4. La naturaleza de la información genética
Nomenclatura IUPAC
A = adenine
C = cytosine
G = guanine
T = thymine
R = G A (purine)
Y = T C (pyrimidine)
K = G T (keto)
M = A C (amino)
S = G C (strong bonds)
W = A T (weak bonds)
B = G T C (all but A)
D = G A T (all but C)
H = A C T (all but G)
V = G C A (all but T)
N = A G C T (any)
6. La naturaleza de la información genética
Ancho de banda de la información genética humana
3.120 Mbp/ genoma haplotide.
4 nt = 2 bits (00 A, 01 C, 10 T, 11 G)
Eyaculación promedio: 200M espermatozooides
3,12*109 * 2 bits * 2*108 = 1,28*1018 bits = 145.519,152 TB
Considerando duración de 5 segs: 29.104 TB/seg
14. Problemas con secuencias
Diseño de secuencias para sintesis de ADN: Introducir
mutaciones puntuales manteniendo traducción pero
alterando el perfil de restricción.
Peptide: MGNCNGASK
ORIGINAL SEQUENCE:
7 FokI Tsp509I TspEI Sse9I
|
| 12 HpyCH4V CviRI
| |
| | 20 BseGI BstF5I
| | |
ATGGGTAATTGCAACGGGGCATCCAAG
|||||||||||||||||||||||||||
TACCCATTAACGTTGCCCCGTAGGTTC
1 27
15. Problemas con secuencias
Diseño de secuencias para sintesis de ADN: Introducir
mutaciones puntuales manteniendo traducción pero
alterando el perfil de restricción.
Peptide: MGNCNGASK
5 MaeIII
|
| 7 FokI
| |
| | 12 HpyCH4V CviRI
| | |
| | | 20 BseGI BstF5I
| | | |
ATGGGTAACTGCAACGGGGCATCCAAG
|||||||||||||||||||||||||||
TACCCATTGACGTTGCCCCGTAGGTTC
1 27
16. Biopython
Conjunto de herramientas libres en Python para bioinformática
y biología molecular
Algunas características:
●Parseo archivos bioinformáticos en estructuras propias
de Python
●Clase “sequence” para guardar secuencias, ids y
distintas caracteristicas (features)
●Interfaces con programas bioinformáticos típicos
(clustalw, blast, primer3 and more)
●Herramientas para realizar operaciones comunes con
secuencias de ADN y proteinas (traducción, transcripción,
Tm, peso molecular)
●Código para gestionar alineamientos
●Integración con otros lenguajes como BioCorba
17. Aportes a Biopython
Código:
●Tm function
●LCC function
●2 checksums function in Bio.SeqUtils.CheckSum
Otros:
●Feedback
●Bug reporting
●Testing (BLAST, SFF files, BioSQL)
20. Búsqueda BLAST
from Bio.Blast import NCBIStandalone as BLAST
r,e = BLAST.blastall(b_exe, 'blastn', b_db,f_in,
gap_open='3', gap_extend='2',
wordsize=20, expectation=1e-50,
alignments=1, descriptions=1,
align_view='0', html='F')
Analizar el resultado del BLAST
from Bio.Blast import NCBIXML
for rec in NCBIXML.parse(r):
for align in rec.alignments:
for hsp in align.hsps:
print hsp.query_start, hsp.query_end
print hsp.sbjct_start, hsp.sbjct_end
if hsp.identities>90:
print align.title
21. Análisis de restricción
# Hacer analisis de restriccion.
anal = Restriction.Analysis(Restriction.CommOnly, dna)
anal.print_as("map")
anal.print_that()
# Guardar las enzimas que cortan esta seq.
enzORI = anal.with_sites().keys()
enzORIset = set(enzORI)
(...)
anal = Restriction.Analysis(Restriction.CommOnly,
Seq.Seq(x, IUPAC.unambiguous_dna))
enzTMP = anal.with_sites().keys()
enzTMPset = set(enzTMP)
if enzTMPset!=enzORIset and enzORI!=None:
pames = str(enzTMP)[1:-1]
print 'Proposed sequence enzymes: %s' % pames
24. class SNPdata():
''' Retrieve SNP data '''
def __init__(self, seq_file_in):
fh = open(seq_file_in)
rsid = {}
for line in fh:
if not line.startswith("#"):
data = line.split()
rsid[data[0]] = {'chromosome':data[1],
'position':int(data[2]),
'genotype':data[3]}
fh.close()
def __getitem__(self, x):
return rsid[x]
def __len__(self):
return len(rsid)
25. Mas información
Biopython website: www.biopython.org
Documentation: biopython.org/wiki/Category:Wiki_Documentation
Cock PJ, et al. “Biopython: freely available Python tools for
computational molecular biology and bioinformatics”. Bioinformatics
2009 Jun 1; 25(11) 1422-3. doi:10.1093/bioinformatics/btp163
pmid:19304878.
Bassi S (2007) A Primer on Python for Life Science Researchers. PLoS
Comput Biol 3(11): e199. doi:10.1371/journal.pcbi.0030199
Book: “Python for Bioinformatics” http://tinyurl.com/biopython
Mailing list:
Users: http://lists.open-bio.org/mailman/listinfo/biopython/
Developers: http://lists.open-bio.org/mailman/listinfo/biopython-dev
Python in Argentina: www.python.org.ar