U. No té T . Els nucleòtids s’uneixen formant molècules d’una sola cadena
  38. 39. Tipus d’ARN
  39. 40. Dogma central de la Biologia Molecular REPLICACIÓ TRANSCRIPCIÓ TRADUCCIÓ
  40. 41. Dogma central de la Biologia Molecular TRANSCRIPCIÓ TRADUCCIÓ REPLICACIÓ
  41. 42. La duplicació de l’ADN El model de la doble hèlix no només explica les fotos de Franckin i les regles de chargaff, també pot explicar la duplicació de l’ADN
  42. 43. Per a què serveixen els gens L’ADN conté els gens, sabem on és i que és capaç de fer còpies de sí mateix, però , com està codificada la informació genètica? Un gen és la informació necessària per construir una proteïna. Les dues molècules comparteixen un codi de manera que una seqüència de nucleòtids d’ADN correspon a una de aa d’una proteïna
  43. 44. Les proteïnes es caracteritzen per la seqüència d’AA, molècules més petites que les composen. Hi ha 20 AA diferents que formen totes les proteïnes
  44. 45. Per a què serveixen els gens Aquests són els 20 AA que formen TOTES les proteïnes
  45. 46. La traducció El codi genètic, és el conjunt d’instruccions que serveixen per fabricar les proteïnes a partir de l’ordre o seqüència dels nucleòtids que formen l’ADN. Aquest codi determina que cada grup de 3 nucleòtids codifica per un aminoàcid. ATTCGCGCCGTTAGCTAACCGTTGACCTATTACCCTTACG Quins aa formaran la proteïna corresponent?
  46. 47. El codi genètic L’hemoglobina S o defectuosa no funciona bé i fa que els gl.vermells tinguin frma de falç
  47. 48. Síntesi de proteïnes
  48. 49. El genoma humà Al 2003 es va publicar per primera vegada la seqüència del genoma humà Només el 5% del nostre genoma són gens i tenim uns 27.000, la resta és DNA escombraria, introns i gens d’ARN RESUM
  49. 50. El genoma humà Enacra no es sap quina és la funció de tant d’ADN sense sentit, saber la seqüència està molt lluny d’entendre el genoma. No hi ha correlació entre complexitat de l’organisme i nombre de gens Figura 4.24 pàgina 99
  50. 51. Noves ciències Genòmica : Part de la Biologia que s’encarrega de l’estudi dels genomes. S’estudien patologies complexes per veure l’associació amb el genoma. Proteòmica: Estudia les proteïnes associades a patologies complexes. metabolómica: Estudia els metabòlits associats a patologies complexes En les tres ciències es registren perfils genòmics, proteïnes i metabòlits de molts individus amb patologies concretes per associar-los . En un futur, observant el perfil de proteïnes cel·lulars d'individu podrem saber si té o no una patologia.
  51. 52. Genètica del desenvolupament La genètica del desenvolupament pretèn entendre els mecanismes o regles que governen el desenvolupament d’un organisme
  52. 53. Genètica del desenvolupament Desenvolupament d’un organisme animal Fecundació Proliferació Diferenciació Quines aplicacions poden sorgir del coneixement del mecanisme de la diferenciació ?
  53. 54. L’epigenètica L’epigenètica és la branca de la genètica que estudia quines característiques d’un individu no estan determinades per la seqüència de nucleòtids de l’ADN http://www.youtube.com/watch?v=SXa5cWcPrrY http://www.youtube.com/watch?v=V1lwe0JUMwk
  54. 55. Manipulació dels gens un a un: biotecnologia L’evolució de la ciència i la tecnologia permeten el desenvolupament de la tecnologia de l’ADN recombinant, també anomenada enginyeria genètica o clonació molecular. Consisteix en manipular els gens dels organismes per aconseguir organismes amb característiques diferents a les pròpies o aconseguir substàncies que estan codificades en un gen i que són difícils de sintetitzar artificialment.
  55. 56. Manipulació dels gens un a un: biotecnologia La diabetis és una malaltia que es caracteritza per una manca de síntesi de l’hormona insulina per part del pàncrees, en conseqüència , els pacients no poden controlar la glucèmia de la sang. L’aportació externa d’Insulina és el seu tractament. Abans de la tecnologia molecular s’obtenia la Insulina del porc i de la vaca, ara s’obté per clonació en bacteris .
  56. 57. Manipulació dels gens un a un: biotecnologia Altres molècules aconseguides per ingenieria genètica <ul><li>Interferó humà per al tractament de l’esclerosi múltiple </li></ul><ul><li>L’hormona del creixement per tractar el nanisme hipofisiari. Abans es treia de cervells de cadàvers humans. </li></ul><ul><li>ADN polimerasa I per al tractament de la fibrosi quística </li></ul><ul><li>Vacunes basades en proteïnes recombinants com la de l’hepatitis B </li></ul><ul><li>Quimosina per l’elaboració de formatge. </li></ul><ul><li>Somatropina bovina per estimular la producció de llet en les vaques. </li></ul><ul><li>Lipolasa per l’elaboració de detergents eficaços amb les taques de greix. </li></ul><ul><li>Subtilina utilitzada per la fabricació de detergents. </li></ul>
  57. 58. La reacció en cadena de la polimerasa PCR Tècnica inventada al 1986 per Kary B. Mullis. Permet ampliar ràpidament mostres d’ADN. Medecina: Estudi del genoma d’agents infecc com virus o bacteris, estudi de malalties hereditàries. Paleontología, antropología biológica, y ciencias forenses
  58. 59. BIOTECNOLOGIA 1 2 6 3 5 4

×