SlideShare una empresa de Scribd logo
1 de 74
GENÉTICA MOLECULAR
ADN: Replicación-
Transcripción y
Traducción
PSU CIENCIAS 1ére S
Prof. Daniela Quezada M.
Composición de los ácidos
nucleicos
Son biopolímeros formados por unidades llamadas monómeros, que son los
nucleótidos.
Los nucleótidos están formados por la unión de:
a) Una pentosa, que puede ser la D-ribosa en el ARN; o la D-2- desoxirribosa
en el ADN
b) Una base nitrogenada, que puede ser:
- Púrica, como la Guanina (G) y la Adenina (A)
- Pirimidica, como la Timina (T), Citosina (C) y Uracilo (U)
C) Ácido fosfórico, que en la cadena de ácido nucleico une dos
pentosas a través de una unión fosfodiester. Esta unión se hace
entre el C-3´de la pentosa, con el C-5´de la segunda.
A la unión de una pentosa con una base nitrogenada se le llama
nucleósido. Esta unión se hace mediante un enlace -glucosídico.
- Si la pentosa es una ribosa, tenemos un ribonucleósido. Estos
tienen como bases nitrogenadas la adenina, guanina, citosina y
uracilo.
Si la pentosa es un
desoxirribosa, tenemos un
desoxirribonucleósido.
Estos tienen como bases
nitrogenadas la adenina,
citosina, guanina y timina.
El enlace -glucosídico
se hace entre el
a) C-1´de la pentosa y
el N-9 de la base
púrica, como la
guanina y la adenina.
b) C-1´de la pentosa y
el N-1 de la base
pìrimidínica, como la
timina y citosina.
En la estructura
secundaria, las bases
nitrogenadas se unen
mediante puentes de
hidrogeno. La A se
empareja siempre con
la T mediante dos
puentes de hidrógeno,
mientras que la C se
empareja siempre con
la G por medio de 3
puentes de hidrógeno.
Los ácidos nucleicos están formados, como ya se ha dicho
anteriormente, por la polimerización de muchos nucleótidos, los
cuales se unen de la siguiente manera: 3´-pentosa-5´-fosfato---3´-
pentosa-5´fosfato-----
Estructura primaria
El ADN está compuesto por
una secuencia de
nucleótidos formados por
desoxirribosa. Las bases
nitrogenadas que se hallan
formando los nucleótidos de
ADN son Adenina, Guanina,
Citosina y Timina. No
aparece Uracilo. Los
nucleótidos se unen entre sí
mediante el grupo fosfato
del segundo nucleótido, que
sirve de puente de unión
entre el carbono 5' del
primer nucleótido y el
carbono 3' de siguiente
nucleótido.
Como el primer nucleótido
tiene libre el carbono 5' y el
siguiente nucleótido tiene
libre el carbono 3', se dice
que la secuencia de
Cada molécula tiene una orientación definida, por lo que la
cadena es 5´-> 3´.
Atendiendo a su estructura y
composición existen dos tipos de
ácidos nucleicos que son:
a) Ácido desoxirribonucleico o
ADN o DNA
b) Ácido ribonucleico o ARN o
RNA
Ácido Desoxirribonucleico o ADN o DNAÁcido Desoxirribonucleico o ADN o DNA
A.- ESTRUCTURA.
Está formado por la unión de muchos desoxirribonucleótidos.
La mayoría de las moléculas de ADN poseen dos cadenas
antiparalelas ( una 5´-3´y la otra 3´-5´) unidas entre sí mediante
las bases nitrogenadas, por medio de puentes de hidrógeno.
La adenina enlaza con la timina, mediante dos puentes de
hidrógeno, mientras que la citosina enlaza con la guanina,
mediante tres puentes de hidrógeno.
El ADN es el portador de la información genética, se puede
decir por tanto, que los genes están compuestos por ADN.
ESTRUCTURA PRIMARIA DEL
ADN
Se trata de la secuencia de
desoxirribonucleótidos de una
de las cadenas. La información
genética está contenida en el
orden exacto de los nucleótidos.
ESTRUCTURA SECUNDARIA DEL
ADN
Es una estructura en doble hélice.
Permite explicar el almacenamiento
de la información genética y el
mecanismo de duplicación del ADN.
Fue postulada por Watson y Crick,
basándose en:
-La difracción de rayos X que habían
realizado Franklin y Wilkins.
- La equivalencia de bases de
Chargaff, dice que la suma de
adeninas más guaninas es igual a la
suma de timinas más citosinas.
Es una cadena doble,
dextrógira o levógira,
según el tipo de ADN.
Ambas cadenas son
complementarias, pues la
adenina de una se une a la
timina de la otra, y la
guanina de una a la
citosina de la otra. Ambas
cadenas son antiparalelas,
pues el extremo 3´de una
se enfrenta al extremo 5
´de la otra.
Existen tres modelos de
ADN. El ADN de tipo B
es el más abundante y es
el descubierto por Watson
y Crick.
ESTRUCTURA TERCIARIA DEL
ADN.
Se refiere a como se almacena
el ADN en un volumen reducido.
Varía según se trate de
organismos procariontes o
eucariontes:
a) En procariontes se pliega
como una super-hélice en
forma, generalmente, circular y
asociada a una pequeña
cantidad de proteínas. Lo
mismo ocurre en la
mitocondrias y en los plastos.
b) En eucariontes el
empaquetamiento ha de
ser más complejo y
compacto y para esto
necesita la presencia de
proteínas, como son las
histonas y otras de
naturaleza no histona (en
los espermatozoides las
proteínas son las
protaminas). A esta
unión de ADN y
proteínas se conoce
como cromatina, en la
cual se distinguen
diferentes niveles de
organización:
ARN o ácidos ribonucleico o RNAARN o ácidos ribonucleico o RNA
A.- ESTRUCTURA
Está formado por la unión de
muchos ribonucleótidos, los cuales
se unen entre ellos mediante enlaces
fosfodiester en sentido 5´-3´( igual
que en el ADN ).
Están formados por una sola cadena,
a excepción del ARN bicatenario de
los reovirus.
ESTRUCTURA PRIMARIA DEL ARN
Al igual que el ADN, se refiere a la
secuencia de las bases nitrogenadas
que constituyen sus nucleótidos.
ESTRUCTURA SECUNDARIA DEL
ARN
Alguna vez, en una misma cadena,
existen regiones con secuencias
complementarias capaces de aparearse.
ESTRUCTURA TERCIARIA DE ARN
Es un plegamiento, complicado, sobre al
estructura secundaria.
B.- CLASIFICACIÓN DE LOS ARN.
Para clasificarlos se adopta la masa molecular
media de sus cadenas, cuyo valor se deduce
de la velocidad de sedimentación. La masa
molecular y por tanto sus dimensiones se
miden en svedberg (S). Según esto tenemos:
ARN MENSAJERO (ARNm)
Sus características son la siguientes:
- Cadenas de largo tamaño con estructura
primaria.
- Se le llama mensajero porque transporta la
información necesaria para la síntesis
proteica.
- Cada ARNm tiene información para sintetizar
una proteina determinada.
- Su vida media es corta.
a) En procariontes el extremo 5´posee un
grupo trifosfato
b) En eucariontes en el extremo 5´posee un
grupo metil-guanosina unido al trifosfato, y el
el extremo 3´posee una cola de poli-A
En los eucariontes se puede distinguir también:
- Exones, secuencias de bases que codifican proteínas
- Intrones, secuencias sin información.
Un ARNm  de este tipo ha de madurar (eliminación de
intrones) antes de hacerse funcional. Antes de madurar, el
ARNm  recibe el nombre de ARN heterogeneonuclear
(ARNhn ).
ARN RIBOSÓMICO (ARNr)
Sus principales características son:
- Cada ARNr  presenta cadena de diferente tamaño, con
estructura secundaria y terciaria.
- Forma parte de las subunidades ribosómicas cuando se
une con muchas proteínas.
- Están vinculados con la síntesis de proteínas.
 
ARN TRANSFERENTE (ARNt)
Sus principales características son.
- Son moléculas de pequeño tamaño
- Poseen en algunas zonas estructura secundaria, lo que va
hacer que en las zonas donde no hay bases
complementarias adquieran un aspecto de bucles, como una
hoja de trébol.
- Los plegamientos se llegan a hacer tan complejos que
adquieren una estructura terciaria
- Su misión es unir aminoácidos y transportarlos hasta el
5.- Funciones de los ácidos nucleicos
Entre las principales funciones de estos ácidos tenemos:
-Duplicación del ADN
-Expresión del mensaje genético:
-Transcripción del ADN para formar ARNm y otros
- Traducción, en los ribosomas, del mensaje contenido en
el  ARNm a proteínas.
Dogma central de la expresión génica
Francis Crick estableció el llamado “dogma central” de la genética
molecular: la información genética contenida en el ADN fluye
hacia el ARN, el que a su vez específica proteínas
•La iniciación de la replicación del ADN comienza siempre con una
secuencia específica de nucleótidos conocida como el origen de
replicación. Requiere proteínas iniciadoras especiales y además
enzimas conocidas como helicasas, que rompen los puentes de
hidrógeno abriendo la hélice, formándose las horquillas de
replicación, una a cada lado de la burbuja a que da lugar la
separación de las ramas del ADN. Una vez abierta la cadena de ADN,
proteínas adicionales (conocidas como proteínas de unión a cadena
simple o topoisomerasas) se unen a las cadenas individuales del
ADN manteniéndolas separadas y evitando que se retuerzan. En el
siguiente paso, las enzimas llamadas ADN polimerasa catalizan la
síntesis real de las nuevas cadenas, añadiendo nucleótidos sobre el
molde, las que se dan bidireccionalmente desde cada una de las
horquillas que se replican en sentido opuesto dentro de cada
burbuja, cuando éstas se encuentran y se fusionan todo el
cromosoma ha quedado replicado longitudinalmente.
• Para que el ADN polimerasa comience su tarea
debe estar presente un cebador que determina el
punto por donde el ADN polimerasa comienza a
añadir nucleótidos, continuando por la cadena de
ADN de molde en la dirección 5´ a 3´.
• Debido a esta unidireccionalidad del ADN
polimerasa, la replicación es continua en una de
las ramas (cadena adelantada), mientras que en
su antiparalela (cadena retrasada) es discontinua,
fragmentada (siempre 5´ a 3´); en ésta, cuando un
ADN polimerasa hace contacto con el extremo de
otro fragmento Okazaki el cebador de éste es
eliminado y otra enzima, el ADN ligasa, conecta
los segmentos de ADN recién sintetizado,
catalizando las reacciones de condensación que
unen los grupos fosfato y azúcar de los
nucleótidos contiguos.
• durante la síntesis a veces se comenten errores
y a la nueva cadena en formación se le agregan
nucleótidos incorrectos, cuando esto ocurre el
ADN polimerasa retrocede (en dirección 3´a 5´),
eliminando nucleótidos hasta que encuentra un
nucleótido correctamente apareado; en ese
punto se detiene en su retroceso y reinicia su
movimiento 5´a 3´.
• La importancia de que la duplicación de ADN
quede perfectamente bien hecha, es mucha, ya
que si no, se pueden presentar mutaciones
genéticas.
Desarrolla las siguientes
actividades
CUESTIONARIO
1º.- El ARNt : estructura, localización y función en
la biosíntesis de proteínas.
2º.- Nucleótidos: concepto, composición química y
moléculas más frecuentes.
3º.-Estructura y funciones del ADN.
4º.-Localización y función del ARNm en la célula
eucarionte.
5º.-¿ Cuántas clases de ARN conoces y en que
procesos intervienen?
6º Relaciona el concepto correcto con la
estructura correspondiente:
1. Cromatina 2. Collar de perlas
3. Nucleosoma 4. Solenoide
5. Cromosoma
Organización de los nucleosomas _______________
Quinto nivel de compactación__________________
Compactación de nucleosomas_________________
Primer nivel de compactación__________________
ADN e histonas_____________________________
7ª En la Figura se
observa un esquema
de la estructura
química de la
molécula
representada en
detalle en la Figura
Indica qué es lo que
se observa en la
figura y cómo se
llaman las partes
numeradas.  
1.
2.
3.
4.
5.
6.
7.
8ª ¿Cómo se llama en general lo que se
observa en la Figura si representa parte de la
estructura terciaria de un ácido nucleico?
1.
2.
3.
9.- Enumera las diferencias que existen entre el
ADN y el ARN, en cuanto a composición
química, estructura molecular, tamaño y
localización en una célula eucariota.
10.- ¿Cuáles son las fuerzas estabilizadoras de la
doble hélice?
11.- ¿Qué entiende por estructura primaria y
secundaria del ADN?
12.- Los ácidos nucleicos:
ADN y ARN son
polinucleótidos que
tienen elevados y
variados pesos
moleculares.
En el esquema indica:
a. Indique con un círculo un
nucleótido
b. Identifique extremos 3´ y
5´ de la cadena.
c. Señale un enlace
fosfodiéster.
d. Se trata de una molécula
de ADN y ARN? Indique
que le permitió
reconocerla
Replicación del ADN
1. ¿Qué quiere decir que la replicación es
semiconservativa? Haz una breve explicación, ayúdate
para ello de dibujos.
2. En la figura se observa un cromosoma. a) Indica
si es de un procariota o de un eucariota; razona
la respuesta. b) ¿Qué procesos se están dando
en a y en b?
3. Dibuja en la figura la hebra de ADN que se
replicará de manera continua e indica la polaridad de
sus extremos. Haz un breve comentario explicativo.
Proceso de Síntesis de Proteínas
El ADN tiene la información para
hacer las proteínas de la célula.
Ya que muchas de estas
proteínas funcionan como
enzimas en las reacciones
químicas que tienen lugar en la
célula, todos los procesos
celulares dependen, en última
instancia, de la información
codificada en el ADN.
En el proceso de síntesis de
proteínas, existe una molécula, el
ARN, que actúa de intermediaria.
Por lo tanto, en el proceso de
expresión de la información
contenida en los genes hay dos
etapas:
ADN ARN
PROTEÍNAS
““Dogma central de la Biología Molecular"Dogma central de la Biología Molecular"
T A C G A A C C G T T G C A C A T C
A U G C U U G G C A A C G U G
Transcripción:
1- Iniciación: Una ARN polimerasa comienza la síntesis del precursor del‑
ARN a partir de unas señales de iniciación "secuencias de consenso " que
se encuentran en el ADN.
ARNpolimerasa
T A C G A A C C G T T G C A C A T C
A U G C U U G G C A A C G U G
Transcripción:
2. Alargamiento: La síntesis de la cadena continúa en dirección
5'→3'. Después de 30 nucleótidos se le añade al ARN una cabeza
(caperuza o líder) de metil GTP en el extremo 5‘ con función‑
protectora.
m-GTP
ARNpolimerasa
A U G C U C G U G
Transcripción:
3- Finalización: Una vez que la enzima (ARN polimerasa) llega a la
región terminadora del gen finaliza la síntesis del ARN. Entonces, una
poliA polimerasa añade una serie de nucleótidos con adenina, la‑ cola
poliA, y el ARN, llamado ahora ARNm precursor, se libera.
m-GTP
poliA-polimerasa
U A G A A A A A
ARNm precursor
ARNm
precursor
AAAAAA
AUG UAG
cola
4. Maduración (cont.): El ARNm precursor contiene tanto exones como
intrones. Se trata, por lo tanto, de un ARNm no apto para que la
información que contiene sea traducida y se sintetice la correspondiente
molécula proteica. En el proceso de maduración un sistema enzimático
reconoce, corta y retira los intrones y las ARN ligasas unen los exones,‑
formándose el ARNm maduro.
ARNm
maduro
Cabeza
Región codificadora del gen
Promotor E1 I1 E2 I2 E3 Terminador
ADN
ARNm
precursor
ARNm
maduro
AAAAAA
AAAAAA
AUG UAG
AUG UAG
ATCTAC
Cabeza
Cabeza E1 I1 E2 I2 E3 cola
cola
Maduración del ARNm (Visión de conjunto).
Met
1er aminoácido
ARNt
Anticodón
Codón
ARNm
Subunidad menor del ribosoma
AAAAAAAAAAA
P A
A U G C A A
U A C
Traducción
Iniciación: La subunidad pequeña del ribosoma se une a la región líder del ARNm y el
ARNm se desplaza hasta llegar al codón AUG, que codifica el principio de la proteína.
Se les une entonces el complejo formado por el ARNt-metionina (Met). La unión se
produce entre el codón del ARNm y el anticodón del ARNt que transporta la metionina
(Met).
5’ 3’
U G C U U A C G A U A G
(i)
Met
Subunidad menor del ribosoma
AAAAAAAAAAA
P A
A U G C A A
U A C
Elongación I: A continuación se une la subunidad mayor a la menor
completándose el ribosoma. El complejo ARNt-aminoácido2 , la glutamima
(Gln) [ARNt-Gln] se sitúa enfrente del codón correspondiente (CAA). La
región del ribosoma a la que se une el complejo ARNt-Gln se le llama región
aminoacil (A).
5’
3’
Gln
G U U
U G C U U A C G A U A G
(i)
ARNm
AAAAAAAAAAA
P A
A U G C A A
U A C
Elongación II: Se forma el enlace peptídico entre el grupo carboxilo de la
metionina (Met) y el grupo amino del segundo aminoácido, la glutamina
(Gln).
5’
Gln-M
et
G U U
U G C U U A C G A U A G
3’
AAAAAAAAAAA
P A
A U G C A A
Elongación III: El ARNt del primer aminoácido, la metionina (Met) se
libera.
5’
U A C
Gln-M
et
G U U
U G C U U A C G A U A G
ARNm
3’
AAAAAAAAAAA
P A
A U G C A A
Elongación IV: El ARNm se traslada, de tal manera que el complejo ARNt-
Gln-Met queda en la región peptidil del ribosoma, quedando ahora la región
aminoacil (A) libre para la entrada del complejo ARNt-aa3
5’ 3’
Gln-M
et
G U U
U G CU G C U U A C G A U A G
ARNm
AAAAAAAAAAA
P A
A U G C A A
Elongación V: Entrada en la posición correspondiente a la región
aminoacil (A) del complejo ARNt-Cys, correspondiente al tercer aminoácido,
la cisteína (Cys).
5’
Gln-M
et
G U U
U G CU G C U U A C G A U A G
ARNm
3’
A C G
Cys
AAAAAAAAAAA
P A
A U G C A A
Elongación VI: Unión del péptido Met-Gln (Metionina-Glutamina) a la
cisteína (Cys).
5’
G U U
U G CU G C U U A C G A U A G
ARNm
3’
A C G
Cys-Gln-M
et
AAAAAAAAAAA
P A
A U G C A A
Elongación VII: Se libera el ARNt correspondiente al segundo
aminoácido, la glutamina (Glu).
5’
U G CU G C U U A C G A U A G
ARNm
3’
G U U
A C G
Cys-Gln-Met(i)
AAAAAAAAAAA
P A
A U G C A A
Elongación VIII: El ARNm corre hacia la otra posición, quedando el
complejo ARNt3-Cys-Glu-Met en la región peptidil del ribosoma.
5’
U G CU G C U U A C G A U A G
ARNm
3’
A C G
Cys-Gln-M
et
AAAAAAAAAAA
P A
A U G C A A
Elongación IX: Entrada del complejo ARNt-Leu correspondiente al 4º
aminoácido, la leucina.
5’
U G CU G C U U A C G A U A G
ARNm
3’
A C G
Cys-Gln-M
et
A A U
Leu
AAAAAAAAAAA
P A
A U G C A A
Elongación X: Este se sitúa en la región aminoacil (A).
5’
U G CU G C U U A C G A U A G
ARNm
3’
A C G
Cys-Gln-Met
A A U
Leu
AAAAAAAAAAA
P A
A U G C A A
Elongación XI: Unión del péptido Met-Gln-Cys con el 4º aminoácido, la
leucina (Leu). Liberación del ARNt de la leucina. El ARNm se desplaza a la
5ª posición
5’
U G CU G C U U A C G A U A G
ARNm
3’
A C G
A A U
Leu-Cys-Gln-Met
AAAAAAAAAAA
P A
A U G C A A
Elongación XII: Entrada del ARNt de la leucina, el 5º aminoácido, la
arginina (ARNt-Arg).
5’
U G CU G C U U A C G A U A G
ARNm
3’
A A U
Leu-Cys-Gln-Met
G C U
Arg
AAAAAAAAAAA
P A
A U G C A A
Elongación XIII: Unión del péptido Met-Gln-Cys-Leu con el 5º aminoácido,
la arginina (Arg). Liberación del ARNt de la leucina (Leu). El ARNm se
desplaza a la 6ª posición, se trata del un codón de finalización o de stop.
5’
U G C U U A C G A U A G
ARNm
3’
A A U
Arg-Leu-Cys-Gln-Met
G C U
AAAAAAAAAAA
P A
A U G C A A
5’
U G C U U A C G A U A G
ARNm
3’
A A U
Arg-Leu-Cys-Gln-Met
G C U
Finalización I: Liberación del péptido o proteína. Las subunidades del
ribosoma se disocian y se separan del ARNm.
AAAAAAAAAAA
Finalización II: Después unos minutos los ARNm son digeridos por las
enzimas del hialoplasma.
5’
ARNm
3’
A U G C A A U G C U U A C G A U A G
(i)
CÓDIGO GENÉTICO
1- El código genético es
universal. Todos los seres
vivos lo emplean; con
ciertas excepciones, por
ejemplo, el de las
mitocondrias, que tiene
algunas diferencias.
2. Existen tres tripletas
que no codifican ningún
aminoácido, son las
tripletas "sin sentido", de
"paro" o "stop". Estas
tripletas marcan el final de
la región a traducir, esto
es, el final de la molécula
proteica.
3- La secuencia AUG
codifica el principio de la
región que se va a traducir
y al mismo tiempo sirve
para codificar al
aminoácido metionina.
GUÍA DE TRABAJO
RESPUESTA
5' AAUCGUCAUAUAAACUAAUGUGCCAUCGGGGUA 3'
1. Un fragmento de la cadena de ADN que codifica la
oxitocina tiene la siguiente secuencia de bases:
3‘ TTAGCAGTATATTTGATTACACGGTAGCCCCAT
5'.
Determina la secuencia de bases del trascrito
2. Escribir la secuencia de la molécula de ARNm
sintetizada a partir de una cadena de ADN molde que
presente la siguiente secuencia:
3' T-A-C-G-T-A-C-C-G-T-A-T-C-A-T-A-T-C 5' 
 
RESPUESTA
5' AUG CAU GGC AUA GUA UAG 3'
RESPUESTA
1) ADN; 2) ARN polimerasa;
3) ARNm precursor; 4)
ARNm trascrito; 5) ARNm
maduro; 6) Proteína
sintetizada; 7) Ribosoma.
El esquema de la figura 1 representa la trascripción,
procesamiento y síntesis de polipéptidos en un eucariota.
Identifica los distintos elementos de la figura representados
por números.
3. El siguiente segmento de RNAm (ARNm) codifica un
segmento intersticial de un polipéptido (los diferentes
codones aparecen subrayados):
 5' ......AAU CUA UUC UCU AUU AAA ACC .....3‘
a) Especifica la correspondiente secuencia de
aminoácidos que se origina en la traducción
(indicando las polaridades en ambos casos).
Trascripción y traducción de la
información genética.
1. El esquema de
la figura
representa dos
procesos
biológicos muy
importantes
¿Cómo se
denominan?
2. Identifica los
distintos
elementos
representados
por números
Marca la alternativa CORRECTA
1) ¿Cuál es la principal función de los genes?
a) Determinar la síntesis de lípidos;
b) determinar la síntesis de glúcidos;
c) determinar la síntesis de proteínas.
d) Ninguna de las respuestas anteriores es la correcta.
2) La parte de la región codificadora de un gen que no contiene información útil se llama....
a) región promotora;
b) región terminadora;
c) exón;
d) intrón.
3) Los procesos de síntesis de ARN a partir del ADN se denominan...
a) replicación del ADN;
b) trascripción de la información genética;
c) traducción de la información genéticas.
d) Ninguna de las respuestas anteriores es correcta.
4) El proceso de síntesis de una proteína a partir de la información contenida en un ARNm se
denomina...
a) replicación del ADN;
b) trascripción de la información genética;
c) traducción de la información genéticas.
d) Ninguna de las respuestas anteriores es correcta.
5) La ARNpolimerasa sinteriza el ARNm en dirección...
a) 5'→ 3';
b) 3'→ 5';
c) del aminoácido amino terminal al aminoácido carboxilo terminal del ARNm.
d) depende de cómo esté situada la región codificadora.
 
6) La cabeza de metil-GTP (m-GTP) que se observa en la Figura.
a) marca el inicio del gen;
b) tiene función protectora contra las exonucleasas;
c) marca el principio de la región codificadora;
d) es un desoxirribonucleótido pirimidínico.
7) Los codones está constituidos por...
a) 3 bases o nucleótidos;
b) 2 bases;
c) 1 base.
d) Ninguna de las respuestas anteriores es correcta
8) Todas las proteínas comienzan por...
a) Glicocola;
b) metionina;
c) una base nitrogenada.
d) Ninguna de las respuestas anteriores es correcta.

Más contenido relacionado

La actualidad más candente

Ac. nuc y nucleotidos
Ac. nuc y nucleotidosAc. nuc y nucleotidos
Ac. nuc y nucleotidos
jujosansan
 
Ejercicio nomenclatura de sales
Ejercicio nomenclatura de salesEjercicio nomenclatura de sales
Ejercicio nomenclatura de sales
EmilioGS
 
Transcripsion en eucariotas[1]
Transcripsion en eucariotas[1]Transcripsion en eucariotas[1]
Transcripsion en eucariotas[1]
jessyaneth
 
Codones inicion y terminacion
Codones inicion y terminacionCodones inicion y terminacion
Codones inicion y terminacion
Luzy147
 
Codigo Genetico
Codigo GeneticoCodigo Genetico
Codigo Genetico
jent46
 
Transcripcion y traduccion
Transcripcion y traduccionTranscripcion y traduccion
Transcripcion y traduccion
jugafoce
 

La actualidad más candente (20)

Ac. nuc y nucleotidos
Ac. nuc y nucleotidosAc. nuc y nucleotidos
Ac. nuc y nucleotidos
 
TABLA PERIODICA Y CONFIGURACIÓN ELECTRONICA
TABLA PERIODICA Y CONFIGURACIÓN ELECTRONICATABLA PERIODICA Y CONFIGURACIÓN ELECTRONICA
TABLA PERIODICA Y CONFIGURACIÓN ELECTRONICA
 
Transcripcion del ADN
Transcripcion del ADNTranscripcion del ADN
Transcripcion del ADN
 
ADN y ARN
ADN y ARNADN y ARN
ADN y ARN
 
Presentación de Ácidos nucleicos
Presentación de Ácidos nucleicosPresentación de Ácidos nucleicos
Presentación de Ácidos nucleicos
 
Traduccion de procariotas y eucariotas
Traduccion de procariotas y eucariotasTraduccion de procariotas y eucariotas
Traduccion de procariotas y eucariotas
 
Gases nobles
Gases noblesGases nobles
Gases nobles
 
Ejercicio nomenclatura de sales
Ejercicio nomenclatura de salesEjercicio nomenclatura de sales
Ejercicio nomenclatura de sales
 
Transcripsion en eucariotas[1]
Transcripsion en eucariotas[1]Transcripsion en eucariotas[1]
Transcripsion en eucariotas[1]
 
Codones inicion y terminacion
Codones inicion y terminacionCodones inicion y terminacion
Codones inicion y terminacion
 
Diferencias transcripcion eucariotas procariotas
Diferencias transcripcion eucariotas procariotasDiferencias transcripcion eucariotas procariotas
Diferencias transcripcion eucariotas procariotas
 
Guias ciclo celular
Guias ciclo celularGuias ciclo celular
Guias ciclo celular
 
Arn
ArnArn
Arn
 
Enlace covalente
Enlace covalenteEnlace covalente
Enlace covalente
 
masa atomica
masa atomicamasa atomica
masa atomica
 
Codigo Genetico
Codigo GeneticoCodigo Genetico
Codigo Genetico
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
Meiosis y gametogénesis
Meiosis y gametogénesisMeiosis y gametogénesis
Meiosis y gametogénesis
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
Transcripcion y traduccion
Transcripcion y traduccionTranscripcion y traduccion
Transcripcion y traduccion
 

Destacado

Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
mnmunaiz
 
Estructura del ARN
Estructura del ARNEstructura del ARN
Estructura del ARN
Arely RouÜs
 
Estructura y replicacion de dna
Estructura y replicacion de dnaEstructura y replicacion de dna
Estructura y replicacion de dna
kamashtemus
 
Diapositivas del ADN
Diapositivas del ADNDiapositivas del ADN
Diapositivas del ADN
Arely RouÜs
 
Transcripción y traducción del adn
Transcripción y traducción del adnTranscripción y traducción del adn
Transcripción y traducción del adn
inesjimenez96
 
Estructura y funcion del adn
Estructura y funcion del adnEstructura y funcion del adn
Estructura y funcion del adn
kRyss
 
Replicación, transcripción y traducción del adn
Replicación, transcripción y traducción del adnReplicación, transcripción y traducción del adn
Replicación, transcripción y traducción del adn
nattonatto
 
Àcids nucleics models
Àcids nucleics modelsÀcids nucleics models
Àcids nucleics models
batbatbi
 

Destacado (20)

Genetica Molecular
Genetica MolecularGenetica Molecular
Genetica Molecular
 
Tipos de ARN
Tipos de ARNTipos de ARN
Tipos de ARN
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
 
Estructura del ARN
Estructura del ARNEstructura del ARN
Estructura del ARN
 
ARN, estructura, funciones, transcripción.
ARN, estructura, funciones, transcripción.ARN, estructura, funciones, transcripción.
ARN, estructura, funciones, transcripción.
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
 
Tipos de ARN
Tipos de ARNTipos de ARN
Tipos de ARN
 
Tipos de ARN
Tipos de ARNTipos de ARN
Tipos de ARN
 
Estructura y replicacion de dna
Estructura y replicacion de dnaEstructura y replicacion de dna
Estructura y replicacion de dna
 
Diapositivas del ADN
Diapositivas del ADNDiapositivas del ADN
Diapositivas del ADN
 
Transcripción y traducción del adn
Transcripción y traducción del adnTranscripción y traducción del adn
Transcripción y traducción del adn
 
Estructura y funcion del adn
Estructura y funcion del adnEstructura y funcion del adn
Estructura y funcion del adn
 
Replicación, transcripción y traducción del adn
Replicación, transcripción y traducción del adnReplicación, transcripción y traducción del adn
Replicación, transcripción y traducción del adn
 
3S_Terapias genicas
3S_Terapias genicas3S_Terapias genicas
3S_Terapias genicas
 
Terapia genica parte 2
Terapia genica parte 2Terapia genica parte 2
Terapia genica parte 2
 
Àcids nucleics models
Àcids nucleics modelsÀcids nucleics models
Àcids nucleics models
 
Tipos de ARN
Tipos  de ARN Tipos  de ARN
Tipos de ARN
 
La terapia génica
La terapia génicaLa terapia génica
La terapia génica
 
2 genetica molecular
2 genetica molecular2 genetica molecular
2 genetica molecular
 
6 ontogenia introduccion_1
6 ontogenia introduccion_16 ontogenia introduccion_1
6 ontogenia introduccion_1
 

Similar a Genética Molecular

Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
guest666ea5
 
áCidos nucleicos upn
áCidos nucleicos upnáCidos nucleicos upn
áCidos nucleicos upn
guest90086be
 
Clase 5 Acidos Nucleicos
Clase 5 Acidos NucleicosClase 5 Acidos Nucleicos
Clase 5 Acidos Nucleicos
guest2235e4
 
Clase 5 Acidos Nucleicos
Clase 5 Acidos NucleicosClase 5 Acidos Nucleicos
Clase 5 Acidos Nucleicos
Loby
 
Acidos nucleicos2013
Acidos nucleicos2013Acidos nucleicos2013
Acidos nucleicos2013
Julio Sanchez
 
Adn, replica, transcr, traducc
Adn, replica, transcr, traduccAdn, replica, transcr, traducc
Adn, replica, transcr, traducc
raquelcervantes
 

Similar a Genética Molecular (20)

Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
 
Adn y arn (1)
Adn y arn (1)Adn y arn (1)
Adn y arn (1)
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
Los ácidos nucleicos
Los ácidos nucleicosLos ácidos nucleicos
Los ácidos nucleicos
 
Los ácidos nucleicos
Los ácidos nucleicosLos ácidos nucleicos
Los ácidos nucleicos
 
ADN Y ARN
ADN Y ARNADN Y ARN
ADN Y ARN
 
áCidos nucleicos upn
áCidos nucleicos upnáCidos nucleicos upn
áCidos nucleicos upn
 
Clase 5 Acidos Nucleicos
Clase 5 Acidos NucleicosClase 5 Acidos Nucleicos
Clase 5 Acidos Nucleicos
 
Clase 5 Acidos Nucleicos
Clase 5 Acidos NucleicosClase 5 Acidos Nucleicos
Clase 5 Acidos Nucleicos
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
5. los ácidos nucleicos
5. los ácidos nucleicos5. los ácidos nucleicos
5. los ácidos nucleicos
 
Tema 2 la información genética
Tema 2 la información genéticaTema 2 la información genética
Tema 2 la información genética
 
Tema 2 la información genética
Tema 2 la información genéticaTema 2 la información genética
Tema 2 la información genética
 
DIAPOSITIVAS ADN Y GENES.pptx
DIAPOSITIVAS ADN Y GENES.pptxDIAPOSITIVAS ADN Y GENES.pptx
DIAPOSITIVAS ADN Y GENES.pptx
 
Acidos nucleicos2013
Acidos nucleicos2013Acidos nucleicos2013
Acidos nucleicos2013
 
Adn, replica, transcr, traducc
Adn, replica, transcr, traduccAdn, replica, transcr, traducc
Adn, replica, transcr, traducc
 
6. Acidos Nucleicos 2009
6. Acidos Nucleicos 20096. Acidos Nucleicos 2009
6. Acidos Nucleicos 2009
 
Acidos nucleicos (1)
Acidos nucleicos (1)Acidos nucleicos (1)
Acidos nucleicos (1)
 
Guia biologia molecular iv
Guia biologia molecular ivGuia biologia molecular iv
Guia biologia molecular iv
 
Los ácidos nucleicos
Los ácidos nucleicosLos ácidos nucleicos
Los ácidos nucleicos
 

Más de Daniela Quezada

Miniensayo psu biología biomoléculas y transporte a través de la membrana
Miniensayo psu biología biomoléculas y transporte a través de la membranaMiniensayo psu biología biomoléculas y transporte a través de la membrana
Miniensayo psu biología biomoléculas y transporte a través de la membrana
Daniela Quezada
 

Más de Daniela Quezada (20)

Termorregulación
TermorregulaciónTermorregulación
Termorregulación
 
Sistema Inmune
Sistema InmuneSistema Inmune
Sistema Inmune
 
Sistema Renal y Osmorregulación
Sistema Renal y OsmorregulaciónSistema Renal y Osmorregulación
Sistema Renal y Osmorregulación
 
Riesgo de caídas adulto mayor hospitalizado
Riesgo de caídas adulto mayor hospitalizadoRiesgo de caídas adulto mayor hospitalizado
Riesgo de caídas adulto mayor hospitalizado
 
Sexualidad y Reproducción Humana
Sexualidad y Reproducción HumanaSexualidad y Reproducción Humana
Sexualidad y Reproducción Humana
 
Regulación ciclo celular
Regulación ciclo celularRegulación ciclo celular
Regulación ciclo celular
 
Receptores y señalización
Receptores y señalizaciónReceptores y señalización
Receptores y señalización
 
Propiedades periódicas
Propiedades periódicasPropiedades periódicas
Propiedades periódicas
 
Presentación programa contenidos electivo biología 3°medio
Presentación programa contenidos electivo biología 3°medioPresentación programa contenidos electivo biología 3°medio
Presentación programa contenidos electivo biología 3°medio
 
Caso Clínico Flutter Auricular, ITU, Hipotiroidismo
Caso Clínico Flutter Auricular, ITU, HipotiroidismoCaso Clínico Flutter Auricular, ITU, Hipotiroidismo
Caso Clínico Flutter Auricular, ITU, Hipotiroidismo
 
Mutaciones genéticas 2° medio
Mutaciones genéticas 2° medioMutaciones genéticas 2° medio
Mutaciones genéticas 2° medio
 
Miniensayo psu biología biomoléculas y transporte a través de la membrana
Miniensayo psu biología biomoléculas y transporte a través de la membranaMiniensayo psu biología biomoléculas y transporte a través de la membrana
Miniensayo psu biología biomoléculas y transporte a través de la membrana
 
Metodos anticonceptivos y Enfermedades de Transmisión Sexual en Chile.
Metodos anticonceptivos y Enfermedades de Transmisión Sexual en Chile.Metodos anticonceptivos y Enfermedades de Transmisión Sexual en Chile.
Metodos anticonceptivos y Enfermedades de Transmisión Sexual en Chile.
 
Meiosis
MeiosisMeiosis
Meiosis
 
Mecanismos de adhesión celular
Mecanismos de adhesión celularMecanismos de adhesión celular
Mecanismos de adhesión celular
 
ITU Pielonefritis
ITU Pielonefritis ITU Pielonefritis
ITU Pielonefritis
 
Hormonas
HormonasHormonas
Hormonas
 
Homeostasis y estres
Homeostasis y estresHomeostasis y estres
Homeostasis y estres
 
Genetica mendeliana + postmendel
Genetica mendeliana + postmendelGenetica mendeliana + postmendel
Genetica mendeliana + postmendel
 
Fecundación y desarrollo embrionario
Fecundación y desarrollo embrionarioFecundación y desarrollo embrionario
Fecundación y desarrollo embrionario
 

Último

Estrategia Nacional de Refuerzo Escolar SJA Ccesa007.pdf
Estrategia Nacional de Refuerzo Escolar  SJA  Ccesa007.pdfEstrategia Nacional de Refuerzo Escolar  SJA  Ccesa007.pdf
Estrategia Nacional de Refuerzo Escolar SJA Ccesa007.pdf
Demetrio Ccesa Rayme
 
Diseño Universal de Aprendizaje en Nuevos Escenarios JS2 Ccesa007.pdf
Diseño Universal de Aprendizaje en Nuevos Escenarios  JS2  Ccesa007.pdfDiseño Universal de Aprendizaje en Nuevos Escenarios  JS2  Ccesa007.pdf
Diseño Universal de Aprendizaje en Nuevos Escenarios JS2 Ccesa007.pdf
Demetrio Ccesa Rayme
 

Último (20)

ciclos biogeoquimicas y flujo de materia ecosistemas
ciclos biogeoquimicas y flujo de materia ecosistemasciclos biogeoquimicas y flujo de materia ecosistemas
ciclos biogeoquimicas y flujo de materia ecosistemas
 
AEC2. Egipto Antiguo. Adivina, Adivinanza.pptx
AEC2. Egipto Antiguo. Adivina, Adivinanza.pptxAEC2. Egipto Antiguo. Adivina, Adivinanza.pptx
AEC2. Egipto Antiguo. Adivina, Adivinanza.pptx
 
TEMA EGIPTO.pdf. Presentación civilización
TEMA EGIPTO.pdf. Presentación civilizaciónTEMA EGIPTO.pdf. Presentación civilización
TEMA EGIPTO.pdf. Presentación civilización
 
Síndrome piramidal 2024 según alvarez, farrera y wuani
Síndrome piramidal 2024 según alvarez, farrera y wuaniSíndrome piramidal 2024 según alvarez, farrera y wuani
Síndrome piramidal 2024 según alvarez, farrera y wuani
 
AEC 2. Aventura en el Antiguo Egipto.pptx
AEC 2. Aventura en el Antiguo Egipto.pptxAEC 2. Aventura en el Antiguo Egipto.pptx
AEC 2. Aventura en el Antiguo Egipto.pptx
 
animalesdelaproincia de beunos aires.pdf
animalesdelaproincia de beunos aires.pdfanimalesdelaproincia de beunos aires.pdf
animalesdelaproincia de beunos aires.pdf
 
REGLAMENTO FINAL DE EVALUACIÓN 2024 pdf.pdf
REGLAMENTO  FINAL DE EVALUACIÓN 2024 pdf.pdfREGLAMENTO  FINAL DE EVALUACIÓN 2024 pdf.pdf
REGLAMENTO FINAL DE EVALUACIÓN 2024 pdf.pdf
 
Diapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanente
Diapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanenteDiapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanente
Diapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanente
 
Estrategia Nacional de Refuerzo Escolar SJA Ccesa007.pdf
Estrategia Nacional de Refuerzo Escolar  SJA  Ccesa007.pdfEstrategia Nacional de Refuerzo Escolar  SJA  Ccesa007.pdf
Estrategia Nacional de Refuerzo Escolar SJA Ccesa007.pdf
 
TAREA_1_GRUPO7_ADMINISTRACIÓN_DE_EMPRESA.pptx
TAREA_1_GRUPO7_ADMINISTRACIÓN_DE_EMPRESA.pptxTAREA_1_GRUPO7_ADMINISTRACIÓN_DE_EMPRESA.pptx
TAREA_1_GRUPO7_ADMINISTRACIÓN_DE_EMPRESA.pptx
 
Power Point E. S.: Los dos testigos.pptx
Power Point E. S.: Los dos testigos.pptxPower Point E. S.: Los dos testigos.pptx
Power Point E. S.: Los dos testigos.pptx
 
Diseño Universal de Aprendizaje en Nuevos Escenarios JS2 Ccesa007.pdf
Diseño Universal de Aprendizaje en Nuevos Escenarios  JS2  Ccesa007.pdfDiseño Universal de Aprendizaje en Nuevos Escenarios  JS2  Ccesa007.pdf
Diseño Universal de Aprendizaje en Nuevos Escenarios JS2 Ccesa007.pdf
 
Novena de Pentecostés con textos de san Juan Eudes
Novena de Pentecostés con textos de san Juan EudesNovena de Pentecostés con textos de san Juan Eudes
Novena de Pentecostés con textos de san Juan Eudes
 
Sesión de clase Motivados por la esperanza.pdf
Sesión de clase Motivados por la esperanza.pdfSesión de clase Motivados por la esperanza.pdf
Sesión de clase Motivados por la esperanza.pdf
 
Santa Criz de Eslava, la más monumental de las ciudades romanas de Navarra
Santa Criz de Eslava, la más monumental de las ciudades romanas de NavarraSanta Criz de Eslava, la más monumental de las ciudades romanas de Navarra
Santa Criz de Eslava, la más monumental de las ciudades romanas de Navarra
 
TÉCNICAS OBSERVACIONALES Y TEXTUALES.pdf
TÉCNICAS OBSERVACIONALES Y TEXTUALES.pdfTÉCNICAS OBSERVACIONALES Y TEXTUALES.pdf
TÉCNICAS OBSERVACIONALES Y TEXTUALES.pdf
 
Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...
Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...
Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...
 
Evaluación de los Factores Externos de la Organización.
Evaluación de los Factores Externos de la Organización.Evaluación de los Factores Externos de la Organización.
Evaluación de los Factores Externos de la Organización.
 
Presentación de la propuesta de clase.pdf
Presentación de la propuesta de clase.pdfPresentación de la propuesta de clase.pdf
Presentación de la propuesta de clase.pdf
 
Sesión de clase APC: Los dos testigos.pdf
Sesión de clase APC: Los dos testigos.pdfSesión de clase APC: Los dos testigos.pdf
Sesión de clase APC: Los dos testigos.pdf
 

Genética Molecular

  • 1. GENÉTICA MOLECULAR ADN: Replicación- Transcripción y Traducción PSU CIENCIAS 1ére S Prof. Daniela Quezada M.
  • 2. Composición de los ácidos nucleicos Son biopolímeros formados por unidades llamadas monómeros, que son los nucleótidos. Los nucleótidos están formados por la unión de: a) Una pentosa, que puede ser la D-ribosa en el ARN; o la D-2- desoxirribosa en el ADN b) Una base nitrogenada, que puede ser: - Púrica, como la Guanina (G) y la Adenina (A) - Pirimidica, como la Timina (T), Citosina (C) y Uracilo (U)
  • 3. C) Ácido fosfórico, que en la cadena de ácido nucleico une dos pentosas a través de una unión fosfodiester. Esta unión se hace entre el C-3´de la pentosa, con el C-5´de la segunda. A la unión de una pentosa con una base nitrogenada se le llama nucleósido. Esta unión se hace mediante un enlace -glucosídico. - Si la pentosa es una ribosa, tenemos un ribonucleósido. Estos tienen como bases nitrogenadas la adenina, guanina, citosina y uracilo. Si la pentosa es un desoxirribosa, tenemos un desoxirribonucleósido. Estos tienen como bases nitrogenadas la adenina, citosina, guanina y timina.
  • 4. El enlace -glucosídico se hace entre el a) C-1´de la pentosa y el N-9 de la base púrica, como la guanina y la adenina. b) C-1´de la pentosa y el N-1 de la base pìrimidínica, como la timina y citosina. En la estructura secundaria, las bases nitrogenadas se unen mediante puentes de hidrogeno. La A se empareja siempre con la T mediante dos puentes de hidrógeno, mientras que la C se empareja siempre con la G por medio de 3 puentes de hidrógeno.
  • 5. Los ácidos nucleicos están formados, como ya se ha dicho anteriormente, por la polimerización de muchos nucleótidos, los cuales se unen de la siguiente manera: 3´-pentosa-5´-fosfato---3´- pentosa-5´fosfato-----
  • 6. Estructura primaria El ADN está compuesto por una secuencia de nucleótidos formados por desoxirribosa. Las bases nitrogenadas que se hallan formando los nucleótidos de ADN son Adenina, Guanina, Citosina y Timina. No aparece Uracilo. Los nucleótidos se unen entre sí mediante el grupo fosfato del segundo nucleótido, que sirve de puente de unión entre el carbono 5' del primer nucleótido y el carbono 3' de siguiente nucleótido. Como el primer nucleótido tiene libre el carbono 5' y el siguiente nucleótido tiene libre el carbono 3', se dice que la secuencia de
  • 7. Cada molécula tiene una orientación definida, por lo que la cadena es 5´-> 3´. Atendiendo a su estructura y composición existen dos tipos de ácidos nucleicos que son: a) Ácido desoxirribonucleico o ADN o DNA b) Ácido ribonucleico o ARN o RNA
  • 8. Ácido Desoxirribonucleico o ADN o DNAÁcido Desoxirribonucleico o ADN o DNA A.- ESTRUCTURA. Está formado por la unión de muchos desoxirribonucleótidos. La mayoría de las moléculas de ADN poseen dos cadenas antiparalelas ( una 5´-3´y la otra 3´-5´) unidas entre sí mediante las bases nitrogenadas, por medio de puentes de hidrógeno. La adenina enlaza con la timina, mediante dos puentes de hidrógeno, mientras que la citosina enlaza con la guanina, mediante tres puentes de hidrógeno. El ADN es el portador de la información genética, se puede decir por tanto, que los genes están compuestos por ADN.
  • 9. ESTRUCTURA PRIMARIA DEL ADN Se trata de la secuencia de desoxirribonucleótidos de una de las cadenas. La información genética está contenida en el orden exacto de los nucleótidos.
  • 10. ESTRUCTURA SECUNDARIA DEL ADN Es una estructura en doble hélice. Permite explicar el almacenamiento de la información genética y el mecanismo de duplicación del ADN. Fue postulada por Watson y Crick, basándose en: -La difracción de rayos X que habían realizado Franklin y Wilkins. - La equivalencia de bases de Chargaff, dice que la suma de adeninas más guaninas es igual a la suma de timinas más citosinas.
  • 11. Es una cadena doble, dextrógira o levógira, según el tipo de ADN. Ambas cadenas son complementarias, pues la adenina de una se une a la timina de la otra, y la guanina de una a la citosina de la otra. Ambas cadenas son antiparalelas, pues el extremo 3´de una se enfrenta al extremo 5 ´de la otra. Existen tres modelos de ADN. El ADN de tipo B es el más abundante y es el descubierto por Watson y Crick.
  • 12. ESTRUCTURA TERCIARIA DEL ADN. Se refiere a como se almacena el ADN en un volumen reducido. Varía según se trate de organismos procariontes o eucariontes: a) En procariontes se pliega como una super-hélice en forma, generalmente, circular y asociada a una pequeña cantidad de proteínas. Lo mismo ocurre en la mitocondrias y en los plastos.
  • 13. b) En eucariontes el empaquetamiento ha de ser más complejo y compacto y para esto necesita la presencia de proteínas, como son las histonas y otras de naturaleza no histona (en los espermatozoides las proteínas son las protaminas). A esta unión de ADN y proteínas se conoce como cromatina, en la cual se distinguen diferentes niveles de organización:
  • 14.
  • 15. ARN o ácidos ribonucleico o RNAARN o ácidos ribonucleico o RNA A.- ESTRUCTURA Está formado por la unión de muchos ribonucleótidos, los cuales se unen entre ellos mediante enlaces fosfodiester en sentido 5´-3´( igual que en el ADN ). Están formados por una sola cadena, a excepción del ARN bicatenario de los reovirus. ESTRUCTURA PRIMARIA DEL ARN Al igual que el ADN, se refiere a la secuencia de las bases nitrogenadas que constituyen sus nucleótidos.
  • 16. ESTRUCTURA SECUNDARIA DEL ARN Alguna vez, en una misma cadena, existen regiones con secuencias complementarias capaces de aparearse. ESTRUCTURA TERCIARIA DE ARN Es un plegamiento, complicado, sobre al estructura secundaria.
  • 17. B.- CLASIFICACIÓN DE LOS ARN. Para clasificarlos se adopta la masa molecular media de sus cadenas, cuyo valor se deduce de la velocidad de sedimentación. La masa molecular y por tanto sus dimensiones se miden en svedberg (S). Según esto tenemos: ARN MENSAJERO (ARNm) Sus características son la siguientes: - Cadenas de largo tamaño con estructura primaria. - Se le llama mensajero porque transporta la información necesaria para la síntesis proteica. - Cada ARNm tiene información para sintetizar una proteina determinada. - Su vida media es corta. a) En procariontes el extremo 5´posee un grupo trifosfato b) En eucariontes en el extremo 5´posee un grupo metil-guanosina unido al trifosfato, y el el extremo 3´posee una cola de poli-A
  • 18. En los eucariontes se puede distinguir también: - Exones, secuencias de bases que codifican proteínas - Intrones, secuencias sin información. Un ARNm  de este tipo ha de madurar (eliminación de intrones) antes de hacerse funcional. Antes de madurar, el ARNm  recibe el nombre de ARN heterogeneonuclear (ARNhn ). ARN RIBOSÓMICO (ARNr) Sus principales características son: - Cada ARNr  presenta cadena de diferente tamaño, con estructura secundaria y terciaria. - Forma parte de las subunidades ribosómicas cuando se une con muchas proteínas. - Están vinculados con la síntesis de proteínas.   ARN TRANSFERENTE (ARNt) Sus principales características son. - Son moléculas de pequeño tamaño - Poseen en algunas zonas estructura secundaria, lo que va hacer que en las zonas donde no hay bases complementarias adquieran un aspecto de bucles, como una hoja de trébol. - Los plegamientos se llegan a hacer tan complejos que adquieren una estructura terciaria - Su misión es unir aminoácidos y transportarlos hasta el
  • 19. 5.- Funciones de los ácidos nucleicos Entre las principales funciones de estos ácidos tenemos: -Duplicación del ADN -Expresión del mensaje genético: -Transcripción del ADN para formar ARNm y otros - Traducción, en los ribosomas, del mensaje contenido en el  ARNm a proteínas.
  • 20. Dogma central de la expresión génica Francis Crick estableció el llamado “dogma central” de la genética molecular: la información genética contenida en el ADN fluye hacia el ARN, el que a su vez específica proteínas
  • 21.
  • 22.
  • 23.
  • 24.
  • 25.
  • 26.
  • 27.
  • 28.
  • 29.
  • 30. •La iniciación de la replicación del ADN comienza siempre con una secuencia específica de nucleótidos conocida como el origen de replicación. Requiere proteínas iniciadoras especiales y además enzimas conocidas como helicasas, que rompen los puentes de hidrógeno abriendo la hélice, formándose las horquillas de replicación, una a cada lado de la burbuja a que da lugar la separación de las ramas del ADN. Una vez abierta la cadena de ADN, proteínas adicionales (conocidas como proteínas de unión a cadena simple o topoisomerasas) se unen a las cadenas individuales del ADN manteniéndolas separadas y evitando que se retuerzan. En el siguiente paso, las enzimas llamadas ADN polimerasa catalizan la síntesis real de las nuevas cadenas, añadiendo nucleótidos sobre el molde, las que se dan bidireccionalmente desde cada una de las horquillas que se replican en sentido opuesto dentro de cada burbuja, cuando éstas se encuentran y se fusionan todo el cromosoma ha quedado replicado longitudinalmente.
  • 31.
  • 32. • Para que el ADN polimerasa comience su tarea debe estar presente un cebador que determina el punto por donde el ADN polimerasa comienza a añadir nucleótidos, continuando por la cadena de ADN de molde en la dirección 5´ a 3´. • Debido a esta unidireccionalidad del ADN polimerasa, la replicación es continua en una de las ramas (cadena adelantada), mientras que en su antiparalela (cadena retrasada) es discontinua, fragmentada (siempre 5´ a 3´); en ésta, cuando un ADN polimerasa hace contacto con el extremo de otro fragmento Okazaki el cebador de éste es eliminado y otra enzima, el ADN ligasa, conecta los segmentos de ADN recién sintetizado, catalizando las reacciones de condensación que unen los grupos fosfato y azúcar de los nucleótidos contiguos.
  • 33. • durante la síntesis a veces se comenten errores y a la nueva cadena en formación se le agregan nucleótidos incorrectos, cuando esto ocurre el ADN polimerasa retrocede (en dirección 3´a 5´), eliminando nucleótidos hasta que encuentra un nucleótido correctamente apareado; en ese punto se detiene en su retroceso y reinicia su movimiento 5´a 3´. • La importancia de que la duplicación de ADN quede perfectamente bien hecha, es mucha, ya que si no, se pueden presentar mutaciones genéticas.
  • 35. CUESTIONARIO 1º.- El ARNt : estructura, localización y función en la biosíntesis de proteínas. 2º.- Nucleótidos: concepto, composición química y moléculas más frecuentes. 3º.-Estructura y funciones del ADN. 4º.-Localización y función del ARNm en la célula eucarionte. 5º.-¿ Cuántas clases de ARN conoces y en que procesos intervienen?
  • 36. 6º Relaciona el concepto correcto con la estructura correspondiente: 1. Cromatina 2. Collar de perlas 3. Nucleosoma 4. Solenoide 5. Cromosoma Organización de los nucleosomas _______________ Quinto nivel de compactación__________________ Compactación de nucleosomas_________________ Primer nivel de compactación__________________ ADN e histonas_____________________________
  • 37. 7ª En la Figura se observa un esquema de la estructura química de la molécula representada en detalle en la Figura Indica qué es lo que se observa en la figura y cómo se llaman las partes numeradas.   1. 2. 3. 4. 5. 6. 7.
  • 38. 8ª ¿Cómo se llama en general lo que se observa en la Figura si representa parte de la estructura terciaria de un ácido nucleico? 1. 2. 3.
  • 39. 9.- Enumera las diferencias que existen entre el ADN y el ARN, en cuanto a composición química, estructura molecular, tamaño y localización en una célula eucariota. 10.- ¿Cuáles son las fuerzas estabilizadoras de la doble hélice? 11.- ¿Qué entiende por estructura primaria y secundaria del ADN?
  • 40. 12.- Los ácidos nucleicos: ADN y ARN son polinucleótidos que tienen elevados y variados pesos moleculares. En el esquema indica: a. Indique con un círculo un nucleótido b. Identifique extremos 3´ y 5´ de la cadena. c. Señale un enlace fosfodiéster. d. Se trata de una molécula de ADN y ARN? Indique que le permitió reconocerla
  • 41. Replicación del ADN 1. ¿Qué quiere decir que la replicación es semiconservativa? Haz una breve explicación, ayúdate para ello de dibujos.
  • 42. 2. En la figura se observa un cromosoma. a) Indica si es de un procariota o de un eucariota; razona la respuesta. b) ¿Qué procesos se están dando en a y en b?
  • 43. 3. Dibuja en la figura la hebra de ADN que se replicará de manera continua e indica la polaridad de sus extremos. Haz un breve comentario explicativo.
  • 44. Proceso de Síntesis de Proteínas
  • 45. El ADN tiene la información para hacer las proteínas de la célula. Ya que muchas de estas proteínas funcionan como enzimas en las reacciones químicas que tienen lugar en la célula, todos los procesos celulares dependen, en última instancia, de la información codificada en el ADN. En el proceso de síntesis de proteínas, existe una molécula, el ARN, que actúa de intermediaria. Por lo tanto, en el proceso de expresión de la información contenida en los genes hay dos etapas: ADN ARN PROTEÍNAS ““Dogma central de la Biología Molecular"Dogma central de la Biología Molecular"
  • 46. T A C G A A C C G T T G C A C A T C A U G C U U G G C A A C G U G Transcripción: 1- Iniciación: Una ARN polimerasa comienza la síntesis del precursor del‑ ARN a partir de unas señales de iniciación "secuencias de consenso " que se encuentran en el ADN. ARNpolimerasa
  • 47. T A C G A A C C G T T G C A C A T C A U G C U U G G C A A C G U G Transcripción: 2. Alargamiento: La síntesis de la cadena continúa en dirección 5'→3'. Después de 30 nucleótidos se le añade al ARN una cabeza (caperuza o líder) de metil GTP en el extremo 5‘ con función‑ protectora. m-GTP ARNpolimerasa
  • 48. A U G C U C G U G Transcripción: 3- Finalización: Una vez que la enzima (ARN polimerasa) llega a la región terminadora del gen finaliza la síntesis del ARN. Entonces, una poliA polimerasa añade una serie de nucleótidos con adenina, la‑ cola poliA, y el ARN, llamado ahora ARNm precursor, se libera. m-GTP poliA-polimerasa U A G A A A A A ARNm precursor
  • 49. ARNm precursor AAAAAA AUG UAG cola 4. Maduración (cont.): El ARNm precursor contiene tanto exones como intrones. Se trata, por lo tanto, de un ARNm no apto para que la información que contiene sea traducida y se sintetice la correspondiente molécula proteica. En el proceso de maduración un sistema enzimático reconoce, corta y retira los intrones y las ARN ligasas unen los exones,‑ formándose el ARNm maduro. ARNm maduro Cabeza
  • 50. Región codificadora del gen Promotor E1 I1 E2 I2 E3 Terminador ADN ARNm precursor ARNm maduro AAAAAA AAAAAA AUG UAG AUG UAG ATCTAC Cabeza Cabeza E1 I1 E2 I2 E3 cola cola Maduración del ARNm (Visión de conjunto).
  • 51. Met 1er aminoácido ARNt Anticodón Codón ARNm Subunidad menor del ribosoma AAAAAAAAAAA P A A U G C A A U A C Traducción Iniciación: La subunidad pequeña del ribosoma se une a la región líder del ARNm y el ARNm se desplaza hasta llegar al codón AUG, que codifica el principio de la proteína. Se les une entonces el complejo formado por el ARNt-metionina (Met). La unión se produce entre el codón del ARNm y el anticodón del ARNt que transporta la metionina (Met). 5’ 3’ U G C U U A C G A U A G (i)
  • 52. Met Subunidad menor del ribosoma AAAAAAAAAAA P A A U G C A A U A C Elongación I: A continuación se une la subunidad mayor a la menor completándose el ribosoma. El complejo ARNt-aminoácido2 , la glutamima (Gln) [ARNt-Gln] se sitúa enfrente del codón correspondiente (CAA). La región del ribosoma a la que se une el complejo ARNt-Gln se le llama región aminoacil (A). 5’ 3’ Gln G U U U G C U U A C G A U A G (i)
  • 53. ARNm AAAAAAAAAAA P A A U G C A A U A C Elongación II: Se forma el enlace peptídico entre el grupo carboxilo de la metionina (Met) y el grupo amino del segundo aminoácido, la glutamina (Gln). 5’ Gln-M et G U U U G C U U A C G A U A G 3’
  • 54. AAAAAAAAAAA P A A U G C A A Elongación III: El ARNt del primer aminoácido, la metionina (Met) se libera. 5’ U A C Gln-M et G U U U G C U U A C G A U A G ARNm 3’
  • 55. AAAAAAAAAAA P A A U G C A A Elongación IV: El ARNm se traslada, de tal manera que el complejo ARNt- Gln-Met queda en la región peptidil del ribosoma, quedando ahora la región aminoacil (A) libre para la entrada del complejo ARNt-aa3 5’ 3’ Gln-M et G U U U G CU G C U U A C G A U A G ARNm
  • 56. AAAAAAAAAAA P A A U G C A A Elongación V: Entrada en la posición correspondiente a la región aminoacil (A) del complejo ARNt-Cys, correspondiente al tercer aminoácido, la cisteína (Cys). 5’ Gln-M et G U U U G CU G C U U A C G A U A G ARNm 3’ A C G Cys
  • 57. AAAAAAAAAAA P A A U G C A A Elongación VI: Unión del péptido Met-Gln (Metionina-Glutamina) a la cisteína (Cys). 5’ G U U U G CU G C U U A C G A U A G ARNm 3’ A C G Cys-Gln-M et
  • 58. AAAAAAAAAAA P A A U G C A A Elongación VII: Se libera el ARNt correspondiente al segundo aminoácido, la glutamina (Glu). 5’ U G CU G C U U A C G A U A G ARNm 3’ G U U A C G Cys-Gln-Met(i)
  • 59. AAAAAAAAAAA P A A U G C A A Elongación VIII: El ARNm corre hacia la otra posición, quedando el complejo ARNt3-Cys-Glu-Met en la región peptidil del ribosoma. 5’ U G CU G C U U A C G A U A G ARNm 3’ A C G Cys-Gln-M et
  • 60. AAAAAAAAAAA P A A U G C A A Elongación IX: Entrada del complejo ARNt-Leu correspondiente al 4º aminoácido, la leucina. 5’ U G CU G C U U A C G A U A G ARNm 3’ A C G Cys-Gln-M et A A U Leu
  • 61. AAAAAAAAAAA P A A U G C A A Elongación X: Este se sitúa en la región aminoacil (A). 5’ U G CU G C U U A C G A U A G ARNm 3’ A C G Cys-Gln-Met A A U Leu
  • 62. AAAAAAAAAAA P A A U G C A A Elongación XI: Unión del péptido Met-Gln-Cys con el 4º aminoácido, la leucina (Leu). Liberación del ARNt de la leucina. El ARNm se desplaza a la 5ª posición 5’ U G CU G C U U A C G A U A G ARNm 3’ A C G A A U Leu-Cys-Gln-Met
  • 63. AAAAAAAAAAA P A A U G C A A Elongación XII: Entrada del ARNt de la leucina, el 5º aminoácido, la arginina (ARNt-Arg). 5’ U G CU G C U U A C G A U A G ARNm 3’ A A U Leu-Cys-Gln-Met G C U Arg
  • 64. AAAAAAAAAAA P A A U G C A A Elongación XIII: Unión del péptido Met-Gln-Cys-Leu con el 5º aminoácido, la arginina (Arg). Liberación del ARNt de la leucina (Leu). El ARNm se desplaza a la 6ª posición, se trata del un codón de finalización o de stop. 5’ U G C U U A C G A U A G ARNm 3’ A A U Arg-Leu-Cys-Gln-Met G C U
  • 65. AAAAAAAAAAA P A A U G C A A 5’ U G C U U A C G A U A G ARNm 3’ A A U Arg-Leu-Cys-Gln-Met G C U Finalización I: Liberación del péptido o proteína. Las subunidades del ribosoma se disocian y se separan del ARNm.
  • 66. AAAAAAAAAAA Finalización II: Después unos minutos los ARNm son digeridos por las enzimas del hialoplasma. 5’ ARNm 3’ A U G C A A U G C U U A C G A U A G (i)
  • 67. CÓDIGO GENÉTICO 1- El código genético es universal. Todos los seres vivos lo emplean; con ciertas excepciones, por ejemplo, el de las mitocondrias, que tiene algunas diferencias. 2. Existen tres tripletas que no codifican ningún aminoácido, son las tripletas "sin sentido", de "paro" o "stop". Estas tripletas marcan el final de la región a traducir, esto es, el final de la molécula proteica. 3- La secuencia AUG codifica el principio de la región que se va a traducir y al mismo tiempo sirve para codificar al aminoácido metionina.
  • 69. RESPUESTA 5' AAUCGUCAUAUAAACUAAUGUGCCAUCGGGGUA 3' 1. Un fragmento de la cadena de ADN que codifica la oxitocina tiene la siguiente secuencia de bases: 3‘ TTAGCAGTATATTTGATTACACGGTAGCCCCAT 5'. Determina la secuencia de bases del trascrito 2. Escribir la secuencia de la molécula de ARNm sintetizada a partir de una cadena de ADN molde que presente la siguiente secuencia: 3' T-A-C-G-T-A-C-C-G-T-A-T-C-A-T-A-T-C 5'    RESPUESTA 5' AUG CAU GGC AUA GUA UAG 3'
  • 70. RESPUESTA 1) ADN; 2) ARN polimerasa; 3) ARNm precursor; 4) ARNm trascrito; 5) ARNm maduro; 6) Proteína sintetizada; 7) Ribosoma. El esquema de la figura 1 representa la trascripción, procesamiento y síntesis de polipéptidos en un eucariota. Identifica los distintos elementos de la figura representados por números.
  • 71. 3. El siguiente segmento de RNAm (ARNm) codifica un segmento intersticial de un polipéptido (los diferentes codones aparecen subrayados):  5' ......AAU CUA UUC UCU AUU AAA ACC .....3‘ a) Especifica la correspondiente secuencia de aminoácidos que se origina en la traducción (indicando las polaridades en ambos casos).
  • 72. Trascripción y traducción de la información genética. 1. El esquema de la figura representa dos procesos biológicos muy importantes ¿Cómo se denominan? 2. Identifica los distintos elementos representados por números
  • 73. Marca la alternativa CORRECTA 1) ¿Cuál es la principal función de los genes? a) Determinar la síntesis de lípidos; b) determinar la síntesis de glúcidos; c) determinar la síntesis de proteínas. d) Ninguna de las respuestas anteriores es la correcta. 2) La parte de la región codificadora de un gen que no contiene información útil se llama.... a) región promotora; b) región terminadora; c) exón; d) intrón. 3) Los procesos de síntesis de ARN a partir del ADN se denominan... a) replicación del ADN; b) trascripción de la información genética; c) traducción de la información genéticas. d) Ninguna de las respuestas anteriores es correcta. 4) El proceso de síntesis de una proteína a partir de la información contenida en un ARNm se denomina... a) replicación del ADN; b) trascripción de la información genética; c) traducción de la información genéticas. d) Ninguna de las respuestas anteriores es correcta. 5) La ARNpolimerasa sinteriza el ARNm en dirección... a) 5'→ 3'; b) 3'→ 5'; c) del aminoácido amino terminal al aminoácido carboxilo terminal del ARNm. d) depende de cómo esté situada la región codificadora.  
  • 74. 6) La cabeza de metil-GTP (m-GTP) que se observa en la Figura. a) marca el inicio del gen; b) tiene función protectora contra las exonucleasas; c) marca el principio de la región codificadora; d) es un desoxirribonucleótido pirimidínico. 7) Los codones está constituidos por... a) 3 bases o nucleótidos; b) 2 bases; c) 1 base. d) Ninguna de las respuestas anteriores es correcta 8) Todas las proteínas comienzan por... a) Glicocola; b) metionina; c) una base nitrogenada. d) Ninguna de las respuestas anteriores es correcta.