SlideShare a Scribd company logo
1 of 1
Download to read offline
Can someone please help me with these questions and also explain the answer for 1. Most
sequencing method require the amplification of target DNA. Which of the following primer pairs
would be the most appropriate to amplify this sequence for sequencing?
GCAGGAGTTTCAAACTTTACGACACATAATAAAAGTAGTAAATAATAATGACAGTA
TCTCAAATCAG
TGCAGGGGGGAAAGGCCTACTAATACCTTACCACCCTAGAAAGGCATGATGAAAAT
TTAAGATAGA
AGGAAAATATAAATTGAAAAAAAAAAACCTAAATATTCTAAGAAAAAAGGAATCTA
GTTTGTCAAAA
TGTGACTTGAATTAATAGATAAGGAGAGTCACTTAACAAATGATTCTGACAAATATC
TTCTCTTTCCA
GGGAGAATCACTGAGCCAGAATAAAATTGAACAGATGATAAGAGGGTCAAAATTAT
GTTTATCTTA
GGAAAAGTAGAATAGAAAATTTATAAGCAGATTAAAATTTTCCCAACATTCTTGTGA
AATATGACA
CATCCCAATCTTAACAGATGTGATGGTGGGATAATTGGATAGCAATATGGGAAAAG
ATATATTTAAT
TTCCGTTGCTACACCAAATGCCATCATTTGGGATACTGTACTTGTGAGTGGAAGTGT
GGTACTATTTC ACCAAATGCCA A B C
You are planning a Next Generation Sequencing (NGS) experiment to study the mechanism of
tumorigenesis. Formation of tumor could happen due to overexpression of an oncogene,
translocation leading to a fusion gene or reduced expression of tumor suppressor gene. Which of
the following order of NGS experiments would be most appropriate? A. WGS--MethylSeq--
RNASeq--CLiPSeq B. MethylSeq-WES-RNASeq-CLiPSeq C. WES-- MethylSeq-RNASeq-
CliPSeq D. RNASeq-WES-MethylSeq--CliPSeq

More Related Content

More from sales88

Caso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdf
Caso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdfCaso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdf
Caso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdfsales88
 
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdfCASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdfsales88
 
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdfCASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdfsales88
 
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdfCaso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdfsales88
 
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdfCaso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdfsales88
 
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdfCaso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdfsales88
 
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdfCaso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdfsales88
 
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdfCaso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdfsales88
 
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdfCaso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdfsales88
 
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdfCaso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdfsales88
 
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdfCaso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdfsales88
 
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdfCaso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdfsales88
 
Case studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdfCase studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdfsales88
 
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdfCASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdfsales88
 
case study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdfcase study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdfsales88
 
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdfCase Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdfsales88
 
Case Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdfCase Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdfsales88
 
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdfCase Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdfsales88
 
Case presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdfCase presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdfsales88
 
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdfCap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdfsales88
 

More from sales88 (20)

Caso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdf
Caso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdfCaso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdf
Caso de estudio Hacer que las alianzas estrat�gicas y las redes f.pdf
 
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdfCASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
CASO DE ESTUDIO La cl�nica Mayo es uno de los nombres m�s respetad.pdf
 
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdfCASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
CASO DE ESTUDIO La �pera de Sydney es uno de los edificios ic�nico.pdf
 
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdfCaso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
Caso de estudio Despu�s de luchar con la deuda y la fuerte compete.pdf
 
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdfCaso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
Caso cl�nicoSDRAPregunta 1.Dados sus s�ntomas de fatiga, disne.pdf
 
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdfCaso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
Caso 21-3 Orden de prueba de deterioro Five Star Hotel Corporati.pdf
 
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdfCaso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
Caso 6.2 Seguro Mar�timo Cl�usula Inchmaree Un barco pesquero c.pdf
 
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdfCaso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
Caso 3.1 Firma de contadores Moss y McAdams Bruce Palmer hab�a t.pdf
 
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdfCaso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
Caso 2 (TV de Alta Definici�n La Gran Alianza) (1) Seg�n el caso .pdf
 
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdfCaso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
Caso 1 (8 puntos) Miguel y Cinthia Leatch viven en Covington, Ten.pdf
 
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdfCaso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
Caso 1 Agmmaglobulinemia ligada al X 1. Bill fue testamento duran.pdf
 
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdfCaso 1 Felipe R�os  y Tiffany De Los Rios married filling jointl.pdf
Caso 1 Felipe R�os y Tiffany De Los Rios married filling jointl.pdf
 
Case studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdfCase studyData Protect and PrivacyHuman beings value their priva.pdf
Case studyData Protect and PrivacyHuman beings value their priva.pdf
 
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdfCASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
CASE STUDY [30 Marks] Former Tongaat Hulett bosses in court for frau.pdf
 
case study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdfcase study Private Practice Implements Safeguards for Waiting .pdf
case study Private Practice Implements Safeguards for Waiting .pdf
 
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdfCase Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
Case Study Liberty and the Elderly Patient Ronald is 71 years old..pdf
 
Case Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdfCase Study AMr. P tripped and broke her left hip while attempting.pdf
Case Study AMr. P tripped and broke her left hip while attempting.pdf
 
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdfCase Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
Case Study - Rescuing a Troubled Project C.A. McCall-Peat Liberty Li.pdf
 
Case presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdfCase presentation Isabelle is a four-year-old girl who lives with he.pdf
Case presentation Isabelle is a four-year-old girl who lives with he.pdf
 
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdfCap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
Cap�tulo 14 Preguntas para completar Selecciona las palabras neces.pdf
 

Recently uploaded

IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...PsychoTech Services
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationnomboosow
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformChameera Dedduwage
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphThiyagu K
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)eniolaolutunde
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Celine George
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingTeacherCyreneCayanan
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3JemimahLaneBuaron
 
social pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajansocial pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajanpragatimahajan3
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxiammrhaywood
 
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdfBASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdfSoniaTolstoy
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room servicediscovermytutordmt
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeThiyagu K
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104misteraugie
 

Recently uploaded (20)

IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communication
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy Reform
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot Graph
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writing
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3
 
Advance Mobile Application Development class 07
Advance Mobile Application Development class 07Advance Mobile Application Development class 07
Advance Mobile Application Development class 07
 
social pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajansocial pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajan
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdfBASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room service
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 

Can someone please help me with these questions and also explain the.pdf

  • 1. Can someone please help me with these questions and also explain the answer for 1. Most sequencing method require the amplification of target DNA. Which of the following primer pairs would be the most appropriate to amplify this sequence for sequencing? GCAGGAGTTTCAAACTTTACGACACATAATAAAAGTAGTAAATAATAATGACAGTA TCTCAAATCAG TGCAGGGGGGAAAGGCCTACTAATACCTTACCACCCTAGAAAGGCATGATGAAAAT TTAAGATAGA AGGAAAATATAAATTGAAAAAAAAAAACCTAAATATTCTAAGAAAAAAGGAATCTA GTTTGTCAAAA TGTGACTTGAATTAATAGATAAGGAGAGTCACTTAACAAATGATTCTGACAAATATC TTCTCTTTCCA GGGAGAATCACTGAGCCAGAATAAAATTGAACAGATGATAAGAGGGTCAAAATTAT GTTTATCTTA GGAAAAGTAGAATAGAAAATTTATAAGCAGATTAAAATTTTCCCAACATTCTTGTGA AATATGACA CATCCCAATCTTAACAGATGTGATGGTGGGATAATTGGATAGCAATATGGGAAAAG ATATATTTAAT TTCCGTTGCTACACCAAATGCCATCATTTGGGATACTGTACTTGTGAGTGGAAGTGT GGTACTATTTC ACCAAATGCCA A B C You are planning a Next Generation Sequencing (NGS) experiment to study the mechanism of tumorigenesis. Formation of tumor could happen due to overexpression of an oncogene, translocation leading to a fusion gene or reduced expression of tumor suppressor gene. Which of the following order of NGS experiments would be most appropriate? A. WGS--MethylSeq-- RNASeq--CLiPSeq B. MethylSeq-WES-RNASeq-CLiPSeq C. WES-- MethylSeq-RNASeq- CliPSeq D. RNASeq-WES-MethylSeq--CliPSeq