SlideShare una empresa de Scribd logo
1 de 30
Caracterización
Metabólica Modificada
de la resistencia a
metales pesados de la
Cupriavidus
metallidurans cepa
MSR33 . Generada para
la biorremediación del
mercurio.
Rojas Luis y col.
El mercurio es uno de los elementos mas tóxicos en el
medio ambiente.
Para contrarrestar sus efectos se han realizados
procesos fisicoquímicos tales como: el intercambio
iónico y precipitación. A su vez procesos biológicos
para su eliminación, los cuales se han impuesto
sobre los anteriores.
En bacterias existen genes de resistencia a mercurio
conocidos como “mer” los cuales se organizan en
operones. Operones como merRTPADE confieren
resistencia solo a mercurio inorgánico y como mer
RTPAGBDE confiere resistencia tanto a mercurio
orgánico como inorgánico.
En este estudio se utilizara la cepa CH34
Metallidurans Cupriavidus, esta alberga dos grandes
plásmidos: pMOL28 y Pmol30, los cuales tienen
determinantes genéticos de resistencia a metales
pesados. Ambos poseen el operon merRTPADE, para
mejorar la resistencia se introdujo en la cepa CH34 el
plasmido Ptp6 IncP-1β, lo que originó una cepa
trasconjugante MSR33 la cual fue capaz de eliminar
el mercurio de aguas contaminada.
INTRODUCCIÓN
Objetivos:
• General: Caracterizar el
metabolismo modificado que
dá resistencia a metales
pesados de la Cupriavidus
Metallidurans cepa MSR33.
• Específico: Generación de una
cepa bacteriana con
resistencia a metales pesados y
a su vez a mercurio orgánico e
inorgánico.
HIPÓTESIS
• LA CEPA MRS33 CONTIENE LAS
CARACTERISTICAS DE UN METABOLISMO
MODIFICADO PARA LA ELIMINACIÓN DEL
MERCURIO
Materiales
• HgCl2 (analytical grade), CuSO4?5H2O, K2CrO4, NaBH4,
• NaOH, HCl (Suprapur) and standard Titrisol solution were
• obtained from Merck (Darmstadt, Germany). CH3HgCl (analytical
• grade) were obtained from Sigma Aldrich (Saint Louis, MO,
• USA). Stock solutions of Cu2+
• (5,000 mg ml21); CrO4
• 22 (2,500 mg
• ml21); Hg2+
• (1,000 mg ml21) and CH3Hg
• +
• (100 mg ml21) were
• prepared. NaBH4 solution (0.25%) was prepared in NaOH (0.4%)
• solution. High purity hydrochloric acid was used for mercury
• dilutions before quantification by inductively coupled plasma
• optical emission spectrometer (ICP-OES). Sodium succinate and
• salts for media preparation were obtained from Merck (Darmstadt,
• Germany). Taq DNA polymerase and bovine serum albumin for
• PCR were obtained from Invitrogen (Carlsbad, CA, USA). RNA
• was extracted using an RNeasy Protect Bacteria Mini kit from
• Qiagen (Hilden, Germany). For RNA quantification the QuantiT
• TM RNA Assay kit from Invitrogen (Carlsbad, CA, USA) was
• used. RT-PCR was performed using SuperScriptTM III One-Step
• Tampón TAE: 0.04 M Tris, 0.04 M de acetato,
0.001 M EDTA, ph=8.
• PCA: filtro estéril sobre agar para recuento en
placa
Medios
LB:
• 10g de triptona
• 5g de levadura
• 10 g de NaCl
LPTMS:
• 6.06 g de tris
• 4.68 g de NaCl
• 1.49 g de KCL
• 1.07 g NH4CL
• 0.43G Na2SO4
• 0.2 MgCl2.H20
• 003g CaCl2. 2H20
• 0.23g Na2HPO4.12H2O
• 0.005g Fe(III) NH4
• 1 ml de solución de
elementos traza
Métodos
Purificación del DNA
LISIS DE
CÉLULAS
DETERGENTES
ANIÓNICOS
CONSERVANTES QUE
IMPIDEN LA ACCIÓN
DE DNasas
RNasas
Eliminar el
RNA
PRECIPITACIÓN
SALINA
ELIMINAR
PROTEÍNAS Y
CONTAMINANTES
CELULARES
PRECIPITACIÓNALCOHOL
SOLUCIÓN
TAMPONADA EN
PRESENCIA DE
CONSERVANTES
Extracción del plásmido
Enzimas de restricción que cortan
lugares específicos
http://www.ncbi.nlm.nih.gov/pmc/articles/PM
C217141/pdf/jbacter00274-0253.pdf
http://www.uco.es/organiza/departamentos/b
ioquimica-biol-
mol/pdfs/43%20PURIFICACI%C3%93N%20AN%
C3%81LISIS%20DNA%20BACTERIANO.pdf
Estabilidad del plásmido
Una colonia de
MSR33
25 ml LB24 h a 28° C
Sembró en PCA 6 Réplicas
Se selecciono 48 colonias
Hg 2+
5 de ellas
resistentes
Y esparcidas por 70
generaciones
PTP6
E. coli JM 109 CH34
C. metallidurans
MSR33 PCA
Selección
LPTMS
28° c
0.3
%Succinato
Hg2+PCR
GENERACIÓN DE CEPAS BACTERIANAS TRANCONJUGANTES
Purificación de Dna
y extracción del
plásmidos
Presencia genes de resistencia a
metales pesados.
Gen MerB:
5’ TCGCCCCATATATTTTAGAAC 3’
5’ GTCGGGACAGATGCAAAGAAA 3’
Gen ChrB:
5’ GTCGTTAGCTTGCCAACATC 3’
5’CGGAAAGCAAGATGTCGAATCG 3’
Gen CopA:
5’ GGSABTACTGGTRBCAC 3’
5’ TGNGHCATCATSGTRTCRTT 3’
residuos de PCR
Gel de agarosa Tampón TAE
Plásmidos
Síntesis de MerA y MerB en MSR33
MSR33 LB
Cosechadas en fase
exponencial
Se lavó 2 veces
con tampón
fosfato
1 L/ 5 mg
Se colocó en
ebullición durante 5
minutos
Centrifugación 4°C10 min
Cuantificación
de proteínas
Electroforesis
FluorómetroTinción azul
brillante
Efecto de Hg2+ en el crecimiento de
las células
CH34
MSR33
LPTMS
SUCCINATO
CON Y SIN Hg 2+
EXPUESTAS A FASE
INCIAL Y A FASE
EXPONENCIAL
Microscopia electrónica de Trasmisión
MSR33
CH34
LTMS INCUBARON
2 H
Hg2+
Centrifugación
Lavo con
tampón
fosfato
Fijadas con
Karnowsky
en tampón
cacodilato
Tetra oxido
de osmio
Deshidratación en
alcohol y acetona
Sumergieron en
una resina epoxi
Secciones
delgadas
Cuchillo de
diamante
Contrastó con
acetato de
uranilo y
citrato de
plomo
Observo con
microscopio
electrónico Zeiss
EM900
Biorremediación de aguas
contaminadas con Hg+
Soluciones Acuosas
Hg2+
Bioreactor
Tioglicolato
MSR33
Sin tioglicolato
2 aguas
residuales
Resistencia a metales pesados
MSR33
LTPMS
Hg2+ CH2Hg+
RESULTADOS-DISCUSIÓN
Detección por PCR de genes
resistente a metales pesados
Detección por electroforesis de MerA y MerB
Efecto de Hg2+ en el crecimiento de
las cepas MSR33 Y CH34
Efecto de Hg+ en la morfología de las células
Efecto de la biorremediación en aguas
contaminadas con Hg2+ utilizando MSR33
Resistencia a metales pesados
CONCLUSIONES:
Se generó una cepa
resistente a metales
pesados, así como a
mercurio tanto inorgánico
como orgánico.
REFERENCIAS
• References
• 1. von Canstein H, Li Y, Timmis KN, Deckwer WD, Wagner-Do¨bler I (1999)
• Removal of mercury from chloralkali electrolysis wastewater by a mercuryresistant
• Pseudomonas putida strain. Appl Environ Microbiol 65: 5279–5284.
• 2. Nealson KH, Belz A, McKee B (2002) Breathing metals as a way of life:
• geobiology in action. Antonie Van Leeuwenhoek 81: 215–222.
• 3. Valls M, de Lorenzo V (2002) Exploiting the genetic and biochemical capacities
• of bacteria for the remediation of heavy metal pollution. FEMS Microbiol Rev
• 26: 327–338.
• 4. Pieper DH, Seeger M (2008) Bacterial metabolism of polychlorinated biphenyls.
• J Mol Microbiol Biotechnol 15: 121–138.
• 5. Morgante V, Lo´pez-Lo´pez A, Flores C, Gonza´lez M, Gonza´lez B, et al. (2010)
• Bioaugmentation with Pseudomonas sp. strain MHP41 promotes simazine
• attenuation and bacterial community changes in agricultural soils. FEMS
• Microbiol Ecol 71: 114–126. Erratum in FEMS Microbiol Ecol (2010) 72: 152.
• 6. Saavedra JM, Acevedo F, Gonza´lez M, Seeger M (2010) Mineralization of
• PCBs by the genetically modified strain Cupriavidus necator JMS34 and its
• application for bioremediation of PCBs in soil. Appl Microbiol Biotechnol 87:
• 1543–1554.
• 7. Nascimento AM, Chartone-Souze E (2003) Operon mer: bacterial resistance to
• mercury and potential for bioremediation of contaminated environments. Genet
• Mol Res 2: 92–101.
• 8. Oehmen A, Fradinho J, Serra S, Carvalho G, Capelo JL, et al. (2009) The effect
• of carbon source on the biological reduction of ionic mercury. J Hazard Mater
• 165: 1040–1048.
• 9. Barkay T, Miller SM, Summers AO (2003) Bacterial mercury resistance from
• atoms to ecosystems. FEMS Microbiol Rev 27: 355–384.
• 10. Wagner-Do¨bler I (2003) Pilot plant for bioremediation of mercury-containing
• industrial wastewater. Appl Microbiol Biotechnol 62: 124–133.
• 11. Fatta D, Canna-Michaelidou S, Michael C, Demetriou Georgiou E,
• Christodoulidou M, et al. (2007) Organochlorine and organophosphoric
• insecticides, herbicides and heavy metals residue in industrial wastewaters in
• Cyprus. J Hazard Mater 145: 169–179.
• 12. Ritter JA, Bibler JP (1992) Removal of mercury from wastewater: large-scale
• performance of an ion exchange process. Wat Sci Technol 25: 165–172.
• 13. Chang JS, Hong J (1994) Biosorption of mercury by the inactivated cells of
• Pseudomonas aeruginosa PU21 (Rip64). Biotechnol Bioeng 44: 999–1006.
• 14. Deckwer WD, Becker FU, Ledakowicz S, Wagner-Do¨bler I (2004) Microbial
• removal of ionic mercury in a three-phase fluidized bed reactor. Environ Sci
• Technol 38: 1858–1865.
• 15. Baldrian P, in der Wiesche C, Gabriel J, Nerud F, Zadrazil F (2000) Influence of
• cadmium and mercury on activities of ligninolytic enzymes and degradation of
• polycyclic aromatic hydrocarbons by Pleurotus ostreatus in soil. Appl Environ
• Microbiol 66: 2471–2478.
• 16. Yurieva O, Kholodii G, Minakhin L, Gorlenko Z, Kalyaeva E, et al. (1997)
• Intercontinental spread of promiscuous mercury-resistance transposons in
• environmental bacteria. Mol Microbiol 24: 321–329.
• 17. Silver S, Phung LT (2005) A bacterial view of the periodic table: genes and
• proteins for toxic inorganic ions. J Ind Microbiol Biotechnol 32: 587–605.
• 18. Kiyono M, Sone Y, Nakamura R, Pan-Hou H, Sakabe K (2009) The MerE
• protein encoded by transposon Tn21 is a broad mercury transporter in
• Escherichia coli. FEBS Lett 583: 1127–1131.
• 19. Moore MJ, Distefano MD, Zydowsky LD, Cummings RT, Walsh CT (1990)
• Organomercurial lyase and mercuric ion reductase: nature’s mercury detoxification
• catalysts. Acc Chem Res 23: 301–308.
• 20. Misra TK (1992) Bacterial resistance to inorganic mercury salts and
• organomercurials. Plasmid 27: 4–16.
• 21. Kiyono M, Pan-Hou H (1999) The merG gene product is involved in
• phenylmercury resistance in Pseudomonas strain K-62. J Bacteriol 181: 762–730.
• 22. Champier L, Duarte V, Michaud-Soret I, Cove`s J (2004) Characterization of the
• MerD protein from Ralstonia metallidurans CH34: a possible role in bacterial
• mercury resistance by switching off the induction of the mer operon. Mol
• Microbiol 52: 1475–1485.
• 23. Ni’Bhriain NN, Silver S, Foster TJ (1983) Tn5 insertion mutations in the
• mercuric ion resistance genes derived from plasmid R100. J Bacteriol 155:
• 690–703.
• 24. Permina EA, Kazakov AE, Kalinina OV, Gelfand MS (2006) Comparative
• genomics of regulation of heavy metal resistance in Eubacteria. BMC Microbiol
• 6: 49–60.
• 25. Brown NL, Stoyanov JV, Kidd SP, Hobman JL (2003) The MerR family of
• transcriptional regulators. FEMS Microbiol Rev 27: 145–163.
• 26. Smalla K, Haines AS, Jones K, Kro¨gerrecklenfort E, Heuer H, et al. (2006)
• Increased abundance of IncP-1b plasmids and mercury resistance genes in
• mercury-polluted river sediments: first discovery of IncP-1b plasmids with a
• complex mer transposon as the sole accessory element. Appl Environ Microbiol
• 72: 7253–7259.
• 27. Mergeay M, Monchy S, Vallaeys T, Auquier V, Benotmane A, et al. (2003)
• Ralstonia metallidurans, a bacterium specifically adapted to toxic metals: towards a
• catalogue of metal-responsive genes. FEMS Microbiol Rev 27: 385–410.
• 28. Mergeay M, Nies D, Schlegel HG, Gerits J, Charles P, et al. (1985) Alcaligenes
• eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to
• heavy metals. J Bacteriol 162: 328–334.
• 29. Monchy S, Benotmane MA, Janssen P, Vallaeys T, Taghavi S, et al. (2007)
• Plasmids pMOL28 and pMOL30 of Cupriavidus metallidurans are specialized in the
• maximal response to heavy metals. J Bacteriol 189: 7417–7425.
• 30. Don RH, Pemberton JM (1981) Properties of six pesticide degradation plasmids
• isolated from Alcaligenes paradoxus and Alcaligenes eutrophus. J Bacteriol 145:
• 681–686.
• 31. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory
• Manual, 2nd Ed., Cold Spring Harbor, New York: Cold Spring Harbor
• Laboratory Press.
• 32. Kado CI, Liu ST (1981) Rapid procedure for detection and isolation of large
• and small plasmids. J Bacteriol 145: 1365–1373.
• 33. Top E, Mergeay M, Springael D, Verstraete W (1990) Gene escape model:
• transfer of heavy metal resistances genes from Escherichia coli to Alcaligenes eutrophus
• on agar plates and in soil samples. Appl Environ Microbiol 56: 2471–2479.
• 34. Liebert CA, Wireman J, Smith T, Summers AO (1997) Phylogeny of mercury
• resistance (mer) operons of gram-negative bacteria isolated from the fecal flora of
• primates. Appl Environ Microbiol 63: 1066–1076.
• 35. Nies A, Nies DH, Silver S (1990) Nucleotide sequence and expression of a
• plasmid-encoded chromate resistance determinant from Alcaligenes eutrophus. J Biol
• Chem 265: 5648–5653.
• 36. Abou-Shanab RA, van Berkum P, Angle JS (2007) Heavy metal resistance and
• genotypic analysis of metal resistances genes in gram-positive and gram-negative
• bacteria present in Ni-rich serpentine soil and in the rhizosphere of Alyssum
• murale. Chemosphere 68: 360–367.
• 37. Lejon DP, Nowak V, Bouko S, Pascault N, Mougel C, et al. (2007)
• Fingerprinting and diversity of bacterial copA genes in response to soil types,
• soil organic status and copper contamination. FEMS Microbiol Ecol 61:
• 424–437.
• 38. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007)
• Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948.
• 39. Ca´mara B, Herrera C, Gonza´lez M, Couve E, Hofer B, et al. (2004) From PCBs
• to highly toxic metabolites by the biphenyl pathway. Environ Microbiol 6:
• 842–850.
• 40. Seeger M, Jerez CA (1993) Phosphate-starvation induced changes in Thiobacillus
• ferrooxidans. FEMS Microbiol Lett 108: 35–42.
• 41. Summers AO, Sugarman LI (1974) Cell-free mercury (II)-reducing activity in a
• plasmid-bearing strain of Escherichia coli. J Bacteriol 119: 242–249.
• 42. Fox B, Walsh CT (1982) Mercuric reductase. Purification and characterization
• of a transposon-encoded flavoprotein containing an oxidation-reduction-active
• disulfide. J Biol Chem 257: 2498–2503.
• 43. Pukall R, Tscha¨pe H, Smalla K (1996) Monitoring the spread of broad host and
• narrow host range plasmids in soil microcosms. FEMS Microbiol Ecol 20:
• 53–66.
• 44. Schlu¨ ter A, Szczepanowski R, Pu¨hler A, Top EM (2007) Genomics of IncP-1
• antibiotic resistance plasmids isolated from wastewater treatment plants provides
• evidence for a widely accessible drug resistance gene pool. FEMS Microbiol Rev
• 31: 449–477.
• 45. Kafri R, Levy M, Pilpel Y (2006) The regulatory utilization of genetic
• redundancy through responsive backup circuits. Proc Natl Acad Sci USA 103:
• 11653–11658.
• 46. Horn JM, Brunke M, Deckwer WD, Timmis KN (1994) Pseudomonas putida
• strains which constitutively overexpress mercury resistance for biodetoxification
• of organomercurial pollutants. Appl Environ Microbiol 60: 357–362.
• 47. Vaituzis Z, Nelson JD, Jr., Wan LW, Colwell RR (1975) Effects of mercuric
• chloride on growth and morphology of selected strains of mercury-resistant
• bacteria. Appl Microbiol 29: 275–286.
• 48. Janssen PJ, van Houdt R, Moors H, Monsieurs P, Morin N, et al. (2010) The
• complete genome sequence of Cupriavidus metallidurans strain CH34, a master
• survivalist in harsh and anthropogenic environments. PLoS ONE 5: e10433.
• doi:10.1371/journal.pone.0010433.
• 49. Schottel JL (1978) The mercuric and organomercurial detoxifying enzymes from
• a plasmid-bearing strain of Escherichia coli. J Biol Chem 253: 4341–4349.
• 50. Nakamura K, Nakahara H (1988) Simplified X-ray film method for detection of
• bacterial volatilization of mercury chloride by Escherichia coli. Appl Environ
• Microbiol 54: 2871–2873.
• 51. Ray S, Gachhui R, Pahan K, Chaudhury J, Mandal A (1989) Detoxification of
• mercury and organomercurials by nitrogen-fixing soil bacteria. J Biosci 14:
• 173–182.
• 52. Nakamura K, Hagimine M, Sakai M, Furukawa K (1999) Removal of mercury
• from mercury-contaminated sediments using a combined method of chemical
• leaching and volatilization of mercury by bacteria. Biodegradation 10: 443–447.
• 53. Okino S, Iwasaki K, Yagi O, Tanaka H (2000) Development of a biological
• mercury removal-recovery system. Biotechnol Lett 22: 783–788.
• 54. Saouter E, Gillman M, Barkay T (1995) An evaluation of mer-specified reduction
• of ionic mercury as a remedial tool of mercury-contaminated freshwater pond.
• J Ind Microbiol 14: 343–348.
• Novel Mercury-Resistant C. metallidurans Strain
• PLoS
GRACIAS

Más contenido relacionado

La actualidad más candente

Laboratorio no. 3 técnicas de inoculación
Laboratorio no. 3  técnicas de inoculaciónLaboratorio no. 3  técnicas de inoculación
Laboratorio no. 3 técnicas de inoculaciónnataliaizurieta
 
3 caracteristicas generales de los hongos
3 caracteristicas generales de los hongos3 caracteristicas generales de los hongos
3 caracteristicas generales de los hongosTania Acevedo-Villar
 
Orientación para la identificación bacteriana y el procesamiento de muestras ...
Orientación para la identificación bacteriana y el procesamiento de muestras ...Orientación para la identificación bacteriana y el procesamiento de muestras ...
Orientación para la identificación bacteriana y el procesamiento de muestras ...Andrea Villagra
 
Toxicología regulatoria (presentación de la unidad)
Toxicología regulatoria (presentación de la unidad)Toxicología regulatoria (presentación de la unidad)
Toxicología regulatoria (presentación de la unidad)Educapapyrus S.A
 
Crecimiento microbiano
Crecimiento microbianoCrecimiento microbiano
Crecimiento microbianoLuisNoche
 
Espectroscopia de emision I
Espectroscopia de emision IEspectroscopia de emision I
Espectroscopia de emision IAlex Santiago
 
2.1 estreptococcos y enterococcus
2.1 estreptococcos y enterococcus2.1 estreptococcos y enterococcus
2.1 estreptococcos y enterococcusCarlos Morales M
 
Coliformes ecb 2013
Coliformes ecb 2013Coliformes ecb 2013
Coliformes ecb 2013Leslie Yaya
 
Microscopia y tinción
Microscopia y tinciónMicroscopia y tinción
Microscopia y tinciónReila Lilith
 
215 guia para la identificacion de las bacteria
215 guia para la identificacion de las bacteria215 guia para la identificacion de las bacteria
215 guia para la identificacion de las bacteriaBiohazardoa
 
Crecimiento microbiano
Crecimiento microbianoCrecimiento microbiano
Crecimiento microbianoIPN
 
Metodos de identificacion bacteriana en el laboratorio de microbiologia
Metodos de identificacion bacteriana en el laboratorio de microbiologiaMetodos de identificacion bacteriana en el laboratorio de microbiologia
Metodos de identificacion bacteriana en el laboratorio de microbiologiaIPN
 
Microbiología del agua
Microbiología del aguaMicrobiología del agua
Microbiología del aguaguest6e00ca1
 
Laboratorio no. 4 recuento bacteriano
Laboratorio no. 4   recuento bacterianoLaboratorio no. 4   recuento bacteriano
Laboratorio no. 4 recuento bacterianonataliaizurieta
 
Mohos importancia en los alimentos
Mohos importancia en los alimentosMohos importancia en los alimentos
Mohos importancia en los alimentosHans J
 

La actualidad más candente (20)

Laboratorio no. 3 técnicas de inoculación
Laboratorio no. 3  técnicas de inoculaciónLaboratorio no. 3  técnicas de inoculación
Laboratorio no. 3 técnicas de inoculación
 
3 caracteristicas generales de los hongos
3 caracteristicas generales de los hongos3 caracteristicas generales de los hongos
3 caracteristicas generales de los hongos
 
Crecimiento microbiano
Crecimiento microbianoCrecimiento microbiano
Crecimiento microbiano
 
Mc farland
Mc farlandMc farland
Mc farland
 
Orientación para la identificación bacteriana y el procesamiento de muestras ...
Orientación para la identificación bacteriana y el procesamiento de muestras ...Orientación para la identificación bacteriana y el procesamiento de muestras ...
Orientación para la identificación bacteriana y el procesamiento de muestras ...
 
Toxicología regulatoria (presentación de la unidad)
Toxicología regulatoria (presentación de la unidad)Toxicología regulatoria (presentación de la unidad)
Toxicología regulatoria (presentación de la unidad)
 
Crecimiento microbiano
Crecimiento microbianoCrecimiento microbiano
Crecimiento microbiano
 
Espectroscopia de emision I
Espectroscopia de emision IEspectroscopia de emision I
Espectroscopia de emision I
 
2.1 estreptococcos y enterococcus
2.1 estreptococcos y enterococcus2.1 estreptococcos y enterococcus
2.1 estreptococcos y enterococcus
 
Geohelmintosis en México
Geohelmintosis en MéxicoGeohelmintosis en México
Geohelmintosis en México
 
Coliformes ecb 2013
Coliformes ecb 2013Coliformes ecb 2013
Coliformes ecb 2013
 
Microscopia y tinción
Microscopia y tinciónMicroscopia y tinción
Microscopia y tinción
 
215 guia para la identificacion de las bacteria
215 guia para la identificacion de las bacteria215 guia para la identificacion de las bacteria
215 guia para la identificacion de las bacteria
 
Crecimiento microbiano
Crecimiento microbianoCrecimiento microbiano
Crecimiento microbiano
 
Metodos de identificacion bacteriana en el laboratorio de microbiologia
Metodos de identificacion bacteriana en el laboratorio de microbiologiaMetodos de identificacion bacteriana en el laboratorio de microbiologia
Metodos de identificacion bacteriana en el laboratorio de microbiologia
 
Microbiología del agua
Microbiología del aguaMicrobiología del agua
Microbiología del agua
 
Laboratorio no. 4 recuento bacteriano
Laboratorio no. 4   recuento bacterianoLaboratorio no. 4   recuento bacteriano
Laboratorio no. 4 recuento bacteriano
 
Cromatografia de gases
Cromatografia de gasesCromatografia de gases
Cromatografia de gases
 
Mohos importancia en los alimentos
Mohos importancia en los alimentosMohos importancia en los alimentos
Mohos importancia en los alimentos
 
Toxicidad
ToxicidadToxicidad
Toxicidad
 

Similar a Caracterización del metabolismo modificado metal pesado resistente de cupriavidus

PresentationNo 3 German japan
PresentationNo 3 German japanPresentationNo 3 German japan
PresentationNo 3 German japanKonstantin German
 
Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...
Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...
Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...Dr. Asaad الأولAl-Taee
 
ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...
ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...
ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...IRJET Journal
 
Adsorption of mercury metal using modified vermicompost biochar
Adsorption of mercury metal using modified vermicompost biocharAdsorption of mercury metal using modified vermicompost biochar
Adsorption of mercury metal using modified vermicompost biocharRavindra Kumar Kachhap Oraon
 
Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...
Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...
Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...Salah Hussein
 
4. optimization of culture condition for enhanced decolorization of reactive ...
4. optimization of culture condition for enhanced decolorization of reactive ...4. optimization of culture condition for enhanced decolorization of reactive ...
4. optimization of culture condition for enhanced decolorization of reactive ...Darshan Rudakiya
 
Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...
Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...
Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...IOSR Journals
 
Origin and function of a metal resistance gene isolated from eukaryotic soil ...
Origin and function of a metal resistance gene isolated from eukaryotic soil ...Origin and function of a metal resistance gene isolated from eukaryotic soil ...
Origin and function of a metal resistance gene isolated from eukaryotic soil ...Antoine Ziller
 
Biosorption of some Heavy Metals by Metal Resistant Bacillus.PDF
Biosorption of some Heavy Metals by Metal Resistant Bacillus.PDFBiosorption of some Heavy Metals by Metal Resistant Bacillus.PDF
Biosorption of some Heavy Metals by Metal Resistant Bacillus.PDFDr. Asaad الأولAl-Taee
 
A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...
A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...
A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...Deja Lewis
 
2. evaluation of remediation in heavy metal tolerance and removal by comamona...
2. evaluation of remediation in heavy metal tolerance and removal by comamona...2. evaluation of remediation in heavy metal tolerance and removal by comamona...
2. evaluation of remediation in heavy metal tolerance and removal by comamona...Darshan Rudakiya
 
ICCA -2013 CONF. Presentation1
ICCA -2013 CONF. Presentation1ICCA -2013 CONF. Presentation1
ICCA -2013 CONF. Presentation1Elisee Bakatula
 
M.Tech. thesis presentation
M.Tech. thesis presentationM.Tech. thesis presentation
M.Tech. thesis presentationSayan Sarkar
 

Similar a Caracterización del metabolismo modificado metal pesado resistente de cupriavidus (20)

PresentationNo 3 German japan
PresentationNo 3 German japanPresentationNo 3 German japan
PresentationNo 3 German japan
 
Bioaccumulation of Shewanella oneidensis
Bioaccumulation of Shewanella oneidensisBioaccumulation of Shewanella oneidensis
Bioaccumulation of Shewanella oneidensis
 
Presentation Nev
Presentation NevPresentation Nev
Presentation Nev
 
Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...
Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...
Biosorption of some Heavy Metals by Deinococcus radiodurans Isolated from Soi...
 
ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...
ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...
ANALYSIS OF HYDROGEOCHEMICAL AND MINERALOGICAL CHARACTERISTICS RELATED TO HEA...
 
Adsorption of mercury metal using modified vermicompost biochar
Adsorption of mercury metal using modified vermicompost biocharAdsorption of mercury metal using modified vermicompost biochar
Adsorption of mercury metal using modified vermicompost biochar
 
Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...
Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...
Degradation of an organophosphorus insecticide (chlorpyrifos) in simulated wa...
 
4. optimization of culture condition for enhanced decolorization of reactive ...
4. optimization of culture condition for enhanced decolorization of reactive ...4. optimization of culture condition for enhanced decolorization of reactive ...
4. optimization of culture condition for enhanced decolorization of reactive ...
 
1
11
1
 
Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...
Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...
Synthesis, spectroscopic, magnetic properties and superoxide dismutase (SOD) ...
 
Origin and function of a metal resistance gene isolated from eukaryotic soil ...
Origin and function of a metal resistance gene isolated from eukaryotic soil ...Origin and function of a metal resistance gene isolated from eukaryotic soil ...
Origin and function of a metal resistance gene isolated from eukaryotic soil ...
 
Biosorption of some Heavy Metals by Metal Resistant Bacillus.PDF
Biosorption of some Heavy Metals by Metal Resistant Bacillus.PDFBiosorption of some Heavy Metals by Metal Resistant Bacillus.PDF
Biosorption of some Heavy Metals by Metal Resistant Bacillus.PDF
 
Fc24961966
Fc24961966Fc24961966
Fc24961966
 
20320140501007
2032014050100720320140501007
20320140501007
 
A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...
A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...
A Plant Genetically Modified That Accumulates Pb Is Especially Promising For ...
 
2. evaluation of remediation in heavy metal tolerance and removal by comamona...
2. evaluation of remediation in heavy metal tolerance and removal by comamona...2. evaluation of remediation in heavy metal tolerance and removal by comamona...
2. evaluation of remediation in heavy metal tolerance and removal by comamona...
 
ICCA -2013 CONF. Presentation1
ICCA -2013 CONF. Presentation1ICCA -2013 CONF. Presentation1
ICCA -2013 CONF. Presentation1
 
M.Tech. thesis presentation
M.Tech. thesis presentationM.Tech. thesis presentation
M.Tech. thesis presentation
 
Mudasir Presentation.pptx
Mudasir Presentation.pptxMudasir Presentation.pptx
Mudasir Presentation.pptx
 
Assessment of Cadmium, Lead and Nickel Removal Capacity of Lactic Acid Bacter...
Assessment of Cadmium, Lead and Nickel Removal Capacity of Lactic Acid Bacter...Assessment of Cadmium, Lead and Nickel Removal Capacity of Lactic Acid Bacter...
Assessment of Cadmium, Lead and Nickel Removal Capacity of Lactic Acid Bacter...
 

Más de Dayanis Sanchez

Más de Dayanis Sanchez (11)

Estudio de fermentación
Estudio de fermentaciónEstudio de fermentación
Estudio de fermentación
 
Antibióticos
AntibióticosAntibióticos
Antibióticos
 
Células de mamíferos
Células de mamíferos Células de mamíferos
Células de mamíferos
 
Cestodos ppt
Cestodos pptCestodos ppt
Cestodos ppt
 
SINTESIS DE AMINOÁCIDOS
SINTESIS DE AMINOÁCIDOSSINTESIS DE AMINOÁCIDOS
SINTESIS DE AMINOÁCIDOS
 
Toxicología forense
Toxicología forenseToxicología forense
Toxicología forense
 
Virus de inmunodeficiencia humana
Virus de inmunodeficiencia humana Virus de inmunodeficiencia humana
Virus de inmunodeficiencia humana
 
La eutanasia bioetica
La eutanasia bioeticaLa eutanasia bioetica
La eutanasia bioetica
 
Actividad antimicrobiana
Actividad antimicrobiana Actividad antimicrobiana
Actividad antimicrobiana
 
Plaguicidas
Plaguicidas Plaguicidas
Plaguicidas
 
microbiología inicios
microbiología iniciosmicrobiología inicios
microbiología inicios
 

Último

Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426jennyeacort
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...Sheetaleventcompany
 
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls ServiceGENUINE ESCORT AGENCY
 
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...Namrata Singh
 
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...Sheetaleventcompany
 
Kollam call girls Mallu aunty service 7877702510
Kollam call girls Mallu aunty service 7877702510Kollam call girls Mallu aunty service 7877702510
Kollam call girls Mallu aunty service 7877702510Vipesco
 
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Amritsar Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Amritsar Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Amritsar Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Amritsar Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...adilkhan87451
 
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableGENUINE ESCORT AGENCY
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...parulsinha
 
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...chetankumar9855
 
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...Sheetaleventcompany
 
Call Girls Mumbai Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mumbai Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Mumbai Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mumbai Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service AvailableCall Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service AvailableJanvi Singh
 
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...chandars293
 
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 

Último (20)

Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
 
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
 
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
💚Call Girls In Amritsar 💯Anvi 📲🔝8725944379🔝Amritsar Call Girl No💰Advance Cash...
 
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
 
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
Call Girls Kolkata Kalikapur 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Girl Se...
 
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
Low Rate Call Girls Bangalore {7304373326} ❤️VVIP NISHA Call Girls in Bangalo...
 
Kollam call girls Mallu aunty service 7877702510
Kollam call girls Mallu aunty service 7877702510Kollam call girls Mallu aunty service 7877702510
Kollam call girls Mallu aunty service 7877702510
 
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
 
Call Girls Amritsar Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Amritsar Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Amritsar Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Amritsar Just Call 8250077686 Top Class Call Girl Service Available
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
 
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
 
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
Call Girl In Pune 👉 Just CALL ME: 9352988975 💋 Call Out Call Both With High p...
 
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
Dehradun Call Girls Service {8854095900} ❤️VVIP ROCKY Call Girl in Dehradun U...
 
Call Girls Mumbai Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mumbai Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Mumbai Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mumbai Just Call 8250077686 Top Class Call Girl Service Available
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service AvailableCall Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
Call Girls Jaipur Just Call 9521753030 Top Class Call Girl Service Available
 
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...Top Rated  Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
Top Rated Hyderabad Call Girls Chintal ⟟ 9332606886 ⟟ Call Me For Genuine Se...
 
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
 

Caracterización del metabolismo modificado metal pesado resistente de cupriavidus

  • 1. Caracterización Metabólica Modificada de la resistencia a metales pesados de la Cupriavidus metallidurans cepa MSR33 . Generada para la biorremediación del mercurio. Rojas Luis y col.
  • 2. El mercurio es uno de los elementos mas tóxicos en el medio ambiente. Para contrarrestar sus efectos se han realizados procesos fisicoquímicos tales como: el intercambio iónico y precipitación. A su vez procesos biológicos para su eliminación, los cuales se han impuesto sobre los anteriores. En bacterias existen genes de resistencia a mercurio conocidos como “mer” los cuales se organizan en operones. Operones como merRTPADE confieren resistencia solo a mercurio inorgánico y como mer RTPAGBDE confiere resistencia tanto a mercurio orgánico como inorgánico. En este estudio se utilizara la cepa CH34 Metallidurans Cupriavidus, esta alberga dos grandes plásmidos: pMOL28 y Pmol30, los cuales tienen determinantes genéticos de resistencia a metales pesados. Ambos poseen el operon merRTPADE, para mejorar la resistencia se introdujo en la cepa CH34 el plasmido Ptp6 IncP-1β, lo que originó una cepa trasconjugante MSR33 la cual fue capaz de eliminar el mercurio de aguas contaminada. INTRODUCCIÓN
  • 3. Objetivos: • General: Caracterizar el metabolismo modificado que dá resistencia a metales pesados de la Cupriavidus Metallidurans cepa MSR33. • Específico: Generación de una cepa bacteriana con resistencia a metales pesados y a su vez a mercurio orgánico e inorgánico.
  • 4. HIPÓTESIS • LA CEPA MRS33 CONTIENE LAS CARACTERISTICAS DE UN METABOLISMO MODIFICADO PARA LA ELIMINACIÓN DEL MERCURIO
  • 5.
  • 6. Materiales • HgCl2 (analytical grade), CuSO4?5H2O, K2CrO4, NaBH4, • NaOH, HCl (Suprapur) and standard Titrisol solution were • obtained from Merck (Darmstadt, Germany). CH3HgCl (analytical • grade) were obtained from Sigma Aldrich (Saint Louis, MO, • USA). Stock solutions of Cu2+ • (5,000 mg ml21); CrO4 • 22 (2,500 mg • ml21); Hg2+ • (1,000 mg ml21) and CH3Hg • + • (100 mg ml21) were • prepared. NaBH4 solution (0.25%) was prepared in NaOH (0.4%) • solution. High purity hydrochloric acid was used for mercury • dilutions before quantification by inductively coupled plasma • optical emission spectrometer (ICP-OES). Sodium succinate and • salts for media preparation were obtained from Merck (Darmstadt, • Germany). Taq DNA polymerase and bovine serum albumin for • PCR were obtained from Invitrogen (Carlsbad, CA, USA). RNA • was extracted using an RNeasy Protect Bacteria Mini kit from • Qiagen (Hilden, Germany). For RNA quantification the QuantiT • TM RNA Assay kit from Invitrogen (Carlsbad, CA, USA) was • used. RT-PCR was performed using SuperScriptTM III One-Step
  • 7. • Tampón TAE: 0.04 M Tris, 0.04 M de acetato, 0.001 M EDTA, ph=8. • PCA: filtro estéril sobre agar para recuento en placa
  • 8. Medios LB: • 10g de triptona • 5g de levadura • 10 g de NaCl LPTMS: • 6.06 g de tris • 4.68 g de NaCl • 1.49 g de KCL • 1.07 g NH4CL • 0.43G Na2SO4 • 0.2 MgCl2.H20 • 003g CaCl2. 2H20 • 0.23g Na2HPO4.12H2O • 0.005g Fe(III) NH4 • 1 ml de solución de elementos traza
  • 10. Purificación del DNA LISIS DE CÉLULAS DETERGENTES ANIÓNICOS CONSERVANTES QUE IMPIDEN LA ACCIÓN DE DNasas RNasas Eliminar el RNA PRECIPITACIÓN SALINA ELIMINAR PROTEÍNAS Y CONTAMINANTES CELULARES PRECIPITACIÓNALCOHOL SOLUCIÓN TAMPONADA EN PRESENCIA DE CONSERVANTES
  • 11. Extracción del plásmido Enzimas de restricción que cortan lugares específicos http://www.ncbi.nlm.nih.gov/pmc/articles/PM C217141/pdf/jbacter00274-0253.pdf http://www.uco.es/organiza/departamentos/b ioquimica-biol- mol/pdfs/43%20PURIFICACI%C3%93N%20AN% C3%81LISIS%20DNA%20BACTERIANO.pdf
  • 12. Estabilidad del plásmido Una colonia de MSR33 25 ml LB24 h a 28° C Sembró en PCA 6 Réplicas Se selecciono 48 colonias Hg 2+ 5 de ellas resistentes Y esparcidas por 70 generaciones
  • 13. PTP6 E. coli JM 109 CH34 C. metallidurans MSR33 PCA Selección LPTMS 28° c 0.3 %Succinato Hg2+PCR GENERACIÓN DE CEPAS BACTERIANAS TRANCONJUGANTES Purificación de Dna y extracción del plásmidos
  • 14. Presencia genes de resistencia a metales pesados. Gen MerB: 5’ TCGCCCCATATATTTTAGAAC 3’ 5’ GTCGGGACAGATGCAAAGAAA 3’ Gen ChrB: 5’ GTCGTTAGCTTGCCAACATC 3’ 5’CGGAAAGCAAGATGTCGAATCG 3’ Gen CopA: 5’ GGSABTACTGGTRBCAC 3’ 5’ TGNGHCATCATSGTRTCRTT 3’ residuos de PCR Gel de agarosa Tampón TAE Plásmidos
  • 15. Síntesis de MerA y MerB en MSR33 MSR33 LB Cosechadas en fase exponencial Se lavó 2 veces con tampón fosfato 1 L/ 5 mg Se colocó en ebullición durante 5 minutos Centrifugación 4°C10 min Cuantificación de proteínas Electroforesis FluorómetroTinción azul brillante
  • 16. Efecto de Hg2+ en el crecimiento de las células CH34 MSR33 LPTMS SUCCINATO CON Y SIN Hg 2+ EXPUESTAS A FASE INCIAL Y A FASE EXPONENCIAL
  • 17. Microscopia electrónica de Trasmisión MSR33 CH34 LTMS INCUBARON 2 H Hg2+ Centrifugación Lavo con tampón fosfato Fijadas con Karnowsky en tampón cacodilato Tetra oxido de osmio Deshidratación en alcohol y acetona Sumergieron en una resina epoxi Secciones delgadas Cuchillo de diamante Contrastó con acetato de uranilo y citrato de plomo Observo con microscopio electrónico Zeiss EM900
  • 18. Biorremediación de aguas contaminadas con Hg+ Soluciones Acuosas Hg2+ Bioreactor Tioglicolato MSR33 Sin tioglicolato 2 aguas residuales
  • 19. Resistencia a metales pesados MSR33 LTPMS Hg2+ CH2Hg+
  • 21. Detección por PCR de genes resistente a metales pesados
  • 23. Efecto de Hg2+ en el crecimiento de las cepas MSR33 Y CH34
  • 24. Efecto de Hg+ en la morfología de las células
  • 25. Efecto de la biorremediación en aguas contaminadas con Hg2+ utilizando MSR33
  • 27. CONCLUSIONES: Se generó una cepa resistente a metales pesados, así como a mercurio tanto inorgánico como orgánico.
  • 28. REFERENCIAS • References • 1. von Canstein H, Li Y, Timmis KN, Deckwer WD, Wagner-Do¨bler I (1999) • Removal of mercury from chloralkali electrolysis wastewater by a mercuryresistant • Pseudomonas putida strain. Appl Environ Microbiol 65: 5279–5284. • 2. Nealson KH, Belz A, McKee B (2002) Breathing metals as a way of life: • geobiology in action. Antonie Van Leeuwenhoek 81: 215–222. • 3. Valls M, de Lorenzo V (2002) Exploiting the genetic and biochemical capacities • of bacteria for the remediation of heavy metal pollution. FEMS Microbiol Rev • 26: 327–338. • 4. Pieper DH, Seeger M (2008) Bacterial metabolism of polychlorinated biphenyls. • J Mol Microbiol Biotechnol 15: 121–138. • 5. Morgante V, Lo´pez-Lo´pez A, Flores C, Gonza´lez M, Gonza´lez B, et al. (2010) • Bioaugmentation with Pseudomonas sp. strain MHP41 promotes simazine • attenuation and bacterial community changes in agricultural soils. FEMS • Microbiol Ecol 71: 114–126. Erratum in FEMS Microbiol Ecol (2010) 72: 152. • 6. Saavedra JM, Acevedo F, Gonza´lez M, Seeger M (2010) Mineralization of • PCBs by the genetically modified strain Cupriavidus necator JMS34 and its • application for bioremediation of PCBs in soil. Appl Microbiol Biotechnol 87: • 1543–1554. • 7. Nascimento AM, Chartone-Souze E (2003) Operon mer: bacterial resistance to • mercury and potential for bioremediation of contaminated environments. Genet • Mol Res 2: 92–101. • 8. Oehmen A, Fradinho J, Serra S, Carvalho G, Capelo JL, et al. (2009) The effect • of carbon source on the biological reduction of ionic mercury. J Hazard Mater • 165: 1040–1048. • 9. Barkay T, Miller SM, Summers AO (2003) Bacterial mercury resistance from • atoms to ecosystems. FEMS Microbiol Rev 27: 355–384. • 10. Wagner-Do¨bler I (2003) Pilot plant for bioremediation of mercury-containing • industrial wastewater. Appl Microbiol Biotechnol 62: 124–133. • 11. Fatta D, Canna-Michaelidou S, Michael C, Demetriou Georgiou E, • Christodoulidou M, et al. (2007) Organochlorine and organophosphoric • insecticides, herbicides and heavy metals residue in industrial wastewaters in • Cyprus. J Hazard Mater 145: 169–179. • 12. Ritter JA, Bibler JP (1992) Removal of mercury from wastewater: large-scale • performance of an ion exchange process. Wat Sci Technol 25: 165–172. • 13. Chang JS, Hong J (1994) Biosorption of mercury by the inactivated cells of • Pseudomonas aeruginosa PU21 (Rip64). Biotechnol Bioeng 44: 999–1006. • 14. Deckwer WD, Becker FU, Ledakowicz S, Wagner-Do¨bler I (2004) Microbial • removal of ionic mercury in a three-phase fluidized bed reactor. Environ Sci • Technol 38: 1858–1865. • 15. Baldrian P, in der Wiesche C, Gabriel J, Nerud F, Zadrazil F (2000) Influence of • cadmium and mercury on activities of ligninolytic enzymes and degradation of • polycyclic aromatic hydrocarbons by Pleurotus ostreatus in soil. Appl Environ • Microbiol 66: 2471–2478. • 16. Yurieva O, Kholodii G, Minakhin L, Gorlenko Z, Kalyaeva E, et al. (1997) • Intercontinental spread of promiscuous mercury-resistance transposons in • environmental bacteria. Mol Microbiol 24: 321–329. • 17. Silver S, Phung LT (2005) A bacterial view of the periodic table: genes and • proteins for toxic inorganic ions. J Ind Microbiol Biotechnol 32: 587–605. • 18. Kiyono M, Sone Y, Nakamura R, Pan-Hou H, Sakabe K (2009) The MerE • protein encoded by transposon Tn21 is a broad mercury transporter in • Escherichia coli. FEBS Lett 583: 1127–1131. • 19. Moore MJ, Distefano MD, Zydowsky LD, Cummings RT, Walsh CT (1990) • Organomercurial lyase and mercuric ion reductase: nature’s mercury detoxification • catalysts. Acc Chem Res 23: 301–308. • 20. Misra TK (1992) Bacterial resistance to inorganic mercury salts and • organomercurials. Plasmid 27: 4–16. • 21. Kiyono M, Pan-Hou H (1999) The merG gene product is involved in • phenylmercury resistance in Pseudomonas strain K-62. J Bacteriol 181: 762–730. • 22. Champier L, Duarte V, Michaud-Soret I, Cove`s J (2004) Characterization of the • MerD protein from Ralstonia metallidurans CH34: a possible role in bacterial • mercury resistance by switching off the induction of the mer operon. Mol • Microbiol 52: 1475–1485. • 23. Ni’Bhriain NN, Silver S, Foster TJ (1983) Tn5 insertion mutations in the • mercuric ion resistance genes derived from plasmid R100. J Bacteriol 155: • 690–703. • 24. Permina EA, Kazakov AE, Kalinina OV, Gelfand MS (2006) Comparative • genomics of regulation of heavy metal resistance in Eubacteria. BMC Microbiol • 6: 49–60. • 25. Brown NL, Stoyanov JV, Kidd SP, Hobman JL (2003) The MerR family of • transcriptional regulators. FEMS Microbiol Rev 27: 145–163. • 26. Smalla K, Haines AS, Jones K, Kro¨gerrecklenfort E, Heuer H, et al. (2006) • Increased abundance of IncP-1b plasmids and mercury resistance genes in • mercury-polluted river sediments: first discovery of IncP-1b plasmids with a • complex mer transposon as the sole accessory element. Appl Environ Microbiol • 72: 7253–7259. • 27. Mergeay M, Monchy S, Vallaeys T, Auquier V, Benotmane A, et al. (2003) • Ralstonia metallidurans, a bacterium specifically adapted to toxic metals: towards a • catalogue of metal-responsive genes. FEMS Microbiol Rev 27: 385–410. • 28. Mergeay M, Nies D, Schlegel HG, Gerits J, Charles P, et al. (1985) Alcaligenes • eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to • heavy metals. J Bacteriol 162: 328–334. • 29. Monchy S, Benotmane MA, Janssen P, Vallaeys T, Taghavi S, et al. (2007) • Plasmids pMOL28 and pMOL30 of Cupriavidus metallidurans are specialized in the • maximal response to heavy metals. J Bacteriol 189: 7417–7425. • 30. Don RH, Pemberton JM (1981) Properties of six pesticide degradation plasmids • isolated from Alcaligenes paradoxus and Alcaligenes eutrophus. J Bacteriol 145: • 681–686.
  • 29. • 31. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory • Manual, 2nd Ed., Cold Spring Harbor, New York: Cold Spring Harbor • Laboratory Press. • 32. Kado CI, Liu ST (1981) Rapid procedure for detection and isolation of large • and small plasmids. J Bacteriol 145: 1365–1373. • 33. Top E, Mergeay M, Springael D, Verstraete W (1990) Gene escape model: • transfer of heavy metal resistances genes from Escherichia coli to Alcaligenes eutrophus • on agar plates and in soil samples. Appl Environ Microbiol 56: 2471–2479. • 34. Liebert CA, Wireman J, Smith T, Summers AO (1997) Phylogeny of mercury • resistance (mer) operons of gram-negative bacteria isolated from the fecal flora of • primates. Appl Environ Microbiol 63: 1066–1076. • 35. Nies A, Nies DH, Silver S (1990) Nucleotide sequence and expression of a • plasmid-encoded chromate resistance determinant from Alcaligenes eutrophus. J Biol • Chem 265: 5648–5653. • 36. Abou-Shanab RA, van Berkum P, Angle JS (2007) Heavy metal resistance and • genotypic analysis of metal resistances genes in gram-positive and gram-negative • bacteria present in Ni-rich serpentine soil and in the rhizosphere of Alyssum • murale. Chemosphere 68: 360–367. • 37. Lejon DP, Nowak V, Bouko S, Pascault N, Mougel C, et al. (2007) • Fingerprinting and diversity of bacterial copA genes in response to soil types, • soil organic status and copper contamination. FEMS Microbiol Ecol 61: • 424–437. • 38. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) • Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. • 39. Ca´mara B, Herrera C, Gonza´lez M, Couve E, Hofer B, et al. (2004) From PCBs • to highly toxic metabolites by the biphenyl pathway. Environ Microbiol 6: • 842–850. • 40. Seeger M, Jerez CA (1993) Phosphate-starvation induced changes in Thiobacillus • ferrooxidans. FEMS Microbiol Lett 108: 35–42. • 41. Summers AO, Sugarman LI (1974) Cell-free mercury (II)-reducing activity in a • plasmid-bearing strain of Escherichia coli. J Bacteriol 119: 242–249. • 42. Fox B, Walsh CT (1982) Mercuric reductase. Purification and characterization • of a transposon-encoded flavoprotein containing an oxidation-reduction-active • disulfide. J Biol Chem 257: 2498–2503. • 43. Pukall R, Tscha¨pe H, Smalla K (1996) Monitoring the spread of broad host and • narrow host range plasmids in soil microcosms. FEMS Microbiol Ecol 20: • 53–66. • 44. Schlu¨ ter A, Szczepanowski R, Pu¨hler A, Top EM (2007) Genomics of IncP-1 • antibiotic resistance plasmids isolated from wastewater treatment plants provides • evidence for a widely accessible drug resistance gene pool. FEMS Microbiol Rev • 31: 449–477. • 45. Kafri R, Levy M, Pilpel Y (2006) The regulatory utilization of genetic • redundancy through responsive backup circuits. Proc Natl Acad Sci USA 103: • 11653–11658. • 46. Horn JM, Brunke M, Deckwer WD, Timmis KN (1994) Pseudomonas putida • strains which constitutively overexpress mercury resistance for biodetoxification • of organomercurial pollutants. Appl Environ Microbiol 60: 357–362. • 47. Vaituzis Z, Nelson JD, Jr., Wan LW, Colwell RR (1975) Effects of mercuric • chloride on growth and morphology of selected strains of mercury-resistant • bacteria. Appl Microbiol 29: 275–286. • 48. Janssen PJ, van Houdt R, Moors H, Monsieurs P, Morin N, et al. (2010) The • complete genome sequence of Cupriavidus metallidurans strain CH34, a master • survivalist in harsh and anthropogenic environments. PLoS ONE 5: e10433. • doi:10.1371/journal.pone.0010433. • 49. Schottel JL (1978) The mercuric and organomercurial detoxifying enzymes from • a plasmid-bearing strain of Escherichia coli. J Biol Chem 253: 4341–4349. • 50. Nakamura K, Nakahara H (1988) Simplified X-ray film method for detection of • bacterial volatilization of mercury chloride by Escherichia coli. Appl Environ • Microbiol 54: 2871–2873. • 51. Ray S, Gachhui R, Pahan K, Chaudhury J, Mandal A (1989) Detoxification of • mercury and organomercurials by nitrogen-fixing soil bacteria. J Biosci 14: • 173–182. • 52. Nakamura K, Hagimine M, Sakai M, Furukawa K (1999) Removal of mercury • from mercury-contaminated sediments using a combined method of chemical • leaching and volatilization of mercury by bacteria. Biodegradation 10: 443–447. • 53. Okino S, Iwasaki K, Yagi O, Tanaka H (2000) Development of a biological • mercury removal-recovery system. Biotechnol Lett 22: 783–788. • 54. Saouter E, Gillman M, Barkay T (1995) An evaluation of mer-specified reduction • of ionic mercury as a remedial tool of mercury-contaminated freshwater pond. • J Ind Microbiol 14: 343–348. • Novel Mercury-Resistant C. metallidurans Strain • PLoS