INTRODUCCIÓN
GENERAL
ESPECÍFICA

DESARROLLO
MECANISMO
IMPRINTING
APLICACIÓN

CONCLUSIÓNES
CONSIDERACIONES ÉTICAS
CONCLUSIÓ...
¿¿ Qué es la CLONACIÓN ??
Proceso por el que se consiguen copias
idénticas de un organismo, célula o
molécula ya desarroll...
¿ Como surgió la CLONACIÓN?
INTERÉS : proporcionar animales
transgénicos idénticos que
secreten productos farmacéuticos
en...
Quién fue Dolly??
-1997Wilmut
Los clones pueden
presentar:

1º mamífero creado a
partir de una célula
adulta
Producida por...
La CLONACIÓN promete…
 Conservar y reproducir especies en peligro de
extinción.
 Curar enfermedades genéticas en animale...
CLONACIÓN
NATURAL

ARTIFICIAL
Molecular
Celular
Reproductiva
TERAPÉUTICA
La clonación terapéutica es la transferencia de
material nuclear aislado de una célula somática a
un ovocito enucleado for...
¿ Cuál es la diferencia con la clonación reproductiva?

Fuente: Fischbach and Fischbach
Gran potencial para crear varios tipos de tejidos
Evitaría el uso de fármacos inmunosupresores con fuertes
efectos secunda...
Comparando con el trasplante de órganos…
- Ningún peligro de rechazo de trasplante
- No haría falta que alguien muera para...
Baja disponibilidad de oocitos con fines de investigación
«Síndrome de hiperestimulación ovárica»
Grandes variaciones en l...
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con ...
PARA RECORDAR………

¿Que son las células madres?
Una célula madre es una célula que tiene la
capacidad de autorrenovarse med...
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con ...
SEGUIMOS RECORDANDO…

¿ Cuáles son las propiedades de las células madres?
Células indiferenciadas
Se han identificado en v...
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con ...
¿ Qué es la transferencia nuclear?
PASOS:
Enucleación del oocito
- Micro-manipulación
- Métodos químicos

Transferencia de...
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con ...
¿ Cuál es su relación con la clonación terapéutica?

«Las células obtenidas mediante esta técnica
son genéticamente idénti...
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con ...
MECANISMO DE LA CLONACIÓN TERAPÉUTICA…
1- TRANSFERENCIA NUCLEAR
2- DIVISIÓN DEL CIGOTO

Fuente: Fischbach and Fischbach
3- FORMACIÓN DE LÍNEAS CELULARES

Fuente: Fischbach and Fischbach
4- INCORPORACIÓN DE LAS CÉLULAS AL PACIENTE ENFERMO

Fuente: Kirschstein and Skirboll, 2001
5- ¿CÓMO LLEGAN LAS CÉLULAS A SU DESTINO Y CÓMO SE
ACTIVAN EN DICHO TEJIDO?

Fuente:Blau, Brazelton and Weimann, 2001
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con ...
ALTERNATIVAS PARA EVITAR LA CLONACIÓN TERAPÉUTICA…

Fuente: Colman and Kind
IN VIVO……

Fuente: Kirschstein and Skirboll, 2001
• Ambos alelos se expresan simultáneamente
• Expresión monoalélica
IMPRINTING: DETERMINACIÓN DEL SEXO
EXPERIMENTOS DE TRANSPLANTE DE NÚCLEO

que para un normal desarrollo se requiere la
contribución tanto del genoma materno
...
Ratón partenogenético o
Ratón partenogenético o
ginogenético
ginogenético

Ratón androgenético
Ratón androgenético

LOS GE...
Pero…
Fenómeno epigenético en el cual algunos genes
son expresados a partir de un solo alelo (que
depende del progenitor)

se pr...
MARCA EPIGENÉTICA

Metilaciones
Modificaciones de histona
IMPORTANTES PARA EL DESARROLLO
NORMAL DEL ORGANISMO
El hecho de que sólo uno de los dos alelos se pueda expresar expone aa...
SÍNDROME DE BECKWITH-WIEDEMANN
SÍNDROME DE BECKWITH-WIEDEMANN

SÍNDROME DE SILVER-RUSSELL
SÍNDROME DE SILVER-RUSSELL
SÍNDROME DE PRADER-WILLI
SÍNDROME DE PRADER-WILLI

SÍNDROME DE ANGELMAN
SÍNDROME DE ANGELMAN
¿Cuáles son sus funciones?
¿Dónde se encuentran?
¿Cómo se encuentran?
Genes de ambos padres que se expresan
Regiones de control de impresión

Bartolomei 2009, GENES & DEVELOPMENT 23:2124–2133
GENES METILADOS

ATTGCTTCGCGCGGCCGTCGCTCGATCGCGCGCGATGCTAGCTGATTCGTAGCTAGCTACGTATGCTCTCTAGCCGATC

¡¡GEN NO SE TRANSCRIBE!!
GENES NO METILADOS

ATTGCTTCGCGCGGCCGTCGCTCGATCGCGCGCGATGCTAGCTGATTCGTAGCTAGCTACGTATGCTCTCTAGCCGATC

¡¡¡GEN SE TRANSCRIBE!...
DEJA SIN EFECTO EL SILENCIAMIENTO
DE GENES IMPRESOS O SILENCIA GENES
NO IMPRESOS
PERO…
La impresión genómica puede causar problemas
en la clonación
en los clones muchas veces en DNA no
está metilado en la posi...
APLICACIONES DE LA CLONACIÓN
TERAPÉUTICA
Medicina regenerativa
+
Ingeniería en tejidos

Restaurar forma y función de
órgan...
+ Factores de crecimiento e
inductores de diferenciación

CÉLULAS MADRES EMBRIONARIAS
CÉLULAS MADRES EMBRIONARIAS
Habilida...
C.J. Koh, A. Atala, 2004

Células clonadas, reconocidas
como propias

NO son rechazadas por
el sistema inmune
Reporte en modelos animales
Blastocitos de ratón clonado

Lanza et al

Mismas propiedades
morfológicas y marcadores
de exp...
Rideot et al

TEJIDO SANGUÍNEO
TEJIDO SANGUÍNEO
Trasferencia

Núcleos somáticos de ratones
inmunodeficientes

Oocitos anuc...
Otro estudio…

Clonado terapéutico
+
Ingeniería genética

CORAZÓN
CORAZÓN
Músculo cardíaco
clonado con IGUAL
material gené...
PÁNCREAS
PÁNCREAS

D'Amour et al , 2006

Diferenciación

Células madres embrionarias

Células endócrinas

Glucagón e insul...
PARKINSON
PARKINSON
Síntomas:
Pérdida progresiva del control motor
Temblores
Rigidez muscular
Debido a… degeneración de ne...
¿ Alternativa??
Neuronas derivadas de células embrionarias humanas!!

Astrocitos

Oligodentroglías

Neuronas maduras

Resp...
Barbieri, et al

Obtuvieron por SCNT de células de la cola de un ratón
células madres embrionarias.
Interneuronas GABA min...
CONCLUSIÓN
Estos estudios muestran que células derivadas del clonado
terapéutico :
Pueden ser exitosamente recolectadas;
E...
PERSONALISMO
Considera a la “persona” como la manifestación concreta de la
naturaleza humana, de procedencia divina y, por...
“el estudio sistemático de las dimensiones
morales —visión moral, decisiones, conducta
y políticas— de las ciencias de la ...
Reemplazo de la vida
Producción de un ser -> atenta contra la identidad e
irrepetibilidad propia de la persona
Implica ace...
Cuestionamiento de si es ético modificar a voluntad
otro ser
¿Se asumen las consecuencias?
NUNCA ES LÍCITO USAR PERSONAS C...
En fin…
LOS EMBRIONES MANIPULADOS SON PERSONAS
IGUAL QUE NOSOTROS Y OCUPARLOS CON UN
FIN ES UN ATENTADO CONTRA SU SER Y
DE...
Es preponderante lo que pueda traer beneficio a la
humanidad
Homo sapiens ser cuyas características tienen su
fuente en pr...
• En la fase de desarrollo embrionario que corresponde a
la implantación del cigoto.
• En el momento de la formación de la...
Atribuye a los padres el derecho sobre sus
hijos y, por lo tanto, sobre sus embriones.
Legitimiza la utilización de embrio...
En fin…
SUGIERE QUE SE REALICE CLONACIÓN DE SERES
HUMANOS SIEMPRE QUE TENGA UNA ADECUADA
REGLAMENTACIÓN
Para poder tomar una postura con respecto a temas así
es muy importante estar informado para que nuestra
postura esté bien...
Toda discusión y controversia debe tener como
meta el progreso, no una victoria personal.
J. Joubert
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Próxima SlideShare
Cargando en…5
×

Genetica y-clonacionolll

337 visualizaciones

Publicado el

Publicado en: Noticias y política
0 comentarios
0 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

Sin descargas
Visualizaciones
Visualizaciones totales
337
En SlideShare
0
De insertados
0
Número de insertados
71
Acciones
Compartido
0
Descargas
4
Comentarios
0
Recomendaciones
0
Insertados 0
No insertados

No hay notas en la diapositiva.

Genetica y-clonacionolll

  1. 1. INTRODUCCIÓN GENERAL ESPECÍFICA DESARROLLO MECANISMO IMPRINTING APLICACIÓN CONCLUSIÓNES CONSIDERACIONES ÉTICAS CONCLUSIÓN CURIOSIDADES
  2. 2. ¿¿ Qué es la CLONACIÓN ?? Proceso por el que se consiguen copias idénticas de un organismo, célula o molécula ya desarrollado de forma asexual.  Se parte de un animal "desarrollado” interés por obtener copias de un animal. Sólo cuando es adulto conocemos sus características.  Creación de forma asexual la reproducción sexual no nos permite obtener copias idénticas, genera diversidad.
  3. 3. ¿ Como surgió la CLONACIÓN? INTERÉS : proporcionar animales transgénicos idénticos que secreten productos farmacéuticos en su leche >> factores de coagulación sanguíneo; insulina. • Lactoferrina • Lisozima
  4. 4. Quién fue Dolly?? -1997Wilmut Los clones pueden presentar: 1º mamífero creado a partir de una célula adulta Producida por transferencia nuclear Mayor riesgo de enfermedades genéticas o cáncer debido a la acumulación de mutaciones en el núcleo adulto. Envejecimiento prematuro por presencia de telómeros más cortos. Desarrollo anormal.
  5. 5. La CLONACIÓN promete…  Conservar y reproducir especies en peligro de extinción.  Curar enfermedades genéticas en animales de granja.  Proporcionar modelos animales de enfermedades humanas para los que todavía no hay modelos de investigación.
  6. 6. CLONACIÓN NATURAL ARTIFICIAL Molecular Celular Reproductiva TERAPÉUTICA
  7. 7. La clonación terapéutica es la transferencia de material nuclear aislado de una célula somática a un ovocito enucleado formando de este modo un embrión que no está destinado a la transferencia en el útero sino para obtener células con el mismo genoma que el donante nuclear.
  8. 8. ¿ Cuál es la diferencia con la clonación reproductiva? Fuente: Fischbach and Fischbach
  9. 9. Gran potencial para crear varios tipos de tejidos Evitaría el uso de fármacos inmunosupresores con fuertes efectos secundarios Podría salvar un número incontable de vidas, y aumentar la calidad de vida de muchos otros
  10. 10. Comparando con el trasplante de órganos… - Ningún peligro de rechazo de trasplante - No haría falta que alguien muera para salvar a otra persona - El paciente no recibiría un órgano viejo y con funcionalidad reducida - Podría salvar vidas que de otro modo no podrían salvarse El ADN extraído de la persona donante se puede manipular genéticamente introduciendole trans-genes con el fin de: - Extender la longevidad de las células trasplantadas - Ayudar a la interacción de las células trasplantadas con el tejido del huésped - Inducir la regeneración de los tejidos del huésped
  11. 11. Baja disponibilidad de oocitos con fines de investigación «Síndrome de hiperestimulación ovárica» Grandes variaciones en la capacidad de los diferentes tipos de tejidos adultos para apoyar con éxito la transferencia nuclear La edad del donante es una problema por la integridad de su genoma Posibilidad de mutación de células madres
  12. 12. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  13. 13. PARA RECORDAR……… ¿Que son las células madres? Una célula madre es una célula que tiene la capacidad de autorrenovarse mediante divisiones mitótica o bien de continuar la vía de diferenciación para la que está programada y, por lo tanto, producir células de uno o más tejidos maduros, funcionales y plenamente diferenciados. Fuente: Barreno, 2003
  14. 14. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  15. 15. SEGUIMOS RECORDANDO… ¿ Cuáles son las propiedades de las células madres? Células indiferenciadas Se han identificado en varios tejidos adultos Capaces de proliferar y autorregularse Capacidad para regenerar tejidos
  16. 16. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  17. 17. ¿ Qué es la transferencia nuclear? PASOS: Enucleación del oocito - Micro-manipulación - Métodos químicos Transferencia del núcleo - Electofusión - Micro-inyección Activación del oocito - Estímulo químico Fuente: Colman and Kind Pero…. ¿Cuál es su relación con la clonación terapéutica?
  18. 18. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  19. 19. ¿ Cuál es su relación con la clonación terapéutica? «Las células obtenidas mediante esta técnica son genéticamente idénticas al núcleo donante, se podría utilizar para el trasplante celular en el donante sin temor a que se produjera un rechazo por causas inmunitarias» Fuente: Colman and Kind
  20. 20. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  21. 21. MECANISMO DE LA CLONACIÓN TERAPÉUTICA… 1- TRANSFERENCIA NUCLEAR 2- DIVISIÓN DEL CIGOTO Fuente: Fischbach and Fischbach
  22. 22. 3- FORMACIÓN DE LÍNEAS CELULARES Fuente: Fischbach and Fischbach
  23. 23. 4- INCORPORACIÓN DE LAS CÉLULAS AL PACIENTE ENFERMO Fuente: Kirschstein and Skirboll, 2001
  24. 24. 5- ¿CÓMO LLEGAN LAS CÉLULAS A SU DESTINO Y CÓMO SE ACTIVAN EN DICHO TEJIDO? Fuente:Blau, Brazelton and Weimann, 2001
  25. 25. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  26. 26. ALTERNATIVAS PARA EVITAR LA CLONACIÓN TERAPÉUTICA… Fuente: Colman and Kind
  27. 27. IN VIVO…… Fuente: Kirschstein and Skirboll, 2001
  28. 28. • Ambos alelos se expresan simultáneamente • Expresión monoalélica
  29. 29. IMPRINTING: DETERMINACIÓN DEL SEXO
  30. 30. EXPERIMENTOS DE TRANSPLANTE DE NÚCLEO que para un normal desarrollo se requiere la contribución tanto del genoma materno como del paterno
  31. 31. Ratón partenogenético o Ratón partenogenético o ginogenético ginogenético Ratón androgenético Ratón androgenético LOS GENES EXPRESADOS PROVENIENTES DE CADA PROGENITOR NO SON LOS MISMOS
  32. 32. Pero…
  33. 33. Fenómeno epigenético en el cual algunos genes son expresados a partir de un solo alelo (que depende del progenitor) se produce una marca que distingue a los alelos paternos y tiene como resultado la expresión de un patrón monoalelíco parental específico
  34. 34. MARCA EPIGENÉTICA Metilaciones Modificaciones de histona
  35. 35. IMPORTANTES PARA EL DESARROLLO NORMAL DEL ORGANISMO El hecho de que sólo uno de los dos alelos se pueda expresar expone aaun El hecho de que sólo uno de los dos alelos se pueda expresar expone un gran riesgo genómico debido aaque una mutación (genética o epigenética) gran riesgo genómico debido que una mutación (genética o epigenética)
  36. 36. SÍNDROME DE BECKWITH-WIEDEMANN SÍNDROME DE BECKWITH-WIEDEMANN SÍNDROME DE SILVER-RUSSELL SÍNDROME DE SILVER-RUSSELL
  37. 37. SÍNDROME DE PRADER-WILLI SÍNDROME DE PRADER-WILLI SÍNDROME DE ANGELMAN SÍNDROME DE ANGELMAN
  38. 38. ¿Cuáles son sus funciones? ¿Dónde se encuentran? ¿Cómo se encuentran?
  39. 39. Genes de ambos padres que se expresan Regiones de control de impresión Bartolomei 2009, GENES & DEVELOPMENT 23:2124–2133
  40. 40. GENES METILADOS ATTGCTTCGCGCGGCCGTCGCTCGATCGCGCGCGATGCTAGCTGATTCGTAGCTAGCTACGTATGCTCTCTAGCCGATC ¡¡GEN NO SE TRANSCRIBE!!
  41. 41. GENES NO METILADOS ATTGCTTCGCGCGGCCGTCGCTCGATCGCGCGCGATGCTAGCTGATTCGTAGCTAGCTACGTATGCTCTCTAGCCGATC ¡¡¡GEN SE TRANSCRIBE!!!
  42. 42. DEJA SIN EFECTO EL SILENCIAMIENTO DE GENES IMPRESOS O SILENCIA GENES NO IMPRESOS
  43. 43. PERO…
  44. 44. La impresión genómica puede causar problemas en la clonación en los clones muchas veces en DNA no está metilado en la posición correcta ESTO SE DEBE AL TIEMPO ESTO SE DEBE AL TIEMPO DE REPROGRAMACIÓN DE REPROGRAMACIÓN
  45. 45. APLICACIONES DE LA CLONACIÓN TERAPÉUTICA Medicina regenerativa + Ingeniería en tejidos Restaurar forma y función de órganos y tejidos dañados TRASPLANTE DE ÓRGANOS CLONACIÓN TERAPÉUTICA CÉLULAS EMBRIONARIAS Escases de donantes
  46. 46. + Factores de crecimiento e inductores de diferenciación CÉLULAS MADRES EMBRIONARIAS CÉLULAS MADRES EMBRIONARIAS Habilidad de proliferar en un estado pluripotente de desdiferenciación.
  47. 47. C.J. Koh, A. Atala, 2004 Células clonadas, reconocidas como propias NO son rechazadas por el sistema inmune
  48. 48. Reporte en modelos animales Blastocitos de ratón clonado Lanza et al Mismas propiedades morfológicas y marcadores de expresión que blastocito normal.
  49. 49. Rideot et al TEJIDO SANGUÍNEO TEJIDO SANGUÍNEO Trasferencia Núcleos somáticos de ratones inmunodeficientes Oocitos anucelados Blastocitos clonados, celulas madres Reconstitición de tejido hematopoyético Trasplante Diferenciación Progenitores hematopoyéticos
  50. 50. Otro estudio… Clonado terapéutico + Ingeniería genética CORAZÓN CORAZÓN Músculo cardíaco clonado con IGUAL material genético que la vaca donante. Blastocito implantado para su crecimiento in vivo. Células recolectadas y expandidas in vitro. 6 semanas después del trasplante, recuperadas. Buena organización celular y vascularización.
  51. 51. PÁNCREAS PÁNCREAS D'Amour et al , 2006 Diferenciación Células madres embrionarias Células endócrinas Glucagón e insulina Tratamiento de Diabetes Mellitus Trasplante Células embrionarias clonadas del paciente se diferenciarían en células de la organogénesis del páncreas
  52. 52. PARKINSON PARKINSON Síntomas: Pérdida progresiva del control motor Temblores Rigidez muscular Debido a… degeneración de neuronas dopaminérgidas. ¡SOLUCIÓN! Concentración local de dopamina No detiene la progresión de la enfermedad, efectos secundarios.
  53. 53. ¿ Alternativa?? Neuronas derivadas de células embrionarias humanas!! Astrocitos Oligodentroglías Neuronas maduras Respondieron a neurotransmisores, contuvieron canales dependientes de voltaje, respondieron a acciones despolarizantes. Progenitores neurales, incorporados en el parénquima cerebral del ratón. Se siguió en VIVO : diferenciación en los tres tipos fundamentales de neuronas.
  54. 54. Barbieri, et al Obtuvieron por SCNT de células de la cola de un ratón células madres embrionarias. Interneuronas GABA minérgidas Neuronas serotoninérgidas Neuronas dopaminérgidas Inyectadas en el cuerpo cortical estriado de ratones con Parkinson. 80% de las neuronas vivieron 8 sem. post- transplante
  55. 55. CONCLUSIÓN Estos estudios muestran que células derivadas del clonado terapéutico : Pueden ser exitosamente recolectadas; Expandidas en cultivo; Trasplantadas in vivo; Organizarse en tejidos genética e inmuno- compatibles.
  56. 56. PERSONALISMO Considera a la “persona” como la manifestación concreta de la naturaleza humana, de procedencia divina y, por consecuencia, receptáculo de valores trascendentes. HUMANISMO SECULAR Se fundamenta conocimiento de lo humano desde una perspectiva científica, en donde el hombre es quien genera los valores y es el responsable de su destino.
  57. 57. “el estudio sistemático de las dimensiones morales —visión moral, decisiones, conducta y políticas— de las ciencias de la vida y la atención a la salud, empleando diversas metodologías éticas, con una orientación interdisciplinaria”
  58. 58. Reemplazo de la vida Producción de un ser -> atenta contra la identidad e irrepetibilidad propia de la persona Implica aceptar el dominio de unos sobre otros Se violan ciertos derechos humanos Limitación de la reproducción a su dimensión biológica Uso arbitrario del cuerpo humano como máquina
  59. 59. Cuestionamiento de si es ético modificar a voluntad otro ser ¿Se asumen las consecuencias? NUNCA ES LÍCITO USAR PERSONAS COMO UN MEDIO… SON UN FÍN EN SI MISMA Somos personas desde el momento de la fecundación
  60. 60. En fin… LOS EMBRIONES MANIPULADOS SON PERSONAS IGUAL QUE NOSOTROS Y OCUPARLOS CON UN FIN ES UN ATENTADO CONTRA SU SER Y DERECHOS
  61. 61. Es preponderante lo que pueda traer beneficio a la humanidad Homo sapiens ser cuyas características tienen su fuente en procesos biológicos y no en un alma inmaterial El hombre no es persona desde la fecundación, sino que se “hace persona” en un momento posterior que puede ser…
  62. 62. • En la fase de desarrollo embrionario que corresponde a la implantación del cigoto. • En el momento de la formación de la línea embrionaria cuando el conjunto de células pierden la totipotencialidad. • En cuanto inicia la formación del sistema nervioso central, condición de posibilidad para la percepción del bienestar y el sufrimiento. • En cuanto inicia la formación de la corteza cerebral. • En el momento de la adquisición de la autoconciencia o en el momento de la manifestación de la capacidad de intelección y de autodeterminación.
  63. 63. Atribuye a los padres el derecho sobre sus hijos y, por lo tanto, sobre sus embriones. Legitimiza la utilización de embriones bajo dos conceptos: Atribución de titularidad de derecho sólo a aquellos que tienen capacidad sensorial y sensibilidad al dolor Mayor bien para el mayor número
  64. 64. En fin… SUGIERE QUE SE REALICE CLONACIÓN DE SERES HUMANOS SIEMPRE QUE TENGA UNA ADECUADA REGLAMENTACIÓN
  65. 65. Para poder tomar una postura con respecto a temas así es muy importante estar informado para que nuestra postura esté bien fundamentada.
  66. 66. Toda discusión y controversia debe tener como meta el progreso, no una victoria personal. J. Joubert

×