SlideShare una empresa de Scribd logo
1 de 37
Descargar para leer sin conexión
En 1953, James Watson y Francis Crick publicaron
el primer modelo estructural de la molécula de ADN,
(Premio Nobel de Medicina en 1962)
Unidad básica: nucleótido
   Los peldaños formados por los nucleótidos son complementarios.
   La posición de una A en una de las cadenas se corresponde con
   una T en la otra cadena...

    De igual forma, la posición de una G en una de las cadenas se
    corresponde con una C en la misma posición de la otra cadena.
El esquema de este “dogma” ha sido encontrado repetidamente
y se considera una regla general (salvo en los retrovirus)

Severo Ochoa descubre la ARN polimerasa y sintetiza por primera vez
in vitro una molécula de ARN
(Premio Nobel de Fisiología y Medicina en 1959)

Nirenberg y Khorana descifran el código genético
(Premio Nobel de Medicina en 1968)
El código genético está compuesto por codones   •61 codones para aminoácidos
(codon= 3 bases nitrogenadas) que definen el     (existen 20 aminoácidos diferentes)
                                                •3 codones de terminación
proceso de traducción

                                                            El código genético es

                                                            El código genético es
                                                            redundante (varios
                                                            codones para un mismo

                                                            Ejemplo: El aminoácido
                                                            glicina está codificado
                                                            por GGU, GGC, GGA y
Obtención de organismos genéticamente idénticos

  En el campo de la Ingeniería genética consiste
  en aislar y multiplicar un gen, o en general,
  un trozo de ADN

  En Animales superiores consiste en obtener un
  individuo a partir de una célula o de un nucleo
  de otro individuo
Conjunto de técnicas nacidas de la Biología molecular
que permiten manipular el genoma de un ser vivo

                             Homo sapiens

         Escherichia coli
      Mediante la ingeniería genética se pueden introducir genes
      en el genoma de un individuo que carece de ellos
Aislamiento y manipulación de fragmentos
    de ADN de un organismo para introducirlo
    en otro (ADN recombinante)

Nathans D., Arber W., y Smith H. (premio Nobel de Fisiología
y Medicina en 1978 por el descubrimiento de las enzimas de
restricción y su aplicación en Genética Molecular)
Molécula A                          Molécula B

                     Digestión de ambas moléculas con la
                     misma enzima de restricción, BamHI



                               Tratar con ADN-ligasa

                                ADN recombinante
En 1983 Kary Mullis da a conocer esta técnica y en 1993 recibió el Premio Nobel de Química por este descubrimiento

                                                                      Es un proceso cíclico
                                                                      (cada ciclo consta de 3 pasos)

                                                                      94ºC desnaturalización (separación
                                                                           de las dos hebras de ADN)

                                                                      50ºC Anillamiento de "cebadores"

                                                                      72ºC copia de cada una de las
                                                                           hebras de ADN por la ADN

     35 ciclos                     236= 68 billones de copias

               gen de resistencia
               a la ampicilina

2                                      3

      Extremos cohesivos

                                    Molécula de ADN recombinante


2   3
Ciclo lisogénico

Ciclo lítico
                   (f)   (g)   (h)
Genoma de hongos: 44 millones de pares de bases
Huesped: Escherichia coli
Vector: Bacteriófagos
        capacidad: 20 mil pares de bases

Genoma humano: 3000 millones de pares de bases
Huesped: Saccharomyces cerevisiae
Vector: YAC (cromosoma artificial de levadura)
        MegaYAC (capacidad: 1 millón de pares de bases)
                         GTCCAACAGTTACCAAGTGACTTTGTCCAC              TTTTGCCC
 de genomas     AGTGACTTTGTCCA                       ACGGCCTAAGCGTTTTTTTT

•Detección de mutaciones
   Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual)

•Secuenciación de ADNs fósiles
   Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría
   están dañadas o degradadas)

•Diagnóstico de enfermedades genéticas
   Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o
   determinación del sexo del feto previamente a su implantación en procesos de
   fecundación in vitro

•Identificación de especies y control de cruces entre animales
   Para descubrir fraudes comerciales, tales como vender carne de una especie más
   barata a los precios de otra más cara, o el comercio ilegal de especies en peligro

•Secuenciación de genomas
   Conocimiento básico y aplicado de diferentes organismos (incluido el genoma humano)
16 de Febrero de 2001
Celera Genomics

      Proyecto genoma humano
 La secuencia del genoma es un atajo valioso: ayuda a los
 científicos a encontrar los genes más fácil y rápidamente
 y sienta las bases para averiguar la función de los genes

      Beneficios médicos tras el conocimiento de la
          estructura de cada gen humano

      1.    Diagnóstico en individuos con riesgo de ser
           portadores del gen de alguna enfermedad

      2.    Marco de trabajo para el desarrollo de
           nuevas    terapias,   además     de nuevas
           estrategias para la terapia génica

15 de Febrero de 2001
Consorcio público internacional
Obtención de proteínas de interés médico, comercial, etc...
(insulina, hormona del crecimiento, factores de coagulación antes se obtenían
a partir de los tejidos que las producen o fluidos corporales)
Obtención de vacunas recombinantes
(aternativa al uso de organismos patógenos inactivos)
            Extracción del ADN
                 del virus

                                                                     Integración del
                                                                     plásmido híbrido
                                                                   en el núcleo de una
                ADN                                                 célula de levadura


                                            La levadura fabrica las
                                               proteínas víricas
                                             con poder inmunológico

                                         Inyección de proteínas
                                         víricas en un chimpancé
Mediante ingeniería genética
                                                                                             se construye una sonda de
Diagnóstico de enfermedades de origen genético                                                ADN, marcada (marcaje
                                                                                                fluorescente), con la
                                                                                            secuencia complementaria del
                                                                                                    ADN enfermo
                    ADN sano

                ADN enfermo
                                                                                    ADN complementario
                                                                                     del ADN enfermo
Conocimiento previo de
 la secuencia de ADN                                DIAGNÓSTICO

                    Si aparecen bandas
                     demuestra que la
                    persona presenta la
    Biochip               anomalía
                                           ¿Hibridación? Renaturalización   Desnatura      ADN de la
                                          ¿No hibridación? del ADN con la     lización   persona que se
                                                                sonda        del ADN         quiere
                                                            fluorescente                  diagnosticar
Plantas transgénicas           Agrobacterium tumefaciens es patógena de plantas.Produce tumores

                                                      Plásmido Ti
                                                 inductor de tumores                                cromosoma
                                                  contiene oncogenes
Transgénesis= introducción de                         (genes onc)
ADN extraño en un genoma, de
modo que se mantenga estable de
forma hereditaria y afecte a
todas las células en los organismos          cromosoma
                     Ingeniero                                                    vegetal
                     natural tras
                     sutitución de                                     tumores
                     genes onc por                                                   Proliferación de
                     genes de                                                        hormonas
                     interés                                                         crecimiento. Se
                                                                                     forman tumores en
                                                                                     las zonas de la
•Resistencia a herbicidas, insectos y enfermedades microbianas
   El maíz transgénico de Novartis es resistente al herbicida Basta y también es
   resistente al gusano barrenador europeo (contiene el Gen de resistencia a la
   toxina Bt de Bacillus thuringiensis) produce su propio insecticida

         Problemas:La toxina Bt en las plantas transgénicas tiene propiedades
        sustancialmente diferentes a la toxina Bt en su forma natural.
         La toxina puede ser transmitida a través de la cadena alimenticia, un
         efecto que nunca ha sido observado en la toxina Bt en su forma natural.
         Larvas de especies de insectos predadores benéficos (larvas verdes de
         crisopa) murieron cuando fueron alimentadas con el gusano barrenador

   Gold rice de Monsanto con color amarillo por los altos niveles de vitamina A

Mejora de la calidad de los productos agrícolas
   Producción de aceites modificados

•Síntesis de productos de interés comercial
   Anticuerpos animales, interferón, e incluso elementos de un poliéster destinado a la
   fabricación de plásticos biodegradables
Transgénesis en animales                          (por microinyección de zigotos)

                              Secuencia promotora para
                              la síntesis de una proteína
                Gen humano            de la leche

                             Gen híbrido

                        humano         rata

  Ovulos de cerda

                                           Desarrollo de una cerda transgénica
Clonación de animales
Clonación de animales
Clonan terneros en EE UU para producir anticuerpos

                   efe- Washington - agosto 2002

  Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos)

          genes para anticuerpos                   células dérmicas   clonación
          humanos recombinantes

  Objetivo: Tratamiento de enfermedades inmunológicas

          Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por
          bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica)
Clonan cerdos destinados a trasplantar sus órganos a

                                                                La empresa escocesa PPL Therapeutics logra
                                                                retirar de los cerditos el gen que provoca el
                                                                rechazo en transplantes a humanos "alfa 1,3
                                                                galactosil transferasa"

  Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE)

  Paso importante en favor del xenotrasplante (transferencia de células u
  órganos de una especie a otra)

  Ayudará a superar la escasez de órganos humanos para hacer trasplantes de
  todo tipo
Un laboratorio de Texas clona al primer animal
"Copycat" es el primer gatito nacido mediante clonación"

                                                    El experimento abre las puertas de la clonación masiva de
                                                    animales domésticos, un fin sin explorar cuya sola
                                                    posibilidad había desencadenado ya el almacenamiento
                                                    de células de mascotas por parte de sus ricos propietarios

 febrero 2002 Universidad College Station (Texas)

                                                      El sexto día

                                                                                   El ataque de los clones
La clonación humana ya se
esté intentando de forma
clandestina por varios
                               La clonación reproductiva no arroja
laboratorios en el mundo
                               los resultados suficientes, no existen
                                garantías como para decir 'Vamos a
                               clonar un ser humano'

 Por cada intento de clonación
 hay detrás miles de fallos,   Para obtener a Dolly: 277 fusiones de
 abortos y malformaciones      ovocitos con células mamarias, solo
 genéticas                     29 embriones fueron aptos. De estos
                               solo uno resultó un éxito
                                                                        (con células adultas)

                                                                        -embrión somático-

                                                                        (no hay rechazo)
1 Cultivo de blastocisto


2 Eliminación de la capa externa
                                                 Embrión temprano

3 Adición de sustancias                                                           Fusión de célula somática
  que disgregan la masa                                                                y ovulo enucleado
  celular interna

                                                                      En caso de existir deficiencias a nivel
                                                                      genético se puede hacer terápia génica
                                      6 Adición de factores de        a nivel de células madre
4 Transferencia de los agregados      diferenciación
  celulares a un nuevo pozo           seleccionados

                                                                                    7 Administración de
                                                                                    células diferenciadas a
                                                                                    tejidos dañados
5 Formación de células
  diferenciadas a tejidos
Las células madre abren la posibilidad a un nuevo mundo en
las terapias de los trasplantes

Calificada como una técnica "ineficaz e imperfecta" por científicos
como Iam Wilmut, "padre" de la oveja Dolly, la clonación ha encontrado
en las células "madre" su primera razón de ser.

 Retos técnicos

  1.   Las células embrionarias de ratón originan teratomas y
       teratocarcinomas en animales adultos

  2.   Conocimiento de las señales implicadas en el desarrollo y

  3.   Asegurar la salud a largo plazo de las células a transplantar
       (edad biológica de las células)
Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO
(1997), adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una
continuación en las investigaciones y la salvaguarda de los derechos humanos)

Frente a los múltiples beneficios de la ingeniería genética
pueden surgir algunos problemas

Problemas sanitarios nuevos microorganismos patógenos,
efectos secundarios de nuevos fármacos de diseño, etc...

Problemas ecológicos          desaparición de especies con consecuencias
desconocidas, nuevas contaminaciones debidas a un metabolismo incontrolado, etc...

Problemas sociales y políticos en el campo de la producción industrial, agrícola y ganadera,
 pueden crear diferencias aún más grandes entre países ricos y pobres. El sondeo génico en
personas puede llevar a consecuencias nefastas en la contratación laboral, por ejemplo, y atenta contra
la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminación..).

Problemas éticos y morales               Poder conocer y modificar el patrimonio genético humano
puede ser una puerta abierta al eugenismo "Eugenesia: la ciencia del incremento de la felicidad humana a
 través del perfeccionamiento de las características hereditarias".

Más contenido relacionado

La actualidad más candente

La actualidad más candente (18)

Clase 03 Tecnología del ADN Recombinante
Clase 03 Tecnología del ADN RecombinanteClase 03 Tecnología del ADN Recombinante
Clase 03 Tecnología del ADN Recombinante
Biologia molecular y ingenieria genetica
Biologia molecular y ingenieria geneticaBiologia molecular y ingenieria genetica
Biologia molecular y ingenieria genetica
Tecnología del Adn Recombinante
Tecnología del Adn RecombinanteTecnología del Adn Recombinante
Tecnología del Adn Recombinante
Adn Recombinante
Adn RecombinanteAdn Recombinante
Adn Recombinante
16 el adn y la ingeniería genética
16 el adn y la ingeniería genética16 el adn y la ingeniería genética
16 el adn y la ingeniería genética
Tecnología del adn recombinante
Tecnología del adn recombinanteTecnología del adn recombinante
Tecnología del adn recombinante
Tecnología Adn Recombinante 2003
Tecnología Adn Recombinante 2003Tecnología Adn Recombinante 2003
Tecnología Adn Recombinante 2003
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria genetica
Tecnologías del ADN recombinante
Tecnologías del ADN recombinanteTecnologías del ADN recombinante
Tecnologías del ADN recombinante
Biologia molecular adn
Biologia molecular adnBiologia molecular adn
Biologia molecular adn
Ud. 20. ingenieria genética
Ud. 20. ingenieria genéticaUd. 20. ingenieria genética
Ud. 20. ingenieria genética
Tema 16 adn y la ingenieria genetica
Tema 16 adn y la ingenieria geneticaTema 16 adn y la ingenieria genetica
Tema 16 adn y la ingenieria genetica
Ingenieria Genetica
Ingenieria GeneticaIngenieria Genetica
Ingenieria Genetica
Capitulo 16
Capitulo 16Capitulo 16
Capitulo 16
Cósmidos clonación vectorial
Cósmidos clonación vectorial Cósmidos clonación vectorial
Cósmidos clonación vectorial
Vectores de adn recombinante
Vectores de adn recombinanteVectores de adn recombinante
Vectores de adn recombinante


Modelos de Watson y Crick - ADN
Modelos de Watson y Crick - ADNModelos de Watson y Crick - ADN
Modelos de Watson y Crick - ADNNestor Narvaez
Estructura y función del adn
Estructura y función del adnEstructura y función del adn
Estructura y función del adnlaqbmabel
El modelo de Watson y Crick
El modelo de Watson y CrickEl modelo de Watson y Crick
El modelo de Watson y CrickAlicia
Estructura Del ADN
Estructura Del ADNEstructura Del ADN
Estructura Del ADNguest4f2b4fc

Destacado (7)

Modelos de Watson y Crick - ADN
Modelos de Watson y Crick - ADNModelos de Watson y Crick - ADN
Modelos de Watson y Crick - ADN
Estructura y función del adn
Estructura y función del adnEstructura y función del adn
Estructura y función del adn
Watson y crick
Watson y crickWatson y crick
Watson y crick
El modelo de Watson y Crick
El modelo de Watson y CrickEl modelo de Watson y Crick
El modelo de Watson y Crick
Estructura Del ADN
Estructura Del ADNEstructura Del ADN
Estructura Del ADN

Similar a Biotecnologia

Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1CLAUDIACRISTAL
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015clauciencias
Tema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genéticaTema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genéticaEduardo Gómez
Unidad 4 Revolución genética
Unidad 4   Revolución genéticaUnidad 4   Revolución genética
Unidad 4 Revolución genéticaElena
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria geneticauniguajira
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria geneticauniguajira
Biotecnologas Biotecnologas
Biotecnologas mygoza
Del adn-a-las-proteinas
Del adn-a-las-proteinasDel adn-a-las-proteinas
Del adn-a-las-proteinasRichard Erazo
Introdución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinanteIntrodución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinanteabcsar
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria geneticajujosansan
Introdución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinanteIntrodución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinanteandreasouto

Similar a Biotecnologia (20)

Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1
Tema 5 biotecnología
Tema 5 biotecnologíaTema 5 biotecnología
Tema 5 biotecnología
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015
Tema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genéticaTema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genética
Unidad 4 Revolución genética
Unidad 4   Revolución genéticaUnidad 4   Revolución genética
Unidad 4 Revolución genética
Biologia del adn
Biologia del adnBiologia del adn
Biologia del adn
Tema 4
Tema 4Tema 4
Tema 4
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria genetica
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria genetica
Biotecnologas Biotecnologas
Del adn-a-las-proteinas
Del adn-a-las-proteinasDel adn-a-las-proteinas
Del adn-a-las-proteinas
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria genetica
Introdución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinanteIntrodución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinante
Del DNA a la ingeniería genética
Del DNA a la ingeniería genéticaDel DNA a la ingeniería genética
Del DNA a la ingeniería genética
Ingenieria genetica
Ingenieria geneticaIngenieria genetica
Ingenieria genetica
Introdución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinanteIntrodución a la tecnología del ADN recombinante
Introdución a la tecnología del ADN recombinante

Más de jugafoce

Tejidos vegetales
Tejidos vegetalesTejidos vegetales
Tejidos vegetalesjugafoce
Educacion sexual reuven
Educacion sexual reuvenEducacion sexual reuven
Educacion sexual reuvenjugafoce
Cell structure
Cell structureCell structure
Cell structurejugafoce
Endocrine system & disorders, gland by gland
Endocrine system & disorders, gland by glandEndocrine system & disorders, gland by gland
Endocrine system & disorders, gland by glandjugafoce
Agua y carbono
Agua y carbonoAgua y carbono
Agua y carbonojugafoce
Singing with the plants
Singing with the plantsSinging with the plants
Singing with the plantsjugafoce
Presentacion santi
Presentacion santiPresentacion santi
Presentacion santijugafoce
Plants alejandra tovar ramírez (1)
Plants alejandra tovar ramírez (1)Plants alejandra tovar ramírez (1)
Plants alejandra tovar ramírez (1)jugafoce
Plantas daniel
Plantas danielPlantas daniel
Plantas danieljugafoce
Experimento (1)
Experimento (1)Experimento (1)
Experimento (1)jugafoce
Experiment with plants, music and good treatment
Experiment with plants, music and good treatmentExperiment with plants, music and good treatment
Experiment with plants, music and good treatmentjugafoce
The magic nature
The magic natureThe magic nature
The magic naturejugafoce
Trabajo de ciencias juan manuel b
Trabajo de ciencias juan manuel bTrabajo de ciencias juan manuel b
Trabajo de ciencias juan manuel bjugafoce
Reaction of a plant n2 (1)
Reaction of  a plant   n2 (1)Reaction of  a plant   n2 (1)
Reaction of a plant n2 (1)jugafoce
The plant in the dark
The plant in the darkThe plant in the dark
The plant in the darkjugafoce
The music plant gabriela molano o.
The music plant gabriela molano o.The music plant gabriela molano o.
The music plant gabriela molano o.jugafoce
The effect of heat in plants
The effect of heat in plantsThe effect of heat in plants
The effect of heat in plantsjugafoce

Más de jugafoce (20)

Tejidos vegetales
Tejidos vegetalesTejidos vegetales
Tejidos vegetales
Educacion sexual reuven
Educacion sexual reuvenEducacion sexual reuven
Educacion sexual reuven
Cell structure
Cell structureCell structure
Cell structure
Endocrine system & disorders, gland by gland
Endocrine system & disorders, gland by glandEndocrine system & disorders, gland by gland
Endocrine system & disorders, gland by gland
Agua y carbono
Agua y carbonoAgua y carbono
Agua y carbono
Singing with the plants
Singing with the plantsSinging with the plants
Singing with the plants
Presentacion santi
Presentacion santiPresentacion santi
Presentacion santi
Plants alejandra tovar ramírez (1)
Plants alejandra tovar ramírez (1)Plants alejandra tovar ramírez (1)
Plants alejandra tovar ramírez (1)
Plantas daniel
Plantas danielPlantas daniel
Plantas daniel
Experimento (1)
Experimento (1)Experimento (1)
Experimento (1)
Experiment with plants, music and good treatment
Experiment with plants, music and good treatmentExperiment with plants, music and good treatment
Experiment with plants, music and good treatment
The magic nature
The magic natureThe magic nature
The magic nature
Trabajo de ciencias juan manuel b
Trabajo de ciencias juan manuel bTrabajo de ciencias juan manuel b
Trabajo de ciencias juan manuel b
Reaction of a plant n2 (1)
Reaction of  a plant   n2 (1)Reaction of  a plant   n2 (1)
Reaction of a plant n2 (1)
The plant in the dark
The plant in the darkThe plant in the dark
The plant in the dark
The music plant gabriela molano o.
The music plant gabriela molano o.The music plant gabriela molano o.
The music plant gabriela molano o.
The effect of heat in plants
The effect of heat in plantsThe effect of heat in plants
The effect of heat in plants


  • 1. En 1953, James Watson y Francis Crick publicaron el primer modelo estructural de la molécula de ADN, (Premio Nobel de Medicina en 1962)
  • 2. Unidad básica: nucleótido Los peldaños formados por los nucleótidos son complementarios. La posición de una A en una de las cadenas se corresponde con una T en la otra cadena... De igual forma, la posición de una G en una de las cadenas se corresponde con una C en la misma posición de la otra cadena.
  • 3. El esquema de este “dogma” ha sido encontrado repetidamente y se considera una regla general (salvo en los retrovirus) Proteína
  • 4. Severo Ochoa descubre la ARN polimerasa y sintetiza por primera vez in vitro una molécula de ARN (Premio Nobel de Fisiología y Medicina en 1959) Nirenberg y Khorana descifran el código genético (Premio Nobel de Medicina en 1968)
  • 5. El código genético está compuesto por codones •61 codones para aminoácidos (codon= 3 bases nitrogenadas) que definen el (existen 20 aminoácidos diferentes) •3 codones de terminación proceso de traducción El código genético es universal El código genético es redundante (varios codones para un mismo aminoácido) Ejemplo: El aminoácido glicina está codificado por GGU, GGC, GGA y GGG
  • 6. Obtención de organismos genéticamente idénticos En el campo de la Ingeniería genética consiste en aislar y multiplicar un gen, o en general, un trozo de ADN En Animales superiores consiste en obtener un individuo a partir de una célula o de un nucleo de otro individuo
  • 7. Conjunto de técnicas nacidas de la Biología molecular que permiten manipular el genoma de un ser vivo cromosoma gen Homo sapiens Escherichia coli Mediante la ingeniería genética se pueden introducir genes en el genoma de un individuo que carece de ellos
  • 8. Aislamiento y manipulación de fragmentos de ADN de un organismo para introducirlo en otro (ADN recombinante) Nathans D., Arber W., y Smith H. (premio Nobel de Fisiología y Medicina en 1978 por el descubrimiento de las enzimas de restricción y su aplicación en Genética Molecular)
  • 9. Molécula A Molécula B Digestión de ambas moléculas con la misma enzima de restricción, BamHI Extremos cohesivos Mezclar Tratar con ADN-ligasa ADN recombinante
  • 10. En 1983 Kary Mullis da a conocer esta técnica y en 1993 recibió el Premio Nobel de Química por este descubrimiento Es un proceso cíclico (cada ciclo consta de 3 pasos) 94ºC desnaturalización (separación de las dos hebras de ADN) 50ºC Anillamiento de "cebadores" 72ºC copia de cada una de las hebras de ADN por la ADN polimerasa 35 ciclos 236= 68 billones de copias
  • 11.
  • 12. 1 Plásmido Plásmidos gen de resistencia a la ampicilina 2 3 Extremos cohesivos Molécula de ADN recombinante
  • 14. 1 Virus 2 3
  • 16. Genoma de hongos: 44 millones de pares de bases Huesped: Escherichia coli Vector: Bacteriófagos capacidad: 20 mil pares de bases Genoma humano: 3000 millones de pares de bases Huesped: Saccharomyces cerevisiae Vector: YAC (cromosoma artificial de levadura) MegaYAC (capacidad: 1 millón de pares de bases)
  • 18. •Detección de mutaciones Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual) •Secuenciación de ADNs fósiles Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría están dañadas o degradadas) •Diagnóstico de enfermedades genéticas Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o determinación del sexo del feto previamente a su implantación en procesos de fecundación in vitro •Identificación de especies y control de cruces entre animales Para descubrir fraudes comerciales, tales como vender carne de una especie más barata a los precios de otra más cara, o el comercio ilegal de especies en peligro •Secuenciación de genomas Conocimiento básico y aplicado de diferentes organismos (incluido el genoma humano)
  • 19. 16 de Febrero de 2001 Celera Genomics Proyecto genoma humano La secuencia del genoma es un atajo valioso: ayuda a los científicos a encontrar los genes más fácil y rápidamente y sienta las bases para averiguar la función de los genes identificados Beneficios médicos tras el conocimiento de la estructura de cada gen humano 1. Diagnóstico en individuos con riesgo de ser portadores del gen de alguna enfermedad 2. Marco de trabajo para el desarrollo de nuevas terapias, además de nuevas estrategias para la terapia génica 15 de Febrero de 2001 Consorcio público internacional
  • 20. Obtención de proteínas de interés médico, comercial, etc... (insulina, hormona del crecimiento, factores de coagulación antes se obtenían a partir de los tejidos que las producen o fluidos corporales)
  • 21. Obtención de vacunas recombinantes (aternativa al uso de organismos patógenos inactivos) Extracción del ADN del virus Integración del plásmido híbrido en el núcleo de una ADN célula de levadura plásmido bacteriano La levadura fabrica las proteínas víricas con poder inmunológico Inyección de proteínas víricas en un chimpancé
  • 22. Mediante ingeniería genética se construye una sonda de Diagnóstico de enfermedades de origen genético ADN, marcada (marcaje fluorescente), con la secuencia complementaria del ADN enfermo ADN sano ADN enfermo ADN complementario del ADN enfermo Conocimiento previo de la secuencia de ADN DIAGNÓSTICO enfermo Si aparecen bandas fluorescentes demuestra que la persona presenta la Biochip anomalía Microarray ¿Hibridación? Renaturalización Desnatura ADN de la DNAchip ¿No hibridación? del ADN con la lización persona que se sonda del ADN quiere fluorescente diagnosticar
  • 23. Plantas transgénicas Agrobacterium tumefaciens es patógena de plantas.Produce tumores Agrobacterium núcleo Plásmido Ti inductor de tumores cromosoma contiene oncogenes Transgénesis= introducción de (genes onc) ADN extraño en un genoma, de modo que se mantenga estable de forma hereditaria y afecte a todas las células en los organismos cromosoma multicelulares. célula Ingeniero vegetal genético natural tras sutitución de tumores genes onc por Proliferación de genes de hormonas interés crecimiento. Se forman tumores en las zonas de la lesión
  • 24. •Resistencia a herbicidas, insectos y enfermedades microbianas El maíz transgénico de Novartis es resistente al herbicida Basta y también es resistente al gusano barrenador europeo (contiene el Gen de resistencia a la toxina Bt de Bacillus thuringiensis) produce su propio insecticida Problemas:La toxina Bt en las plantas transgénicas tiene propiedades sustancialmente diferentes a la toxina Bt en su forma natural. La toxina puede ser transmitida a través de la cadena alimenticia, un efecto que nunca ha sido observado en la toxina Bt en su forma natural. Larvas de especies de insectos predadores benéficos (larvas verdes de crisopa) murieron cuando fueron alimentadas con el gusano barrenador europeo Gold rice de Monsanto con color amarillo por los altos niveles de vitamina A Mejora de la calidad de los productos agrícolas Producción de aceites modificados •Síntesis de productos de interés comercial Anticuerpos animales, interferón, e incluso elementos de un poliéster destinado a la fabricación de plásticos biodegradables
  • 25. Transgénesis en animales (por microinyección de zigotos) Secuencia promotora para la síntesis de una proteína Gen humano de la leche Gen híbrido humano rata Ovulos de cerda fecundados Desarrollo de una cerda transgénica
  • 28. Clonan terneros en EE UU para producir anticuerpos humanos efe- Washington - agosto 2002 Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos) genes para anticuerpos células dérmicas clonación humanos recombinantes Objetivo: Tratamiento de enfermedades inmunológicas Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica)
  • 29. Clonan cerdos destinados a trasplantar sus órganos a humanos La empresa escocesa PPL Therapeutics logra retirar de los cerditos el gen que provoca el rechazo en transplantes a humanos "alfa 1,3 galactosil transferasa" Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE) Paso importante en favor del xenotrasplante (transferencia de células u órganos de una especie a otra) Ayudará a superar la escasez de órganos humanos para hacer trasplantes de todo tipo
  • 30. Un laboratorio de Texas clona al primer animal doméstico "Copycat" es el primer gatito nacido mediante clonación" El experimento abre las puertas de la clonación masiva de animales domésticos, un fin sin explorar cuya sola posibilidad había desencadenado ya el almacenamiento de células de mascotas por parte de sus ricos propietarios febrero 2002 Universidad College Station (Texas) El sexto día El ataque de los clones
  • 31. La clonación humana ya se esté intentando de forma clandestina por varios La clonación reproductiva no arroja laboratorios en el mundo los resultados suficientes, no existen garantías como para decir 'Vamos a clonar un ser humano' Por cada intento de clonación hay detrás miles de fallos, Para obtener a Dolly: 277 fusiones de abortos y malformaciones ovocitos con células mamarias, solo genéticas 29 embriones fueron aptos. De estos solo uno resultó un éxito
  • 32. CREACIÓN DE UN EMBRIÓN ARTIFICIAL (con células adultas) -embrión somático- OBJETIVO ÚLTIMO: TRATAMIENTO de ENFERMEDADES OBJETIVO ÚLTIMO: AUTOTRASPLANTES (no hay rechazo) 1 Cultivo de blastocisto Fecundación 2 Eliminación de la capa externa Embrión temprano 3 Adición de sustancias Fusión de célula somática que disgregan la masa y ovulo enucleado celular interna En caso de existir deficiencias a nivel genético se puede hacer terápia génica 6 Adición de factores de a nivel de células madre 4 Transferencia de los agregados diferenciación celulares a un nuevo pozo seleccionados 7 Administración de células diferenciadas a tejidos dañados 5 Formación de células diferenciadas a tejidos dañados
  • 33. Las células madre abren la posibilidad a un nuevo mundo en las terapias de los trasplantes Calificada como una técnica "ineficaz e imperfecta" por científicos como Iam Wilmut, "padre" de la oveja Dolly, la clonación ha encontrado en las células "madre" su primera razón de ser. Retos técnicos 1. Las células embrionarias de ratón originan teratomas y teratocarcinomas en animales adultos 2. Conocimiento de las señales implicadas en el desarrollo y diferenciación 3. Asegurar la salud a largo plazo de las células a transplantar (edad biológica de las células)
  • 34. Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997), adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una continuación en las investigaciones y la salvaguarda de los derechos humanos) Frente a los múltiples beneficios de la ingeniería genética pueden surgir algunos problemas Problemas sanitarios nuevos microorganismos patógenos, efectos secundarios de nuevos fármacos de diseño, etc... Problemas ecológicos desaparición de especies con consecuencias desconocidas, nuevas contaminaciones debidas a un metabolismo incontrolado, etc... Problemas sociales y políticos en el campo de la producción industrial, agrícola y ganadera, pueden crear diferencias aún más grandes entre países ricos y pobres. El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminación..). Problemas éticos y morales Poder conocer y modificar el patrimonio genético humano puede ser una puerta abierta al eugenismo "Eugenesia: la ciencia del incremento de la felicidad humana a través del perfeccionamiento de las características hereditarias".