Mutación
M. en C. RAFAEL GOVEA
M. en C. RAFAEL GOVEA
VILLASEÑOR
VILLASEÑOR
CINVESTAV-IPN
CINVESTAV-IPN
Versión 1.5
¿Qué es una Mutación?

Una mutación es cualesquier cambio
en la información genética
Por lo tanto, la mutación es la
fuent...
¿Cuáles tipos de Mutación existen?

Mutaciones Génicas
Mutaciones o Aberraciones Cromosómicas
Mutaciones Genómicas
Mutacio...
¿Cuál es el soporte de la Información Genética?

En la secuencia de pares de
bases de Bases del Ácido
Desoxirribonucleico,...
D
D

C
C

D

D
D

El ADN es un polímero
de 2 cadenas de P
A
nucleótidos unidos por
D
enlaces fosfo-diester
P
C
formando un...
DNA
El ADN posee 2 cadenas antiparalelas [misma dirección,
pero de sentidos opuestos] y complementarias de 5’ a 3’
–la cad...
Cómo se usa la Información Genética
Copiando la secuencia de pb del ADN como secuencia de
nucleótidos en moléculas ARN [tr...
¿Qué es el Código Genético?

Es la tabla que contiene el nombre de los
aminoácidos escrito en el alfabeto del
ARN
El nombr...
Código Genético
En el código tradicional las BN del codón se anotan a los lados izquierdo, la 1ª BN;
superior, la 2ª BN y ...
¿Qué son las Mutaciones génicas?

Son los cambios en la información
genética que afectan a un gen. Ellas
pueden implicar t...
Tipos de Mutaciones génicas
• Mutaciones puntuales [sustituciones de una Base N]
– Transversiones. Sustitución de purina c...
Tipos de Mutaciones Génicas Por su efecto
• Mutaciones Silenciosas: Se mantiene el significado,
codifican para el mismo am...
Mutaciones Génicas, Sustituciones
G

A

Transversiones C

T

Transiciones:
Mutuaciones Puntuales
(Sustitución de 1 base)

...
Mutaciones Génicas, Sustituciones
M. Puntuales
(Sustitución de 1 base)
Por ejemplo el siguiente
ADN se traduce así:

G

A
...
Mutaciones Génicas, Sustituciones
Si mutamos por transversión la T señalada el
codón CAT se convierte
en su sinónimo CAC. ...
Mutaciones Génicas, Sustituciones
Si mutamos por transversión la G señalada del
codón AgC, este se
convierte en ACC. Por
t...
Mutaciones Génicas, Sustituciones
Si mutamos por
transición la G señalada
del codón gAg, este se
convierte en AAg. Por
tan...
Mutaciones Génicas, Sustituciones
Si mutamos por transversión la G señalada del
codón gCT, este se
convierte en CCT. Por
t...
Mutaciones Génicas, Sustituciones
Si mutamos por
transición la G señalada
del codón TGG, este se
convierte en TGA. Por
tan...
Mutaciones Génicas, Inserción de 1BN
Si tenemos el siguiente trozo de ADN que se traduce así:

ATgCATgACAgCgAgCTAgCTTTCTgg...
Mutaciones Génicas, Inserción de 2 BN
Si tenemos el mismo trozo de ADN que se traduce así:

ATgCATgACAgCgAgCTAgCTTTCTggTTg...
Mutaciones Génicas, Inserciones de 3 BN
Si tenemos el mismo trozo de ADN que se traduce así:

ATgCATgACAgCgAgCTAgCTTTCTggT...
Efecto de las Inserciones de BN

Así las inserciones producen una proteína con un aminoácido de más u otras proteínas
comp...
Mutaciones Génicas, Deleción de 1 BN
Si tenemos el siguiente trozo de ADN que se traduce así:

ATggCTCATgACAgCgAgCTAgCTTTC...
Mutaciones Génicas, Deleción de 2 BN
Si tenemos el mismo trozo de ADN que se traduce así:

ATggCTCATgACAgCgAgCTAgCTTTCTggT...
Mutaciones Génicas, Deleción de 3 BN
Si tenemos el mismo trozo de ADN que se traduce así:

ATggCTCATgACAgCgAgCTAgCTTTCTggT...
Efecto de las Deleciones de BN
Así las deleciones producen una proteína con un aminoácido de menos u otras
proteínas compl...
Duplicaciones por Recombinación Ilegítima

La topoisomerasa I
Corta en dos CCCAT

Exones II duplicados
¿Qué son las Mutaciones Cromosómicas?

Son cambios que afectan la estructura de
los cromosomas o su número.

M en C Rafael...
Mutaciones (Aberraciones) Cromosómicas

Aberraciones Numéricas:
Aumenta o disminuye la dotación de un
cromosoma dado
Aberr...
Aberraciones Cromosómicas Numéricas

Aneuploidías

Monosomías: X0
(Turner) 1:104
Trisomías:
T21 1:800,
T18 1:8000,
XXY(Kli...
Aberraciones Cromosómicas Estructurales
Deleciones 46,XX, del(5p) S. de cri du chat
Inserciones
Inversiones inv(3)p25q21)
...
¿Qué son las deleciones?
En estas mutaciones el cromosoma pierde porciones
de si mismo

M en C Rafael Govea Villaseñor
¿Qué son las inserciones?
Son mutaciones que integran secuencias de ADN
extrañas a los cromosomas

M en C Rafael Govea Vil...
¿Qué son las inversiones?
Son mutaciones que implican la rotura del
cromosoma en dos puntos y el giro de 180 grados
del tr...
¿Qué son las translocaciones?
Son mutaciones en las que porciones de un
cromosoma roto se unen a otro cromosoma

M en C Ra...
¿Qué son las Mutaciones Genómicas?

Son
cambios que
afectan la
estructura
del juego
completo de
cromosomas
M en C Rafael G...
Tipos de Mutágenos
Luz UV-B: 320-280 nm, UV-C: 280-200 nm

Físicos

R-X
Rayos α, β y γ

Químicos

Biológicos
M en C Rafael...
Penetración de la Luz UV en la Piel

Melanoma un
tipo de
cáncer
maligno de la
piel
El agua también es un potente Mutágeno

M en C Rafael Govea Villaseñor
Duplicaciones por Retrotransposición

Exones barajeados

Señal de terminación

Señal de inicio
Mutación como Fuerza Evolutiva

La mutación es una fuerza evolutiva
débil. Si sólo ella actúa, el cambio en la
información...
Pero la Mutación es una espléndida fuente
de variación que puede ser seleccionada
5x106

5x108

5x106

5x108

5x106 3000 g...
Próxima SlideShare
Cargando en…5
×

Mutación como fuente de Variabilidad

6.517 visualizaciones

Publicado el

Trata las mutaciones como fuente de variabilidad. Versión preliminar e incompleta

Publicado en: Educación, Tecnología
0 comentarios
3 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

Sin descargas
Visualizaciones
Visualizaciones totales
6.517
En SlideShare
0
De insertados
0
Número de insertados
437
Acciones
Compartido
0
Descargas
3
Comentarios
0
Recomendaciones
3
Insertados 0
No insertados

No hay notas en la diapositiva.

Mutación como fuente de Variabilidad

  1. 1. Mutación M. en C. RAFAEL GOVEA M. en C. RAFAEL GOVEA VILLASEÑOR VILLASEÑOR CINVESTAV-IPN CINVESTAV-IPN Versión 1.5
  2. 2. ¿Qué es una Mutación? Una mutación es cualesquier cambio en la información genética Por lo tanto, la mutación es la fuente primaria de variabilidad para el proceso evolutivo M en C Rafael Govea Villaseñor
  3. 3. ¿Cuáles tipos de Mutación existen? Mutaciones Génicas Mutaciones o Aberraciones Cromosómicas Mutaciones Genómicas Mutaciones Epigenéticas M en C Rafael Govea Villaseñor
  4. 4. ¿Cuál es el soporte de la Información Genética? En la secuencia de pares de bases de Bases del Ácido Desoxirribonucleico, el ADN, se guarda la información necesaria para sintetizar todas las macromoléculas que llevan a cabo las funciones celulares M en C Rafael Govea Villaseñor
  5. 5. D D C C D D D El ADN es un polímero de 2 cadenas de P A nucleótidos unidos por D enlaces fosfo-diester P C formando una doble D hélice delgada y muy larga gracias a los P puentes de H de sus D pares de bases T T P P D D G G D D M en C Rafael Govea Villaseñor 3' T A A G P P P P P 5' El ADN es muy delgado, apenas de 2 nm de ancho y muy largo mide de milímetros a centímetros . Hay 10 pares de bases [pb] en cada 3.43 nm 3' Como el genoma humano Tiene 2 juegos de 3.3 Mpb entonces las 46 moléculas miden 1.94 m P P ADN 5' Diapo 0052
  6. 6. DNA El ADN posee 2 cadenas antiparalelas [misma dirección, pero de sentidos opuestos] y complementarias de 5’ a 3’ –la cadena sentido- y 3’ a 5’ –la antisentido. CADENA "SENTIDO" 5' 3' GCATGTACGTAGCTAGCTAAG 3' CGTACATGCATCGATCGATTC 5' CADENA "ANTISENTIDO" M en C Rafael Govea Villaseñor Diapo 1152
  7. 7. Cómo se usa la Información Genética Copiando la secuencia de pb del ADN como secuencia de nucleótidos en moléculas ARN [transcrito primario] que se corta y empalma en diversas moléculas de ARN [ARN de transferencia, ribosomal, mensajero y otros] que permiten construir las moléculas de las proteínas ARNt ARN T.1º Proteína ARNm ADN Corte y ARN Traducción Réplicación Transcripción r empalme
  8. 8. ¿Qué es el Código Genético? Es la tabla que contiene el nombre de los aminoácidos escrito en el alfabeto del ARN El nombre de los aminoácidos es un triplete de nucleótidos del ARNm [codón] que la célula reconoce y permite tomar c/u de los 20 aminoácidos proteícos y unirlos por enlaces peptídicos. Así pues hay 4x4x4 combinaciones de Bases disponibles, es decir 64 codones para nombrar a 20 aminoácidos. M en C Rafael Govea Villaseñor
  9. 9. Código Genético En el código tradicional las BN del codón se anotan a los lados izquierdo, la 1ª BN; superior, la 2ª BN y derecho, la 3ª BN. En el punto de intersección del renglón, columna y línea se encuentra el nombre del aminoácido codificado por el codón M en C Rafael Govea Villaseñor
  10. 10. ¿Qué son las Mutaciones génicas? Son los cambios en la información genética que afectan a un gen. Ellas pueden implicar tan solo un cambio en un solo par de bases o modificaciones más extensas. A veces se les denomina mutaciones puntuales M en C Rafael Govea Villaseñor
  11. 11. Tipos de Mutaciones génicas • Mutaciones puntuales [sustituciones de una Base N] – Transversiones. Sustitución de purina con pirimidina o de pirimidina con purina – Transiciones. De purina a purina o de pirimidina a pirimidina • Inserciones. Es el aumento de nucléótidos – De 1, 2 ó 3 bases • Delecciones. Es la pérdida de nucleótidos. – De 1, 2 ó 3 bases M en C Rafael Govea Villaseñor
  12. 12. Tipos de Mutaciones Génicas Por su efecto • Mutaciones Silenciosas: Se mantiene el significado, codifican para el mismo aminoácido • Mutaciones de Sentido erróneo: Cambia el aminoácido codificado • Mutaciones Sin Sentido: Aparece una señal de terminación de la traducción. Provoca la síntesis de proteínas acortadas. • Mutaciones Corrimiento del marco de lectura. Cambia el sentido de toda la secuencia de aminoácidos . M en C Rafael Govea Villaseñor
  13. 13. Mutaciones Génicas, Sustituciones G A Transversiones C T Transiciones: Mutuaciones Puntuales (Sustitución de 1 base) M en C Rafael Govea Villaseñor
  14. 14. Mutaciones Génicas, Sustituciones M. Puntuales (Sustitución de 1 base) Por ejemplo el siguiente ADN se traduce así: G A Transversiones C T Transiciones: ATg CAT gAC AgC gAg CTA gCT TTC Tgg Met-His-Asp-Ser-Glu-Leu-Ala-Fen-Trp 5’ M en C Rafael Govea Villaseñor 3’
  15. 15. Mutaciones Génicas, Sustituciones Si mutamos por transversión la T señalada el codón CAT se convierte en su sinónimo CAC. Por tanto la mutación no cambia el aa codificado G A Transversiones C T Transiciones: ATg CAT gAC AgC gAg CTA gCT TTC Tgg Met-His-Asp-Ser-Glu-Leu-Ala-Fen-Trp 5’ 3’ ATg CAC gAC ACC AAg CTA CCT TTC TgA 3’ Met-His-Asp-Tre-Lis-Leu-Pro–Fen-stop 5’ silenciosa M en C Rafael Govea Villaseñor
  16. 16. Mutaciones Génicas, Sustituciones Si mutamos por transversión la G señalada del codón AgC, este se convierte en ACC. Por tanto la mutación cambia el aa codificado G A Transversiones C T Transiciones: ATg CAT gAC AgC gAg CTA gCT TTC Tgg Met-His-Asp-Ser-Glu-Leu-Ala-Fen-Trp 5’ 3’ ATg CAC gAC ACC AAg CTA CCT TTC TgA 3’ Met-His-Asp-Tre-Lis-Leu-Pro–Fen-stop 5’ Sentido erróneo: la Serina se sustituye por la Treonina M en C Rafael Govea Villaseñor
  17. 17. Mutaciones Génicas, Sustituciones Si mutamos por transición la G señalada del codón gAg, este se convierte en AAg. Por tanto la mutación cambia el aa codificado G A Transversiones C T Transiciones: ATg CAT gAC AgC gAg CTA gCT TTC Tgg Met-His-Asp-Ser-Glu-Leu-Ala-Fen-Trp 5’ 3’ ATg CAC gAC ACC AAg CTA CCT TTC TgA 3’ Met-His-Asp-Tre-Lis-Leu-Pro–Fen-stop 5’ Sentido erróneo, el ácido glutámico se sustituye por la Lisina M en C Rafael Govea Villaseñor
  18. 18. Mutaciones Génicas, Sustituciones Si mutamos por transversión la G señalada del codón gCT, este se convierte en CCT. Por tanto la mutación cambia el aa codificado G A Transversiones C T Transiciones: ATg CAT gAC AgC gAg CTA gCT TTC Tgg Met-His-Asp-Ser-Glu-Leu-Ala-Fen-Trp 5’ 3’ ATg CAC gAC ACC AAg CTA CCT TTC TgA 3’ Met-His-Asp-Tre-Lis-Leu-Pro–Fen-stop 5’ Sentido erróneo: la Alanina se cambia por la Prolina M en C Rafael Govea Villaseñor
  19. 19. Mutaciones Génicas, Sustituciones Si mutamos por transición la G señalada del codón TGG, este se convierte en TGA. Por tanto la mutación no codifica ningún aa G A Transversiones C T Transiciones: ATg CAT gAC AgC gAg CTA gCT TTC Tgg Met-His-Asp-Ser-Glu-Leu-Ala-Fen-Trp 5’ 3’ ATg CAC gAC ACC AAg CTA CCT TTC TgA 3’ Met-His-Asp-Tre-Lis-Leu-Pro–Fen-stop 5’ M en C Rafael Govea Villaseñor Sin sentido: el Triptofano cambia a stop, es decir, se detiene la traducción
  20. 20. Mutaciones Génicas, Inserción de 1BN Si tenemos el siguiente trozo de ADN que se traduce así: ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg M H D S E L A F W L I-- 5’ 3’ Y luego Insertamos 1 Base, por ejemplo T antes del codón CAT T 5’ ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ La secuencia de ADN cambia y se traduce diferente: ATgTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M S stop-------------------------La proteína no se produce por que aparece una señal de stop: 5’ M en C Rafael Govea Villaseñor
  21. 21. Mutaciones Génicas, Inserción de 2 BN Si tenemos el mismo trozo de ADN que se traduce así: ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg M H D S E L A F W L I-- 5’ 3’ Y luego Insertamos 2 Bases, por ejemplo CT después del codón ATg CT 5’ ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ La secuencia de ADN cambia y se traduce diferente: ATgCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M L M T A S stop--------------- 5’ 3’ Se produce otra proteína más corta debido a otra señal de stop: M en C Rafael Govea Villaseñor
  22. 22. Mutaciones Génicas, Inserciones de 3 BN Si tenemos el mismo trozo de ADN que se traduce así: ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg M H D S E L A F W L I-- 5’ 3’ Y luego Insertamos 3 Bases, por ejemplo gCT antes del codón CAT GCT 5’ ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ La secuencia de ADN cambia y se traduce así: ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M A H D S E L A F W L I -- 5’ 3’ Se produce la misma proteína, pero con un aa adicional, la alanina M en C Rafael Govea Villaseñor
  23. 23. Efecto de las Inserciones de BN Así las inserciones producen una proteína con un aminoácido de más u otras proteínas completamente distintas y acortadas que no llevan a cabo la función normal T 5’ ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M H D S E L A F W L I-C 5’ ATgTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M S stop-------------------------g 5’ ATgCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M L M T A S stop--------------ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M A H D S E L A F W L I -- 5’ M en C Rafael Govea Villaseñor 3’
  24. 24. Mutaciones Génicas, Deleción de 1 BN Si tenemos el siguiente trozo de ADN que se traduce así: ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M A H D S E L A F W L I -- 5’ Y luego deletamos sólo 1 Base, por ejemplo g del codón gCT: g 5’ ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ 3’ La secuencia de ADN cambia y se traduce diferente: ATgCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M L M T A S stop--------------- 5’ 3’ Se produce otra proteína acortada por la señal de stop: M en C Rafael Govea Villaseñor
  25. 25. Mutaciones Génicas, Deleción de 2 BN Si tenemos el mismo trozo de ADN que se traduce así: ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M A H D S E L A F W L I -- 5’ Y luego deletamos 2 Bases, por ejemplo gC del codón gCT: gC 5’ ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ 3’ La secuencia de ADN cambia y se traduce diferente: ATgTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M S stop-------------------------- 5’ 3’ De hecho, No Se produce proteína por la señal de stop formada: M en C Rafael Govea Villaseñor
  26. 26. Mutaciones Génicas, Deleción de 3 BN Si tenemos el mismo trozo de ADN que se traduce así: ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg M A H D S E L A F W L I -- 5’ Y luego deletamos 3 Bases, por ejemplo gCT gCT 5’ ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg La secuencia de ADN cambia y se traduce: ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg M H D S E L A F W L I-- 5’ 3’ Se produce la misma proteína, pero con un aa menos, la alanina M en C Rafael Govea Villaseñor 3’ 3’
  27. 27. Efecto de las Deleciones de BN Así las deleciones producen una proteína con un aminoácido de menos u otras proteínas completamente distintas y acortadas que no llevan a cabo la función normal ATgCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M H D S E L A F W L I-T 5’ ATgTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M S stop-------------------------C 5’ ATgCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M L M T A S stop--------------g 5’ ATggCTCATgACAgCgAgCTAgCTTTCTggTTgATTAg 3’ M A H D S E L A F W L I -5’ M en C Rafael Govea Villaseñor
  28. 28. Duplicaciones por Recombinación Ilegítima La topoisomerasa I Corta en dos CCCAT Exones II duplicados
  29. 29. ¿Qué son las Mutaciones Cromosómicas? Son cambios que afectan la estructura de los cromosomas o su número. M en C Rafael Govea Villaseñor
  30. 30. Mutaciones (Aberraciones) Cromosómicas Aberraciones Numéricas: Aumenta o disminuye la dotación de un cromosoma dado Aberraciones Estructurales: Cambian porciones del cromosoma M en C Rafael Govea Villaseñor
  31. 31. Aberraciones Cromosómicas Numéricas Aneuploidías Monosomías: X0 (Turner) 1:104 Trisomías: T21 1:800, T18 1:8000, XXY(Klinefelter) 1:103 M en C Rafael Govea Villaseñor
  32. 32. Aberraciones Cromosómicas Estructurales Deleciones 46,XX, del(5p) S. de cri du chat Inserciones Inversiones inv(3)p25q21) T. Balanceadas Translocaciones T. No-balanceadas M en C Rafael Govea Villaseñor T. Recíproca T. Robersoniana
  33. 33. ¿Qué son las deleciones? En estas mutaciones el cromosoma pierde porciones de si mismo M en C Rafael Govea Villaseñor
  34. 34. ¿Qué son las inserciones? Son mutaciones que integran secuencias de ADN extrañas a los cromosomas M en C Rafael Govea Villaseñor
  35. 35. ¿Qué son las inversiones? Son mutaciones que implican la rotura del cromosoma en dos puntos y el giro de 180 grados del trozo intermedio que se une, así, invertido. M en C Rafael Govea Villaseñor
  36. 36. ¿Qué son las translocaciones? Son mutaciones en las que porciones de un cromosoma roto se unen a otro cromosoma M en C Rafael Govea Villaseñor
  37. 37. ¿Qué son las Mutaciones Genómicas? Son cambios que afectan la estructura del juego completo de cromosomas M en C Rafael Govea Villaseñor El manzano proviene de un ancestro que duplicó su genoma y luego perdió 2 cromosomas
  38. 38. Tipos de Mutágenos Luz UV-B: 320-280 nm, UV-C: 280-200 nm Físicos R-X Rayos α, β y γ Químicos Biológicos M en C Rafael Govea Villaseñor M. Directos: Benzopirenos, Nitrosoureas, … M. indirectos: Nitrosaminas, Aflatoxinas, HPA,… Virus: Retrovirus, Adenovirus Transposones: Alu, LINE-1, … Secuencias de inserción
  39. 39. Penetración de la Luz UV en la Piel Melanoma un tipo de cáncer maligno de la piel
  40. 40. El agua también es un potente Mutágeno M en C Rafael Govea Villaseñor
  41. 41. Duplicaciones por Retrotransposición Exones barajeados Señal de terminación Señal de inicio
  42. 42. Mutación como Fuerza Evolutiva La mutación es una fuerza evolutiva débil. Si sólo ella actúa, el cambio en la información a lo largo de las generaciones es pequeño.
  43. 43. Pero la Mutación es una espléndida fuente de variación que puede ser seleccionada 5x106 5x108 5x106 5x108 5x106 3000 generaciones 5x108 E. Coli en medio mínimo Elena, et al (1996) M en C Rafael Govea Villaseñor mutaciones

×