Taller de genetica

8.641 visualizaciones

Publicado el

Publicado en: Ciencias
0 comentarios
7 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

Sin descargas
Visualizaciones
Visualizaciones totales
8.641
En SlideShare
0
De insertados
0
Número de insertados
27
Acciones
Compartido
0
Descargas
150
Comentarios
0
Recomendaciones
7
Insertados 0
No insertados

No hay notas en la diapositiva.

Taller de genetica

  1. 1. 1.¿CUÁL ES EL CONCEPTO ACTUAL DE GEN? Un gen es una secuencia ordenada de nucleótidos en la molécula de ADN (o ARN, en el caso de algunos virus) que contiene la información necesaria para la síntesis de una macromolécula con función celular específica, habitualmente proteínas pero también ARNm, ARNr y ARNt. El gen es considerado la unidad de almacenamiento de información genética y unidad de la herencia, pues transmite esa información a la descendencia. Los genes se disponen, pues, a lo largo de ambas cromátidas de los cromosomas y ocupan, en el cromosoma, una posición determinada llamada locus. Los genes están localizados en los cromosomas en el núcleo celular. 2. ¿QUÉ FUNCIÓN REALIZAN EN GENERAL LAS ADN POLIMERASA Y LAS ARN POLIMERASAS? la ADN polimerasa actúa en la replicación (autorreplicación o síntesis) del ADN , sintetizando 2 hebras idénticas a 2 hebras moldes o templados, a través de un mecanismo más complejo la ARN polimerasa actúa en la transcripción, sintetizando un ARN (mensajero, ribosomal o de transferencia) a partir de ADN (de un trozo de ADN --> gen, u operón) estas enzimas actúan junto a otras enzimas ... y existen diferentes tipos de estas enzimas en diferentes células (en eucariontes existen ARNpol I, ARNpol II y ARNpol III ...como ejemplo, las demás enzimas tienes diferentes tipos). 3. QUE SE ENTIENDE POR DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR? Basándose sobre las evidencias acumuladas hasta el momento, Francis Crick proclamó, en una conferencia dada a la Sociedad Británica de Biología Experimental, lo que se llamó el "dogma central". En esta conferencia se discute por primera vez la naturaleza del código genético y se propone lahipótesis de un adaptador y que la información fluye del DNA a las proteínas en una única dirección. Después de haber publicado su teoría, Crick fue criticado por usar la palabra "dogma" ya que un dogma es algo que no se pone en duda. Crick
  2. 2. reconoció más tarde que debería haberlo llamado "hipótesis central". Aunque en ese momento había poca evidencia que apoyase este "dogma", una diversidad de experimentos han demostrado desde entonces que se cumple, salvo unas pocas excepciones. La principal excepción al dogma central es un proceso llamado transcripcióninversa, en el cual la información codificada por ciertos virus que contienenRNA se transcribe a DNA por la acción de la enzima transcriptasa inversa, que sería aislada en 1970. El hecho de que la información fluye del DNA a las proteínas suministró una importante confirmación de la teoría darwinista de la evolución. Según esta teoría, la selección natural actúa sobre las variaciones heredables que se encuentran en el DNA. Por otra parte, el "dogma" suministró una refutación a la opinión de Lamarck, quien proponía que las características adquiridas durante la vida de un individuo podían ser heredadas. Hoy sabemos que esas variaciones sólo pueden ser heredadas si son debidas a cambios en el DNA de los gametos de modo que puedan ser transmitidos a la siguiente generación 4. QUE SIGNIFICA QUE EL CÓDIGO GENÉTICO ES ALTAMENTE ESPECIFICO Y AL MISMO TIEMPO DEGENERADO? PUEDE ESTO OFRECER ALGUNA VENTAJA? *Especificidad y continuidad Ningún codón codifica más de un aminoácido, ya que, de no ser así, conllevaría problemas considerables para la síntesis de proteínas específicas para cada gen. Tampoco presenta solapamiento: los tripletes se hallan dispuesto de manera lineal y continua, de manera que entre ellos no existan comas ni espacios y sin compartir ninguna base nitrogenada. Su lectura se hace en un solo sentido (5' - 3'), desde el codón de iniciación hasta el codón de parada. Sin embargo, en un mismo ARNm pueden existir varios codones de inicio, lo que conduce a la síntesis de varios polipéptidos diferentes a partir del mismo transcrito. *Degeneración
  3. 3. El código genético tiene redundancia pero no ambigüedad (ver tablas de codones). Por ejemplo, aunque los codones GAA y GAG especifican los dos el ácido glutámico (redundancia), ninguno específica otro aminoácido (no ambigüedad). Los codones que codifican un aminoácido pueden diferir en alguna de sus tres posiciones, por ejemplo, el ácido glutámico se específica por GAA y GAG (difieren en la tercera posición), el aminoácido leucina se específica por los codones UUA, UUG, CUU, CUC, CUA y CUG (difieren en la primera o en la tercera posición), mientras que en el caso de la serina, se específica por UCA, UCG, UCC, UCU, AGU, AGC (difieren en la primera, segunda o tercera posición). De una posición de un codón se dice que es cuatro veces degenerada si con cualquier nucleótido en esta posición se específica el mismo aminoácido. Por ejemplo, la tercera posición de los codones de la glicina (GGA, GGG, GGC, GGU) es cuatro veces degenerada, porque todas las sustituciones de nucleótidos en este lugar son sinónimos; es decir, no varían el aminoácido menudo como doble degenerado. 5. SEÑALA LOS ASPECTOS DIFERENTES QUE ENCUENTRAS ENTRE REPLICACIÓN Y TRANSCRIPCIÓN ¿QUE TIENEN EN COMÚN? El proceso de replicación de ADN es el mecanismo que permite al ADN duplicarse. Esta duplicación del material genético recibe el nombre de replicación semiconservativa debido a que las dos cadenas complementarias del ADN parental, al separarse, sirven de molde a su vez para la síntesis de una nueva cadena, complementaria de la cadena molde, de forma que cada nueva doble hélice contiene una de las cadenas del ADN parental. La transcripción del ADN es el primer proceso de la expresión genética. Durante la transcripción genética, las secuencias de ADN son copiadas a ARN mediante una enzima llamada ARN polimerasa. La transcripción produce ARN mensajero como primer paso de, en la mayoría de los casos, la síntesis de proteínas. La transcripción del ADN también podría llamarse síntesis del ARN mensajero.
  4. 4. Transcripción del ADN: Cuando una parte de la información contenida en la molécula de ADN debe ser utilizada en el citoplasma de la célula para la construcción de las proteínas, ella es transcrita bajo la forma de una pequeña cadena de ácido ribonucléico: el ARN mensajero (ARNm) utilizando las mismas correspondencias de base que el ADN visto anteriormente, pero con la diferencia ya señalada de que la timina es reemplazada por el uracilo. Uno a uno se van añadiendo los ribonucleótidostrifosfato en la dirección 5´a 3´, usando de molde sólo una de las ramas de la cadena de ADN y a la ARN polimerasa como catalizador. 6. QUE ES UNA MUTUACION GENÉTICA? CITA ALGUNOS EJEMPLOS? En Genética se denomina mutación genética, mutación molecular o mutación puntual a los cambios que alteran la secuencia de nucleótidos del ADN. No confundir con una mutación génica que se refiere a una mutación dentro de un gen. Estas mutaciones en la secuencia de ADN pueden llevar a la sustitución de aminoácidos en las proteínas resultantes. Un cambio en un solo aminoácido puede no ser importante si es conservativo y ocurre fuera del sitio activo de la proteína. De lo contrario puede tener consecuencias severas, como por ejemplo:  La sustitución de valina por ácido glutámico en la posición 6 de la cadena polipéptidica de la beta globina da lugar a la enfermedad anemia falciforme en individuos homocigóticos debido a que la cadena modificada tiene tendencia a cristalizar a bajas concentraciones de oxígeno.  Las proteínas del colágeno constituyen una familia de moléculas estructuralmente relacionadas que son vitales para la integridad de muchos tejidos, incluidos los huesos y la piel. La molécula madura del colágeno está compuesta por 3 cadenas polipeptídicas unidas en una triple hélice. Las cadenas se asocian primero por su extremo C-terminal y luego se enroscan hacia el extremo N-terminal. Para lograr este plegado, las cadenas de colágeno tienen una estructura repetitiva de 3 aminoácidos: glicina - X - Y
  5. 5. (X es generalmente prolina y Y puede ser cualquiera de un gran rango de aminoácidos). Una mutación puntual que cambie un solo aminoácido puede distorsionar la asociación de las cadenas por su extremo C-terminal evitando la formación de la triple hélice, lo que puede tener consecuencias severas. Una cadena mutante puede evitar la formación de la triple hélice, aún cuando haya 2 monómeros de tipo salvaje. Al no tratarse de una enzima, la pequeña cantidad de colágeno funcional producido no puede ser regulada. La consecuencia puede ser la condición dominante letal osteogénesis imperfecta 7. ¿QUÉ SE ENTIENDE POR INGENIERÍA GENÉTICA? CONOCES ALGUNAS DE SUS APLICACIONES? La ingeniería genética, se podría definir como unconjunto de metodologías que permite transferir genes de un organismo a otro y expresarlos (producir las proteínas para las cuales estos genes codifican) en organismos diferentes al de origen. El ADN que combina fragmentos de organismos diferentes se denomina ADN recombinante. En consecuencia, las técnicas que emplea la ingeniería genética se denominan técnicas de ADN recombinante. Así, es posible no sólo obtener proteínas recombinantes de interés sino también mejorar cultivos y animales. Los organismos que reciben un gen que les aporta una nueva característica se denominan organismos genéticamente modificados (OGM) o transgénicos. A su vez, la ingeniería genética es lo que caracteriza a la biotecnología moderna que implementa estas técnicas en la producción de bienes y servicios útiles para el ser humano, el ambiente y la industria . En la actualidad, gracias a la tecnología del ADN recombinante, se clonan los genes de ciertas proteínas humanas en microorganismos adecuados para su fabricación comercial. Un ejemplo típico es la producción de insulina que se obtiene a partir de la levadura Sacharomycescerevisae, en la cual se clona el gen de la insulina en humanos. Obtención de vacunas recombinantes
  6. 6. El sistema tradicional de obtención de vacunas a partir de microorganismos patógenos inactivos, puede comportar un riesgo potencial. Muchas vacunas, como la de la hepatitis B, se obtienen actualmente por ingeniería genética. Como la mayoría de los factores antigénicos son proteínas lo que se hace es clonar el gen de la proteína correspondiente. Diagnóstico de enfermedades de origen genético Conociendo la secuencia de nucleótidos de un gen responsable de una cierta anomalía, se puede diagnosticar si este gen anómalo está presente en un determinado individuo. Obtención de anticuerpos monoclonales Este proceso abre las puertas para luchar contra enfermedades como el cáncer y diagnosticarlo incluso antes de que aparezcan los primeros síntomas. 8. observa los siguientes esquemas, relativos al funcionamiento de los ácidos nucleicos,e indica cuales son verdaderos y cuales son falsos: ADN transcripción ARN V ADN traducción proteína F ADN replicación ADN1+ADN2 V ADN traducción ARN F 9. se realiza el análisis químico de un acido nucleíco y nos va suministrando progresivamente la información. se escribe a continuación, por orden cronológico, la información que nos suministran. Conjetura después de cada etapa el tipo de acido nucleico que se esta analizando, y justifica tu respuesta:
  7. 7.  Contiene un hidrato de carbono que es la ribosa  Contiene un 13% de uracilo,un 25% de adenina, un 28% de guanina y un 34% de citosina  Su peso molecular es de 200.000. R/ El análisis que se está realizando es al acido ribonucleico( ARN o RNA) que recibe el nombre por la molécula de azúcar contenida en su columna vertical, el cual está compuesto por ribonucleotidos de adenina, guanina, citosina y uracilo ,teniendo una sola hélice por lo tanto su peso molecular es de 200.000.. 10.¿que quiere decir que en la replicación del ADN una cadena se copia de forma continua y la otra lo hace de forma discontinua y desfasada?. R/ CONTINUA: Mediante el extremo 3´ se une el cebador que tiene un OH libre y a partir de este se une un ADN POLIMERASA, esta es una enzima que sintetiza la polimerización del ADN agregando bases nitrogenadas.  DISCONTINUA: Se sintetiza por porciones ( fragmento de okasaki) a medida que se va separando por varios cavadores. 11. CITA ALGÚN MECANISMO DE REPARACIÓN DEL ADN EN EL QUE INTERVENGAN UN ADN POLIMERASA Simplemente porque la DNA polimerasa es una enzima que cataliza la polimerizacion del DNA agregando nucléotidos en el extremo 3' OH libre. Al abrir la hebra de DNA y generarse la Horquilla de replicación, solo una hebra le permite a la DNA polimerasa replicar progresivamente e n una hebra ( La que va de 3'-- >5') y la otra hebra quedaría al revéz, es decir desde 5'--3' y la DNa polimerasa no quedaría con extremos 3' libres. Revisa la estructura del DNA y podrás comprender mejor porque se pistula la teoría de los fragmentos de okasaki en lo que respecta a la Hebra Retardada de la replicación. 12. En la purificación de un fragmento de ADN se ha perdido una porción de una de las dos hebras, quedando la secuencia de bases nitrogenadas como se indica
  8. 8. a continuación. Reconstruye la porción que falta y explica en que te basa para reconstruirla ATTACC……….. TAATGGGCCGAATTCGGCTAAGCT R/ ATTACCCGGCTTAAGCCGATTCGA TAATGGGCCGAATTCGGCTAAGCT En la reconstrucción nos basamos en la hebra molde de las bases nitrogenadas. 13. Si el acido nucleico que se estuviera purificando fuera ARN, ¿podrías reconstruir una porción perdida con la misma facilidad que lo has hecho en la cuestión anterior? ¿Qué datos necesitarías para intentar dicha reconstrucción? R/ Si el acido nucleído que se estuviera purificando fuera ARN no podría reconstruirse una porción perdida con la misma facilidad porque el RN está compuesto por una sola hebra, debido a que su reconstrucción necesitaría la hebra molde de ADN 3’- 5’. 14. Defina brevemente los siguientes conceptos:  Nucleótidos nucleótido es un compuesto orgánico que está formado por una base nitrogenada, un azúcar y ácido fosfórico. Es posible dividir a los nucleótidos en ribonucleótidos (cuando el azúcar es la ribosa) y desoxirribonucleótidos (si el azúcar es la desoxirribosa).  Un polinucleótido Los polinucleótidos son cadenas lineales de nucleótidos en los que los grupos fosfato están esterificados a los hidroxilos 5' y 3' de dos nucleótidos consecutivos. Como consecuencia, cada
  9. 9. polinucleótido contiene únicamente un OH libre en el grupo fosfato en posición 5' (extremo 5' fosfato) y un OH libre en posición 3' (extremo 3'). Por convención, la secuencia de los polinucleótidos se representa en el sentido 5' ® 3'. Los dos polinucleótidos presentes en los seres vivos son el ácido ribonucleico (RNA) y el ácido desoxirribonucleico (DNA).  La cromatina es el conjunto de ADN, histonas y proteínas no histónicas que se encuentra en el núcleo de las células eucariotas y que constituye el cromosomaeucariótico.  El ARN de transferencia, ARN transferente o ARNt (tRNA en inglés) es un tipo de ácido ribonucleico encargado de transportar los aminoácidos a los ribosomas para incorporarlos a las futuras proteínas durante el proceso de proteica. Brazo aceptor formado por el extremo 5' y el extremo 3', que en todos los ARNt posee la secuencia CCA, cuyo grupo -OH terminal sirve de lugar de unión con el aminoácido.  la desnaturalización Se entiende por desnaturalizacion de las proteinas a la modificación que sufre la estructura de las proteínas como así también las de los ácidos nucleicos. En el proceso de desnaturalizacion de las proteinas podemos observar el cambio de su estructura nativa, como se afectado su funcionamiento y su cambio de acuerdo a su actividad fisicoquímica.  Un anticodón es una secuencia de tres nucleótidos ubicada en el ARNt, complementaria al codón ubicado en el ARNm. 15. La siguiente secuencia de bases corresponde a un fragmento de una hebra de ADN: 3’ T A C C A A C G G C A T 5’ molde 5’ A T G G T T G C C G T A 3’ complementario 5’ A U G - G U U - G C C - G U A 3’ ARNm
  10. 10. metionina valina alanina valina Hay 4 codones y 4 amonoacidos 16. Imagina que deseas obtener el siguiente tripeptido: HIS-PHE-LYS  ¿Puedes fabricar el fragmento de ADN necesario para esta síntesis?  ¿Qué posible secuencia de bases utilizarías? R/ HIS PHE LYS 3’ GTA AAA UUU 5’ ADN 5’CAU UUU AAA 3’ ARNm Histidina fenilalanina lisina  Histidina : CAU,CAC  Fenilalanina: UUU,UUC  Lisina: AAA,AAG 17. Consultando la tabla de la clave genética, señala el polipeptido que saldría de este trozo de ADN: T A C G C T G C G A T A A A C A T T G C T C G A G A T A T G C G A C G C T A T T T G T A A C G A G C T C T A A U G - C G A - C G C - U A U - U U G - U A A - C G A - G C U - C U A Met arg arg thr leu stop arg ala leu 18. ¿qué quiere decir crecimiento5’ 3’ R/ 5’ es el extremo donde esta las cadenas de fosfato 19. ¿Cómo definirías el concepto de mutación?
  11. 11. R/ MUTACIÓN: Es todo cambio en la información hereditaria. Esto es, será una mutación todo cambio que afecte al material genético: ADN, cromosomas o cariotipo. Las mutaciones pueden producirse tanto en células somáticas como en células germinales, en estas últimas tienen mayor transcendencia. Las mutaciones sólo son heredables cuando afectan a las células germinales. Si afectan a las células somáticas se extinguen por lo general con el individuo, a menos que se trate de un organismo con reproducción asexual. Las mutaciones pueden ser: naturales (espontáneas) o inducidas (provocadas artificialmente con radiaciones, sustancias químicas u otros agentes mutágenos). 20. dibuja la estructura funcionante del operon lac A SECUENCIA DE ADN DEL OPERÓN LAC de E. coli, el ARNm de los genes lacZYA, y el gen lac 22. función de los ribosomas en la síntesis de proteínas La función de los ribosomas es la síntesis de proteínas. Este es el proceso mediante el cual el mensaje contenido en el ADN nuclear, que ha sido previamente transcrito en un ARN mensajero, es traducido en el citoplasma, juntamente con los ribosomas y los ARN de transferencia que transportan a los aminoácidos, para formar las proteínas celulares y de secreción. El ribosoma lee el ARN mensajero y ensambla la proteína con los aminoácidos suministrados por los ARN de transferencia, este proceso se denomina síntesis de proteínas. Los polisomas se encargan de sintetizar proteínas de localización celular, mientras que los ribosomas del RER se encargan de sintetizar proteínas de exportación, o sea que se irán de la célula hacia otro lugar donde se necesite. Para la síntesis de proteínas se requiere la unión de una subunidad mayor y otra menor. Al terminar de fabricar las proteínas, se separan. Cuando vuelven a sintetizar se unen dos diferentes.
  12. 12. Para la síntesis de proteínas los ribosomas se asocian en grupos mediante un filamento de unos 2 nm. de espesor. Estos ribosomas asociados se denominan polisomas, y suelen adoptar una figura en espiral. La subunidad menor queda hacia el interior de la espiral. Los ribosomas forman polisomas para realizar cualquier tipo de síntesis proteicas: tanto la efectuada por los ribosomas libres como la realizada por los asociados a membranas (RER). En el RER la subunidad mayor es la que se adosa a la membrana. El número de ribosomas que forman un polisoma y la longitud de ARN-m que los une varía según el peso molecular de las proteínas que se va a sintetizar. Para la síntesis de proteínas, los ribosomas recorren el ARNm desde un extremo a otro. Por cada tres nucleótidos recorridos, incorporan un aminoácido a la cadena de proteínas que están sintetizando; aminoácidos que les proporciona el ARNt . Cuando han completado el recorrido, los ribosomas se liberan del ARNm y suelta la proteína ya terminada. Mientras se esté sintetizando proteínas, por cada ribosoma que abandona el polisoma en el extremo final, otro se incorpora en el inicial, de modo que el ritmo de trabajo del polisoma siempre es complejo. El ARNt y la cadena de aminoácidos que se está formando se encuentran en un canal situado en la subunidad mayor 23. Explicar el siguiente esquema: ADN ARN PROTEINA R/ Es correcto ADN ARN PROTEINA debido a que el ADN es transcrito a ARNm y este es traducido a proteínas lo cual realiza la acción celular.
  13. 13. ADN ARN Es correcto únicamente en los retrovirus a través de la transcriptasa inversa; es una enzima tipo ADN polimerasa y su función es sintetizar ADN de doble cadena utilizando como molde ARN monocateriano. 24. Teniendo en cuenta la tabla del código genético, establece todos los pasos que conducirán a la síntesis del péptido: LEUCINA-ALANINA-PROLINA-SERINA-ARGININA-ARGININA-VALINA 5’ AUG CUA GCU CCG AGC CGU AGA GUA 3’ ARNm 3’ TAC GAT CGA GGC TCG GCA UCU CAT 5’ MOLDE 3’ UAC GAU CGA GGC UCG GCA UCU CAU 5’ ARNt 8 pares ARNt 25. la secuencia de bases de una de las hebras de un fragmento de ADN es: 3’ A A T C C G C G C T A T T A T C G T 5’ CONTINUA 5’ T T A G G C G C G A T A A T A G C A 3’ 3’ A A T C C G C G C T A T T A T C G T 5’ 5’ T T A G G C G C G A T A A T A G C A 3’ DISCONTINUA
  14. 14. Explicar por que la síntesis resulta:  Semiconservativa: porque una hebra pertenece a la cadena anterior y sirve como molde para formar una nueva hebra.  Bidireccional: porque las hebras son continuas y discontinúan, tiene 2 direcciones diferentes  Discontinua: porque la hebra va de 5’-3’ se forma a partir de varios cebadores
  15. 15. TALLER DE GENÉTICA EL CÓDIGO GENÉTICO LUIS DANIEL POLO ALARCÓN LIS ESTEFANÍA REVUELTAS UBARNE TEODORA INÉS CAVADIA UNIVERSIDAD DE CÓRDOBA FACULTAD DEL ÁREA DE CIENCIAS DE LA SALUD PROGRAMA BACTERIOLOGÍA MONTERÍA – CÓRDOBA 2014

×