SlideShare una empresa de Scribd logo
1 de 37
La genética
 
El ADN: el secreto de la vida Para conocer el ADN tenemos que saber: Su composición Su estructura Cómo se expresa su información Cómo se transmite la información  de generación  en generación
LA COMPOSICIÓN DEL ADN
Composición del ADN ,[object Object],[object Object],[object Object],[object Object]
¿De qué se compone un nucleótido? ,[object Object],[object Object],[object Object],[object Object],Guanina Citosina Timina Adenina Nucleótido
Las cadenas de nucleótidos ,[object Object],Los nucleótidos se unen entre sí formando  largas cadenas,  además  dos cadenas  se asocian para formar  una molécula de ADN .  . .  .
LA SECUENCIA DE NUCLEÓTIDOS ,[object Object],El orden en que se unen unos nucleótidos con otros se denomina  secuencia  y tiene una gran importancia, pues contiene la  información  que después se expresará en forma de proteínas T-C-A-G-.............................
LA ESTRUCTURA  DEL ADN
LA ESTRUCTURA DEL ADN ,[object Object],[object Object]
[object Object],[object Object],La estructura de la doble hélice recuerda a una escalera de caracol
La estructura del ADN ,[object Object],[object Object]
La estructura del ADN ,[object Object],[object Object],ATGGCTTAACAATCCCGGGTACGTA TACCGAATTGTTAGGGCCCATGCAT
La estructura del ADN El ADN constituye largas cadenas. Cada molécula de ADN forma, junto a otras moléculas denominadas histonas, una sustancia denominada cromatina, durante la división celular la cromatina se condensa y forma los cromosomas ¿Cuántas moléculas de ADN hay  en cada célula de un ser humano? 46
Expresión de la  información genética
Expresión de la información genética. ,[object Object],[object Object],[object Object],[object Object],[object Object]
Expresión de la información genética ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Expresión de la información genética.  Uno de los científicos que contribuyó a descubrir como se realizaba esta traducción fue Severo Ochoa. Su trabajo en este campo le valió el Premio Nobel.
Expresión de la información genética ,[object Object],[object Object],1.- La información contenida en el ADN se  transcribe a una molécula de ARN (ácido ribonucleico) que una  vez formada abandona el núcleo para dirigirse al citoplasma. 2.- La información genética se  traduce  al lenguaje de  las proteínas en los ribosoma.Cada cadena de ARN dará lugar a una proteína
Expresión de la información genética. La transcripción ADN ARN ACCGGTACTGACAGTACTTCC TGGCCATGACTGTCATGAAGG Molécula de ADN
Expresión de la información genética. La transcripción. ACCGGTACTGACAGTACTTCC TGGCCATGACTGTCATGAAGG UGGCCAUGACUGUCAUGAAGG ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Expresión de la información genética. La transcripción. Características del ARN: ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Expresión de la información genética. La traducción ARN Proteínas Se traduce un lenguaje con cuatro signos  (las cuatro bases nitrogenadas) a un lenguaje con veinte signos (los veinte aminoácidos que componen las proteínas)
Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA Tiene lugar en los ribosomas, donde el ARNm lleva la  información del ADN ARN Ribosoma Aminoácido Proteína en formación Los aminoácidos son conducidos al ribosoma por el ARNt, y unidos según indica la secuencia de nucleótidos del ARNm
Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
Expresión de la información genética. La traducción Aquí se observa como varios ribosomas trabajan a la vez  para conseguir varias copias de la proteína.
Expresión de la información genética.  El código genético establece la relación que hay entre los tripletes de bases y los aminoácidos de las proteínas
Expresión de la información genética.  Deduce la secuencia de aminoácidos AUG CCU CAU AGU GGC UAA
3.-La replicación del ADN ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
La replicación del ADN ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],ACCGTTAC TGGCAATG ACCGTTAC TGGCAATG TGGCAATG ACCGTTAC
La replicación del ADN
4.-Las mutaciones
Las mutaciones
Las mutaciones

Más contenido relacionado

La actualidad más candente

Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓNTema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓNjosemanuel7160
 
Biomoléculas proteinas 1
Biomoléculas proteinas 1Biomoléculas proteinas 1
Biomoléculas proteinas 1N Flores
 
Aminoacidos 1213
Aminoacidos 1213Aminoacidos 1213
Aminoacidos 1213pblanco61
 
Grupos prostéticos asociados a proteínas
Grupos prostéticos asociados a proteínasGrupos prostéticos asociados a proteínas
Grupos prostéticos asociados a proteínasOscar Guerra
 
Dogma central de la Biología.
Dogma central de la Biología.Dogma central de la Biología.
Dogma central de la Biología.Claudita Aranguiz
 
Moléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac Nucleicos
Moléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac NucleicosMoléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac Nucleicos
Moléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac NucleicosAngel Cartuche
 
Replicación, Transcripción y Traducción del ADN
Replicación, Transcripción y Traducción del ADNReplicación, Transcripción y Traducción del ADN
Replicación, Transcripción y Traducción del ADNKarol110694
 
Del ADN a las proteínas
Del ADN a las proteínasDel ADN a las proteínas
Del ADN a las proteínasEduardo Gómez
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica moleculardimaxbatista
 
Peroxisomas
PeroxisomasPeroxisomas
Peroxisomasmaycardi
 
Sintesis De Proteinas
Sintesis De ProteinasSintesis De Proteinas
Sintesis De Proteinasguest16fa80
 
BASES CROMOSÓMICAS DE LA HERENCIA por Vanessa Jacome
BASES CROMOSÓMICAS DE LA HERENCIA por Vanessa JacomeBASES CROMOSÓMICAS DE LA HERENCIA por Vanessa Jacome
BASES CROMOSÓMICAS DE LA HERENCIA por Vanessa Jacomevanealejandra
 

La actualidad más candente (20)

Las proteínas 2013
Las proteínas 2013Las proteínas 2013
Las proteínas 2013
 
Mendelismo complejo
Mendelismo complejoMendelismo complejo
Mendelismo complejo
 
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓNTema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
 
Especificidad de proteínas
Especificidad de proteínasEspecificidad de proteínas
Especificidad de proteínas
 
Biomoléculas proteinas 1
Biomoléculas proteinas 1Biomoléculas proteinas 1
Biomoléculas proteinas 1
 
Aminoacidos 1213
Aminoacidos 1213Aminoacidos 1213
Aminoacidos 1213
 
Grupos prostéticos asociados a proteínas
Grupos prostéticos asociados a proteínasGrupos prostéticos asociados a proteínas
Grupos prostéticos asociados a proteínas
 
Dogma central de la Biología.
Dogma central de la Biología.Dogma central de la Biología.
Dogma central de la Biología.
 
Moléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac Nucleicos
Moléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac NucleicosMoléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac Nucleicos
Moléculas de la Materia viva: Proteinas, Lípidos, Carbohidratos y Ac Nucleicos
 
Replicación, Transcripción y Traducción del ADN
Replicación, Transcripción y Traducción del ADNReplicación, Transcripción y Traducción del ADN
Replicación, Transcripción y Traducción del ADN
 
Aplicaciones PCR
Aplicaciones PCRAplicaciones PCR
Aplicaciones PCR
 
Del ADN a las proteínas
Del ADN a las proteínasDel ADN a las proteínas
Del ADN a las proteínas
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
 
Las coenzimas
Las coenzimasLas coenzimas
Las coenzimas
 
Peroxisomas
PeroxisomasPeroxisomas
Peroxisomas
 
Sintesis De Proteinas
Sintesis De ProteinasSintesis De Proteinas
Sintesis De Proteinas
 
Adn
AdnAdn
Adn
 
Peroxisomas
PeroxisomasPeroxisomas
Peroxisomas
 
BASES CROMOSÓMICAS DE LA HERENCIA por Vanessa Jacome
BASES CROMOSÓMICAS DE LA HERENCIA por Vanessa JacomeBASES CROMOSÓMICAS DE LA HERENCIA por Vanessa Jacome
BASES CROMOSÓMICAS DE LA HERENCIA por Vanessa Jacome
 
Clase Ficomicetos
Clase FicomicetosClase Ficomicetos
Clase Ficomicetos
 

Destacado

Webquest Julio Verne
Webquest Julio VerneWebquest Julio Verne
Webquest Julio Verneguest47727c
 
Estructura y funcion del adn
Estructura y funcion del adnEstructura y funcion del adn
Estructura y funcion del adnkRyss
 
Fichas proyecto la vuelta al mundo
Fichas proyecto la vuelta al mundoFichas proyecto la vuelta al mundo
Fichas proyecto la vuelta al mundolaragmezgmez
 
El informe cientifico
El informe cientificoEl informe cientifico
El informe cientificofrank
 
Severo Ochoa- Alberto Arminio y Pablo Mata
Severo Ochoa- Alberto Arminio y Pablo MataSevero Ochoa- Alberto Arminio y Pablo Mata
Severo Ochoa- Alberto Arminio y Pablo MataJoaquin Luceno
 

Destacado (10)

Adn estefanía castellanos 1º bch
Adn estefanía castellanos 1º bchAdn estefanía castellanos 1º bch
Adn estefanía castellanos 1º bch
 
Adn inf i3
Adn inf i3Adn inf i3
Adn inf i3
 
Webquest Julio Verne
Webquest Julio VerneWebquest Julio Verne
Webquest Julio Verne
 
Verne vida y obras
Verne vida y obrasVerne vida y obras
Verne vida y obras
 
Adn 1copi a
Adn 1copi aAdn 1copi a
Adn 1copi a
 
Replicacion
ReplicacionReplicacion
Replicacion
 
Estructura y funcion del adn
Estructura y funcion del adnEstructura y funcion del adn
Estructura y funcion del adn
 
Fichas proyecto la vuelta al mundo
Fichas proyecto la vuelta al mundoFichas proyecto la vuelta al mundo
Fichas proyecto la vuelta al mundo
 
El informe cientifico
El informe cientificoEl informe cientifico
El informe cientifico
 
Severo Ochoa- Alberto Arminio y Pablo Mata
Severo Ochoa- Alberto Arminio y Pablo MataSevero Ochoa- Alberto Arminio y Pablo Mata
Severo Ochoa- Alberto Arminio y Pablo Mata
 

Similar a La genética molecular

Similar a La genética molecular (20)

Biologia 2
Biologia 2Biologia 2
Biologia 2
 
Sintesis de proteinas biologia
Sintesis   de  proteinas biologiaSintesis   de  proteinas biologia
Sintesis de proteinas biologia
 
Monograffff-- MIGUEL CHACON
Monograffff-- MIGUEL CHACONMonograffff-- MIGUEL CHACON
Monograffff-- MIGUEL CHACON
 
Adn y arn
Adn y arnAdn y arn
Adn y arn
 
Adn
AdnAdn
Adn
 
Cap6
Cap6Cap6
Cap6
 
CODIGO GENETICO HUMANO REPLICACIÓN, TRADUCCIÓN Y TRANSCRIPCIÓN .ppt
CODIGO GENETICO HUMANO REPLICACIÓN, TRADUCCIÓN Y TRANSCRIPCIÓN .pptCODIGO GENETICO HUMANO REPLICACIÓN, TRADUCCIÓN Y TRANSCRIPCIÓN .ppt
CODIGO GENETICO HUMANO REPLICACIÓN, TRADUCCIÓN Y TRANSCRIPCIÓN .ppt
 
Los ácidos nucleicos
Los ácidos nucleicosLos ácidos nucleicos
Los ácidos nucleicos
 
Los ácidos nucleicos
Los ácidos nucleicosLos ácidos nucleicos
Los ácidos nucleicos
 
hpja
hpjahpja
hpja
 
Tema4 los genes y la manipulacion
Tema4 los genes y la manipulacionTema4 los genes y la manipulacion
Tema4 los genes y la manipulacion
 
ADN Y ARN
ADN Y ARNADN Y ARN
ADN Y ARN
 
Adn y arn (1)
Adn y arn (1)Adn y arn (1)
Adn y arn (1)
 
bases quimicas para herencia
bases quimicas para herenciabases quimicas para herencia
bases quimicas para herencia
 
Genética Molecular
Genética MolecularGenética Molecular
Genética Molecular
 
Adn, replica, transcr, traducc
Adn, replica, transcr, traduccAdn, replica, transcr, traducc
Adn, replica, transcr, traducc
 
Replicación ADN
Replicación ADNReplicación ADN
Replicación ADN
 
GENETICA MOLECULAR
GENETICA MOLECULARGENETICA MOLECULAR
GENETICA MOLECULAR
 
HERENCIA REPRODUCCIÓN Y EVOLUCIÓN.pptx
HERENCIA REPRODUCCIÓN Y EVOLUCIÓN.pptxHERENCIA REPRODUCCIÓN Y EVOLUCIÓN.pptx
HERENCIA REPRODUCCIÓN Y EVOLUCIÓN.pptx
 
4ºESO: Genetica Molecular
4ºESO: Genetica Molecular4ºESO: Genetica Molecular
4ºESO: Genetica Molecular
 

Más de eugenia6709

La alimentacion1
La alimentacion1La alimentacion1
La alimentacion1eugenia6709
 
Accidentes trafico
Accidentes traficoAccidentes trafico
Accidentes traficoeugenia6709
 
Enfermedades hereditarias
Enfermedades hereditariasEnfermedades hereditarias
Enfermedades hereditariaseugenia6709
 
Enfermedades degenerativas trabajo cmc
Enfermedades degenerativas trabajo cmcEnfermedades degenerativas trabajo cmc
Enfermedades degenerativas trabajo cmceugenia6709
 
Trastornos alimentarios, anorexia y bulimia
Trastornos alimentarios, anorexia y bulimiaTrastornos alimentarios, anorexia y bulimia
Trastornos alimentarios, anorexia y bulimiaeugenia6709
 
Presentacion cmc. enfermedades degenerativas
Presentacion cmc. enfermedades degenerativasPresentacion cmc. enfermedades degenerativas
Presentacion cmc. enfermedades degenerativaseugenia6709
 
Mendel (trabajo completo)
Mendel (trabajo completo)Mendel (trabajo completo)
Mendel (trabajo completo)eugenia6709
 
Acc. tráfico 1º bach d
Acc. tráfico   1º bach dAcc. tráfico   1º bach d
Acc. tráfico 1º bach deugenia6709
 
Anorexia y bulimia
Anorexia y bulimiaAnorexia y bulimia
Anorexia y bulimiaeugenia6709
 
Enfermedades hereditarias 1 c
Enfermedades hereditarias 1 cEnfermedades hereditarias 1 c
Enfermedades hereditarias 1 ceugenia6709
 
Habitos saludables
Habitos saludablesHabitos saludables
Habitos saludableseugenia6709
 
Accidentes de trafico
Accidentes de traficoAccidentes de trafico
Accidentes de traficoeugenia6709
 
Concepto de medio ambiente y dinámica de sistemas
Concepto de medio ambiente y dinámica de sistemasConcepto de medio ambiente y dinámica de sistemas
Concepto de medio ambiente y dinámica de sistemaseugenia6709
 
Humanidad y nedio ambiente
Humanidad y nedio ambienteHumanidad y nedio ambiente
Humanidad y nedio ambienteeugenia6709
 

Más de eugenia6709 (20)

La alimentacion1
La alimentacion1La alimentacion1
La alimentacion1
 
Drogas 1
Drogas 1Drogas 1
Drogas 1
 
Accidentes trafico
Accidentes traficoAccidentes trafico
Accidentes trafico
 
Enfermedades hereditarias
Enfermedades hereditariasEnfermedades hereditarias
Enfermedades hereditarias
 
Enfermedades degenerativas trabajo cmc
Enfermedades degenerativas trabajo cmcEnfermedades degenerativas trabajo cmc
Enfermedades degenerativas trabajo cmc
 
Drogas3
Drogas3Drogas3
Drogas3
 
Drogas2
Drogas2Drogas2
Drogas2
 
Trastornos alimentarios, anorexia y bulimia
Trastornos alimentarios, anorexia y bulimiaTrastornos alimentarios, anorexia y bulimia
Trastornos alimentarios, anorexia y bulimia
 
Presentacion cmc. enfermedades degenerativas
Presentacion cmc. enfermedades degenerativasPresentacion cmc. enfermedades degenerativas
Presentacion cmc. enfermedades degenerativas
 
Mendel (trabajo completo)
Mendel (trabajo completo)Mendel (trabajo completo)
Mendel (trabajo completo)
 
Acc. tráfico 1º bach d
Acc. tráfico   1º bach dAcc. tráfico   1º bach d
Acc. tráfico 1º bach d
 
Anorexia y bulimia
Anorexia y bulimiaAnorexia y bulimia
Anorexia y bulimia
 
Enfermedades hereditarias 1 c
Enfermedades hereditarias 1 cEnfermedades hereditarias 1 c
Enfermedades hereditarias 1 c
 
Drogas
DrogasDrogas
Drogas
 
Trabajo de cmc
Trabajo de cmcTrabajo de cmc
Trabajo de cmc
 
Habitos saludables
Habitos saludablesHabitos saludables
Habitos saludables
 
Accidentes de trafico
Accidentes de traficoAccidentes de trafico
Accidentes de trafico
 
Concepto de medio ambiente y dinámica de sistemas
Concepto de medio ambiente y dinámica de sistemasConcepto de medio ambiente y dinámica de sistemas
Concepto de medio ambiente y dinámica de sistemas
 
Humanidad y nedio ambiente
Humanidad y nedio ambienteHumanidad y nedio ambiente
Humanidad y nedio ambiente
 
Pret placas
Pret placasPret placas
Pret placas
 

Último

05 Fenomenos fisicos y quimicos de la materia.pdf
05 Fenomenos fisicos y quimicos de la materia.pdf05 Fenomenos fisicos y quimicos de la materia.pdf
05 Fenomenos fisicos y quimicos de la materia.pdfRAMON EUSTAQUIO CARO BAYONA
 
IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO YESSENIA 933623393 NUEV...
IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO  YESSENIA 933623393 NUEV...IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO  YESSENIA 933623393 NUEV...
IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO YESSENIA 933623393 NUEV...YobanaZevallosSantil1
 
SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024
SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024
SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024gharce
 
5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdf
5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdf5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdf
5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdfOswaldoGonzalezCruz
 
Técnicas de grabado y estampación : procesos y materiales
Técnicas de grabado y estampación : procesos y materialesTécnicas de grabado y estampación : procesos y materiales
Técnicas de grabado y estampación : procesos y materialesRaquel Martín Contreras
 
TUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJO
TUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJOTUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJO
TUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJOweislaco
 
Contextualización y aproximación al objeto de estudio de investigación cualit...
Contextualización y aproximación al objeto de estudio de investigación cualit...Contextualización y aproximación al objeto de estudio de investigación cualit...
Contextualización y aproximación al objeto de estudio de investigación cualit...Angélica Soledad Vega Ramírez
 
PROGRAMACION ANUAL DE MATEMATICA 2024.docx
PROGRAMACION ANUAL DE MATEMATICA 2024.docxPROGRAMACION ANUAL DE MATEMATICA 2024.docx
PROGRAMACION ANUAL DE MATEMATICA 2024.docxEribertoPerezRamirez
 
Día de la Madre Tierra-1.pdf día mundial
Día de la Madre Tierra-1.pdf día mundialDía de la Madre Tierra-1.pdf día mundial
Día de la Madre Tierra-1.pdf día mundialpatriciaines1993
 
DETALLES EN EL DISEÑO DE INTERIOR
DETALLES EN EL DISEÑO DE INTERIORDETALLES EN EL DISEÑO DE INTERIOR
DETALLES EN EL DISEÑO DE INTERIORGonella
 
Manejo del Dengue, generalidades, actualización marzo 2024 minsa
Manejo del Dengue, generalidades, actualización marzo 2024 minsaManejo del Dengue, generalidades, actualización marzo 2024 minsa
Manejo del Dengue, generalidades, actualización marzo 2024 minsaLuis Minaya
 
Fichas de Matemática DE SEGUNDO DE SECUNDARIA.pdf
Fichas de Matemática DE SEGUNDO DE SECUNDARIA.pdfFichas de Matemática DE SEGUNDO DE SECUNDARIA.pdf
Fichas de Matemática DE SEGUNDO DE SECUNDARIA.pdfssuser50d1252
 
4º SOY LECTOR PART2- MD EDUCATIVO.p df PARTE
4º SOY LECTOR PART2- MD  EDUCATIVO.p df PARTE4º SOY LECTOR PART2- MD  EDUCATIVO.p df PARTE
4º SOY LECTOR PART2- MD EDUCATIVO.p df PARTESaraNolasco4
 
Monitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptx
Monitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptxMonitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptx
Monitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptxJUANCARLOSAPARCANARE
 
Actividad transversal 2-bloque 2. Actualización 2024
Actividad transversal 2-bloque 2. Actualización 2024Actividad transversal 2-bloque 2. Actualización 2024
Actividad transversal 2-bloque 2. Actualización 2024Rosabel UA
 

Último (20)

05 Fenomenos fisicos y quimicos de la materia.pdf
05 Fenomenos fisicos y quimicos de la materia.pdf05 Fenomenos fisicos y quimicos de la materia.pdf
05 Fenomenos fisicos y quimicos de la materia.pdf
 
Tema 7.- E-COMMERCE SISTEMAS DE INFORMACION.pdf
Tema 7.- E-COMMERCE SISTEMAS DE INFORMACION.pdfTema 7.- E-COMMERCE SISTEMAS DE INFORMACION.pdf
Tema 7.- E-COMMERCE SISTEMAS DE INFORMACION.pdf
 
IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO YESSENIA 933623393 NUEV...
IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO  YESSENIA 933623393 NUEV...IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO  YESSENIA 933623393 NUEV...
IV SES LUN 15 TUTO CUIDO MI MENTE CUIDANDO MI CUERPO YESSENIA 933623393 NUEV...
 
VISITA À PROTEÇÃO CIVIL _
VISITA À PROTEÇÃO CIVIL                  _VISITA À PROTEÇÃO CIVIL                  _
VISITA À PROTEÇÃO CIVIL _
 
TL/CNL – 2.ª FASE .
TL/CNL – 2.ª FASE                       .TL/CNL – 2.ª FASE                       .
TL/CNL – 2.ª FASE .
 
SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024
SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024
SISTEMA INMUNE FISIOLOGIA MEDICA UNSL 2024
 
5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdf
5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdf5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdf
5° SEM29 CRONOGRAMA PLANEACIÓN DOCENTE DARUKEL 23-24.pdf
 
Técnicas de grabado y estampación : procesos y materiales
Técnicas de grabado y estampación : procesos y materialesTécnicas de grabado y estampación : procesos y materiales
Técnicas de grabado y estampación : procesos y materiales
 
TUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJO
TUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJOTUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJO
TUTORIA II - CIRCULO DORADO UNIVERSIDAD CESAR VALLEJO
 
Contextualización y aproximación al objeto de estudio de investigación cualit...
Contextualización y aproximación al objeto de estudio de investigación cualit...Contextualización y aproximación al objeto de estudio de investigación cualit...
Contextualización y aproximación al objeto de estudio de investigación cualit...
 
La luz brilla en la oscuridad. Necesitamos luz
La luz brilla en la oscuridad. Necesitamos luzLa luz brilla en la oscuridad. Necesitamos luz
La luz brilla en la oscuridad. Necesitamos luz
 
PROGRAMACION ANUAL DE MATEMATICA 2024.docx
PROGRAMACION ANUAL DE MATEMATICA 2024.docxPROGRAMACION ANUAL DE MATEMATICA 2024.docx
PROGRAMACION ANUAL DE MATEMATICA 2024.docx
 
Día de la Madre Tierra-1.pdf día mundial
Día de la Madre Tierra-1.pdf día mundialDía de la Madre Tierra-1.pdf día mundial
Día de la Madre Tierra-1.pdf día mundial
 
DETALLES EN EL DISEÑO DE INTERIOR
DETALLES EN EL DISEÑO DE INTERIORDETALLES EN EL DISEÑO DE INTERIOR
DETALLES EN EL DISEÑO DE INTERIOR
 
Manejo del Dengue, generalidades, actualización marzo 2024 minsa
Manejo del Dengue, generalidades, actualización marzo 2024 minsaManejo del Dengue, generalidades, actualización marzo 2024 minsa
Manejo del Dengue, generalidades, actualización marzo 2024 minsa
 
Aedes aegypti + Intro to Coquies EE.pptx
Aedes aegypti + Intro to Coquies EE.pptxAedes aegypti + Intro to Coquies EE.pptx
Aedes aegypti + Intro to Coquies EE.pptx
 
Fichas de Matemática DE SEGUNDO DE SECUNDARIA.pdf
Fichas de Matemática DE SEGUNDO DE SECUNDARIA.pdfFichas de Matemática DE SEGUNDO DE SECUNDARIA.pdf
Fichas de Matemática DE SEGUNDO DE SECUNDARIA.pdf
 
4º SOY LECTOR PART2- MD EDUCATIVO.p df PARTE
4º SOY LECTOR PART2- MD  EDUCATIVO.p df PARTE4º SOY LECTOR PART2- MD  EDUCATIVO.p df PARTE
4º SOY LECTOR PART2- MD EDUCATIVO.p df PARTE
 
Monitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptx
Monitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptxMonitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptx
Monitoreo a los coordinadores de las IIEE JEC_28.02.2024.vf.pptx
 
Actividad transversal 2-bloque 2. Actualización 2024
Actividad transversal 2-bloque 2. Actualización 2024Actividad transversal 2-bloque 2. Actualización 2024
Actividad transversal 2-bloque 2. Actualización 2024
 

La genética molecular

  • 2.  
  • 3. El ADN: el secreto de la vida Para conocer el ADN tenemos que saber: Su composición Su estructura Cómo se expresa su información Cómo se transmite la información de generación en generación
  • 5.
  • 6.
  • 7.
  • 8.
  • 9. LA ESTRUCTURA DEL ADN
  • 10.
  • 11.
  • 12.
  • 13.
  • 14. La estructura del ADN El ADN constituye largas cadenas. Cada molécula de ADN forma, junto a otras moléculas denominadas histonas, una sustancia denominada cromatina, durante la división celular la cromatina se condensa y forma los cromosomas ¿Cuántas moléculas de ADN hay en cada célula de un ser humano? 46
  • 15. Expresión de la información genética
  • 16.
  • 17.
  • 18. Expresión de la información genética. Uno de los científicos que contribuyó a descubrir como se realizaba esta traducción fue Severo Ochoa. Su trabajo en este campo le valió el Premio Nobel.
  • 19.
  • 20. Expresión de la información genética. La transcripción ADN ARN ACCGGTACTGACAGTACTTCC TGGCCATGACTGTCATGAAGG Molécula de ADN
  • 21.
  • 22.
  • 23. Expresión de la información genética. La traducción ARN Proteínas Se traduce un lenguaje con cuatro signos (las cuatro bases nitrogenadas) a un lenguaje con veinte signos (los veinte aminoácidos que componen las proteínas)
  • 24. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA Tiene lugar en los ribosomas, donde el ARNm lleva la información del ADN ARN Ribosoma Aminoácido Proteína en formación Los aminoácidos son conducidos al ribosoma por el ARNt, y unidos según indica la secuencia de nucleótidos del ARNm
  • 25. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 26. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 27. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 28. Expresión de la información genética. La traducción AUG CCU CAU AGU GGC UAA ARN
  • 29. Expresión de la información genética. La traducción Aquí se observa como varios ribosomas trabajan a la vez para conseguir varias copias de la proteína.
  • 30. Expresión de la información genética. El código genético establece la relación que hay entre los tripletes de bases y los aminoácidos de las proteínas
  • 31. Expresión de la información genética. Deduce la secuencia de aminoácidos AUG CCU CAU AGU GGC UAA
  • 32.
  • 33.