SlideShare una empresa de Scribd logo
Biología. 2º bachillerato
                                             Unidad 14. Genética molecular



     Genética molecular
14




                    C.E.M HIPATIA-FUHEM
                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                              Unidad 14. Genética molecular



     Genética molecular
14   1. El ADN como depositario de la información
        genética.
     2. Concepto molecular de gen.
     3. Replicación del ADN
         1. Etapas de la replicación
         2. Diferencias entre el proceso replicativo en
             procariotas y eucariotas.
         4. Expresión de la información genética:
             dogma central de la biología molecular.
         5. Transcripción.
         6. El código genético
         7. Traducción.
         8. El genoma de procariotas y eucariotas
         9. El proyecto genoma humano.
         10. Concepto de proteoma y proteómica.
             Aplicaciones en biociencias.




                                     C.E.M HIPATIA-FUHEM
                                        Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                Unidad 14. Genética molecular


El ADN como portador de información genética

              Interfase
                                                        Análisis de los
                                                        Cromosomas.
                                                        (ADN + proteínas)



                          “Collar de
                            perlas”




Fibra de ADN
unida a proteínas




                                       C.E.M HIPATIA-FUHEM
                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                Unidad 14. Genética molecular


El ADN como portador de información genética

              Interfase
                                                      ¿Qué molécula
                                                         posee la
                                                       información
                                                        genética?


                          “Collar de
                            perlas”




Fibra de ADN
unida a proteínas




                                       C.E.M HIPATIA-FUHEM
                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                Unidad 14. Genética molecular


El ADN como portador de información genética

              Interfase
                                                    ¿Las proteínas en
                                                     su secuencia de
                                                      aminoácidos?


                          “Collar de
                            perlas”




Fibra de ADN
unida a proteínas




                                       C.E.M HIPATIA-FUHEM
                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                Unidad 14. Genética molecular


El ADN como portador de información genética

              Interfase
                                                       ¿El ADN en su
                                                       secuencia de
                                                        nucleótidos?


                          “Collar de
                            perlas”




Fibra de ADN
unida a proteínas




                                       C.E.M HIPATIA-FUHEM
                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                     Unidad 14. Genética molecular


1. ADN COMO MATERIAL GENÉTICO




                                        Primeras evidencias:
                                      Las proteínas. El ADN tiene
                                        una estructura demasiado
                                      sencilla. Las proteínas son más
                                       complejas y tienen funciones
                                                 catalíticas.

      ¿Quién es el
    depositario de la                 1928. Experimento de
      información                    Griffith (buscando vacuna contra
                                          la neumonía provocada por
       genética?                          Streptococcus pneumoniae)




                            C.E.M HIPATIA-FUHEM
                               Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                     Unidad 14. Genética molecular


  1. ADN COMO MATERIAL GENÉTICO


              Streptococcus
               pneumoniae
       (presenta dos variantes o cepas
                  distintas)




Cepa S: (del inglés smooth, liso). Poseen
 cápsula gelatinosa de polisacáridos que
 impide que el sistema inmunológico del
ratón las ataque. Provocan la enfermedad


 Cepa R: (del inglés rough, rugoso). Sin
  cápsula gelatinosa de polisacáridos.
Forman colonias rugosas. No provocan la
enfermedad ya que el sistema inmune del
      ratón las ataca rápidamente.

                                            C.E.M HIPATIA-FUHEM
                                               Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                  Unidad 14. Genética molecular




        Experiencias de F. Griffith
                                                                                                   Bacterias S
                                Bacteria con cápsula                                               muertas por
                                (virulenta)                                                        calor

                    Tipo S




1     De los ratones muertos se extraen bacterias      2     De los ratones inoculados no se extraen
      vivas de la cepa S                                     bacterias vivas


                                                               Bacterias R
                             Bacteria sin cápsula                    vivas                         Bacterias S
                             (no virulenta)                                                        muertas por
                Tipo R                                                                             calor




3   De los ratones inoculados no se extraen            4   De los ratones muertos se extraen bacterias
    bacterias vivas, pues no crecen en el animal.          vivas de la cepa S

                                                       C.E.M HIPATIA-FUHEM
                                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                          Unidad 14. Genética molecular




CONCLUSIÓN. En las bacterias muertas (cepa S) existía algo,
  llamado PRINCIPIO TRANSFORMANTE que era captado por las
  bacterias vivas no virulentas (cepa R) y transformaba sus
  caracteres hereditarios convirtiéndose en virulentas.
                                 C.E.M HIPATIA-FUHEM
                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                 Unidad 14. Genética molecular

      EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN
        UN MEDIO CON DNA PURIFICADO PROCEDENTE DE
                       BACTERIAS S)

Cultivaron las bacterias en tubos de
ensayo (in vitro)
Fueron destruyendo, uno por uno,
todos los componentes bioquímicos
de las células S para evitar la
transformación e identificar el
responsable.
Degradaron polisacáridos de la
pared y al inyectarlas en el ratón la
transformación se producía. A
continuación degradaron proteínas y
la transformación se producía.
Así sucesivamente hasta que atacar
al ADN de las bacterias. La
transformación no se producía
                                        C.E.M HIPATIA-FUHEM
                                           Miguel Ángel Madrid
Biología. 2º bachillerato
                                                          Unidad 14. Genética molecular

    EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN
      UN MEDIO CON DNA PURIFICADO PROCEDENTE DE
                     BACTERIAS S)

La molécula de ADN contiene la
información necesaria para
convertir las bacterias R no
virulentas en bacterias S
virulentas.
Demostraron además, del papel
biológico del ADN, que las
bacterias pueden intercambiar
material genético
(transformación)




                                 C.E.M HIPATIA-FUHEM
                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                              Unidad 14. Genética molecular




1.   Se inoculan ratones con cepas S, contraen la enfermedad y mueren. De ellos se extraen
     bacterias S vivas.
2.   Los ratones inoculados con cepas R no contraen la enfermedad. De ellos se extraen bacterias
     vivas pues no crecen en el animal
3.   Se inoculan ratones con cepas S, muertas por el calor. No contraen la enfermedad. De ellos no
     se extraen bacterias vivas.
4.   Los ratones inoculados con cepas S, muertas por el calor y, simultáneamente, cepas R vivas
     contraen la enfermedad y mueren. De ellos se extraen bacterias vivas S.
                                                     C.E.M HIPATIA-FUHEM
                                                        Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                  Unidad 14. Genética molecular




En 1944 Avery y colaboradores demostraron que el principio
  transformante era el ADN, que determinaba o no la producción de
  la cápsula bacteriana.



                         CONCLUSIÓN

                 El ADN era el material genético
                         en bacterias.




                En 1952 se demostró que era el
                material genético en el resto de
                          organismos




                                         C.E.M HIPATIA-FUHEM
                                            Miguel Ángel Madrid
Biología. 2º bachillerato
                                                             Unidad 14. Genética molecular


El concepto molecular de gen
                          Genética clásica
                          Un gen contiene información
                          para un determinado carácter




                                                El concepto de gen ha ido
                                                cambiando según
                                                aumentaban los
                                                conocimientos sobre
                                                genética molecular.

                                    C.E.M HIPATIA-FUHEM
                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                          Unidad 14. Genética molecular


  2. CONCEPTO MOLECULAR DE GEN


Experimento de G. Beadle y E. Tatum con el hongo Neurospora
  crassa



                                                  Sólo precisa una fuente
                                                    de carbono, biotina y
                                                      ciertos minerales.
                                                   Sometieron al hongo a
                                                  ciertas dosis de rayos X.
                                                    Obtuvieron mutantes
                                                   incapaces de sintetizar
                                                        determinados
                                                  aminoácidos, por lo que
                                                     solo sobrevivían al
                                                     añadir al medio los
                                                         aminoácidos.


                                 C.E.M HIPATIA-FUHEM
                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                          Unidad 14. Genética molecular


  2. CONCEPTO MOLECULAR DE GEN


Experimento de G. Beadle y E. Tatum con el hongo Neurospora
  crassa



                                                          Descubrieron :

                                                      A cada mutante le
                                                      faltaba el enzima
                                                        específico que
                                                  catalizaba algún paso de
                                                        la síntesis del
                                                      aminoácido al que
                                                       habían alterado.
                                                       Los mutantes se
                                                  diferenciaban de la cepa
                                                  salvaje en un solo gen.


                                 C.E.M HIPATIA-FUHEM
                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                          Unidad 14. Genética molecular


  2. CONCEPTO MOLECULAR DE GEN


Experimento de G. Beadle y E. Tatum con el hongo Neurospora
  crassa




                                                          Descubrieron :

                                                  Si se altera el gen, no se
                                                      fabrica la enzima
                                                  correspondiente y la ruta
                                                         se bloquea.




                                 C.E.M HIPATIA-FUHEM
                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                            Unidad 14. Genética molecular


   2. CONCEPTO MOLECULAR DE GEN



1 gen               1 enzima




1 gen               1 proteína




1 gen               1 cadena
                   polipeptídica



                                   C.E.M HIPATIA-FUHEM
                                      Miguel Ángel Madrid
Biología. 2º bachillerato
                                                           Unidad 14. Genética molecular


  2. CONCEPTO MOLECULAR DE GEN

Desde el punto de vista funcional:
Fragmento del ADN que lleva la información para
   fabricar una cadena polipeptídica de una
   proteína, necesaria para que se exprese un
   carácter en un individuo




                                  C.E.M HIPATIA-FUHEM
                                     Miguel Ángel Madrid
Biología. 2º bachillerato
                                                       Unidad 14. Genética molecular


REPASEMOS ALGUNOS CONCEPTOS




                              C.E.M HIPATIA-FUHEM
                                 Miguel Ángel Madrid
Biología. 2º bachillerato
REPASEMOS ALGUNOS CONCEPTOS                                                               Unidad 14. Genética molecular


                                       El ciclo celular
  Fase permanente en células
  que no entran nunca en mitosis.                           Síntesis de proteínas y
  Estado de quiescencia.                                    aumento del tamaño celular.

                                              Fase G1
                   Fase G0
                         0
                                                    1

                                                                                          Replicación del ADN y
                                                                                          síntesis de histonas.
           Citocinesis

División del
                                                                                                          Fase S
citoplasma

                                                               Interfase
    Fase de
    mitosis


División celular




    Transcripción y traducción de genes que
                                                        Fase G2
    codifican proteínas necesarias para la                    2

    división. Duplicación de los centriolos
                                                              C.E.M HIPATIA-FUHEM
                                                                 Miguel Ángel Madrid
Biología. 2º bachillerato
                                                            Unidad 14. Genética molecular


   3. REPLICACIÓN (DUPLICACIÓN) DEL ADN



Capacidad de hacer copias de si mismo.
Esto permite transmitir la información genética a
  las células hijas.



                                               La replicación permite a las
                                             células hijas contener el mismo
                                                ADN que la célula madre.


                                               Las células duplican su ADN
                                              antes de la división celular (en
                                               eucariotas en la fase S de la
                                                        interfase).




                                   C.E.M HIPATIA-FUHEM
                                      Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                          Unidad 14. Genética molecular


     3. REPLICACIÓN DEL ADN ¿Cómo se produce la duplicación?
     3 hipótesis
         Hipótesis                       Hipótesis                             Hipótesis
      semiconservativa                  conservativa                           dispersiva




Cadena antigua           Cadena nueva




                                                 C.E.M HIPATIA-FUHEM
                                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                          Unidad 14. Genética molecular


             TEORÍA CONSERVATIVA




Una doble hélice conserva las dos cadenas originales, y
   la otra está formada por las dos cadenas de nueva
                                                C.E.M HIPATIA-FUHEM
   síntesis.
                                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                          Unidad 14. Genética molecular


                  TEORÍA DISPERSIVA




                                             ADN copia
Cada una de las dos cadenas hijas contiene fragmentos
   de la cadena original y fragmentos de la nueva
                                                C.E.M HIPATIA-FUHEM
   síntesis
                                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                         Unidad 14. Genética molecular


       TEORÍA SEMICONSERVATIVA




Cada doble hélice conserva una hélice de las dos
   originales y sintetiza una nueva (Watson y Crick) HIPATIA-FUHEM
                                                C.E.M
                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                                     Unidad 14. Genética molecular


          La duplicación del ADN
                                               Experimento de Meselson y Stahl (1958)

   Medio N15                                                                    Medio N14




                                                                                         ADN N14

                                                   ADN N14-15

            ADN N15


  ADN inicial                          ADN después                            ADN después                            ADN después
                                         de la 1.ª                              de la 2.ª                              de la 3.ª
                                        duplicación                            duplicación                            duplicación




1- Cultivaron bacterias en un medio con N-15 (Las bases nitrogenadas incorporaron el isótopo).
2- Transfirieron las bacterias a un medio con N-14. El ADN obtenido tenia la misma proporción N14,
      N15. Cada bacteria había heredado la mitad de ADN de su progenitora y la otra mitad la
      sintetizaba de los componentes del medio.                       C.E.M HIPATIA-FUHEM
3- Aparecían ADN hibrido (N14-N15) y ADN solo con N14                      Miguel Ángel Madrid
Biología. 2º bachillerato
                                                       Unidad 14. Genética molecular


  3. La duplicación del ADN

                                Núcleo (eucariotas)
                                Nucleoide (procariotas)
¿Dónde ocurre?                  Matriz (mitocondrias)
                                Estroma (cloroplastos)




                                      FASE S DEL
¿Cuándo ocurre?                       CICLO CELULAR
                                        (en interfase)




                              C.E.M HIPATIA-FUHEM
                                 Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                Unidad 14. Genética molecular

3. La duplicación del ADN

                    Principales características de la
                                replicación




      Es semiconservativa.
     Se produce por adición de mononucleótidos en sentido 5´ 3`
      Es bidireccional. Se forman dos horquillas de replicación que
     avanzan en sentidos opuestos.
      En virus y bacterias hay un único punto de inicio, mientras que
     en eucariotas hay varios.
     Es semidiscontinua. En una cadena (llamada conductora) se
     sintetizan fragmentos bastante grandes de forma continua,
     mientras que en la otra (llamada retardada) la síntesis es
     discontinua, es decir, se sintetizan pequeños fragmentos de forma
     separada y después se unen (los llamados fragmentos de
     Okazaki). Ello se debe a que las dos cadenas son antiparalelas y a
     que la síntesis es siempre en sentido 5´  3´


                                       C.E.M HIPATIA-FUHEM
                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                        Unidad 14. Genética molecular


     3. La duplicación del ADN

                           ¿Qué necesitamos?



- ADN molde
- Nucleótidos: ATP, GTP,CTP,TTP
- Proteínas SSB (impiden que se enrede el ADN)
- Enzimas:
     - Helicasas: rompen puentes de H entre las dos cadenas complementarias
     - Topoisomeras (girasas). Desenrollan ADN, evitan tensiones
     - ADN ligasas (unen fragmentos ADN mediante enlaces fosfodiéster). Así sellan el
     hueco entre dos fragmentos de Okazaki.
     - ARN polimerasas (también llamadas primasas). Sintetizan fragmentos de ARN
     (llamados ARN cebador) usando como molde ADN y actúa como iniciador de la
     síntesis de ADN.
     - Nucleasas. Rompen enlaces fosfodiéster entre nucleótidos, escinden ARN cebador y
     reparan lesiones en el ADN.
     - ADN polimerasas. Catalizan la formación de enlaces fosfodiéster entre
     nucleótidos.
                                               C.E.M HIPATIA-FUHEM
                                                  Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                 Unidad 14. Genética molecular


      3. La duplicación del ADN



                                                 Sintetiza el ARN
 ARN POLIMERASA
                                                cebador usando
     (primasa)
                                               como molde el ADN


                       ARN polimerasa




 ARN cebador                            ADN
     (40-50 nucleótidos)



3`
                                                                                        5`

                           ADN molde    ADN polimerasa




                                        C.E.M HIPATIA-FUHEM
                                           Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                           Unidad 14. Genética molecular


      3. La duplicación del ADN
                                                         Función polimerasa
                                                  Precisa ARN cebador (primer o iniciador) y la
                                                               cadena molde de ADN
                                                            Lee en sentido 3´ 5´
                 ADN POLIMERASA
                                                       Función exonucleasa
                                                  Detecta errores, elimina nucleótidos cuyas bases
                                                        están mal emparentadas y ARN cebador


                       ARN polimerasa




 ARN cebador                                 ADN
     (40-50 nucleótidos)                5`                            3`

3`
                                                                                                     5`

                           ADN molde         ADN polimerasa




                                             C.E.M HIPATIA-FUHEM
                                                Miguel Ángel Madrid
Biología. 2º bachillerato
                                                               Unidad 14. Genética molecular


En procariotas distinguimos:
                                        ADN POLIMERASA I
                           (Retira fragmentos ARN cebador: exonucleasa
                                   Sintetiza ADN en los huecos: polimerasa
                            Es correctora, ya que repara errores de la síntesis de
                                                       ADN)

                                             ADN POLIMERASA II
                                   (Interviene en procesos de reparación del ADN
                                   Tiene actividad polimerasa en sentido 5` 3´y
                                        exonucleasa en 3´ 5´)



                                             ADN POLIMERASA III
                                    (Sintetiza ADN en sentido 5´ 3´: polimerasa)




                                             RECUERDA
                                             La ADN polimerasa:
                                             Precisa ARN cebador
                                             Lee en sentido 3´ 5
                                          Sintetiza en sentido 5´ 3´



                                     C.E.M HIPATIA-FUHEM
                                        Miguel Ángel Madrid
Biología. 2º bachillerato
                         Unidad 14. Genética molecular




RECUERDA

La actividad polimerasa
  consiste en catalizar la
 unión de nucleótidos a la
cadena de ácido nucleico
 que se está sintetizando.

La actividad exonucleasa
    consiste en escindir
nucleótidos de los extremos
  de los ácidos nucleicos.


C.E.M HIPATIA-FUHEM
   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                            Unidad 14. Genética molecular


               Fases de la replicación: elongación
Junto a las enzimas que participan en la iniciación, en esta fase actúan las ADN polimerasas.



                         EXONUCLEASA               POLIMERIZACIÓN
    POLIMERASA                                                                    INICIACIÓN
                      dirección    función       dirección      función

                                   elimina
                      5’→ 3’
          I                        cebador
                                                 5’→ 3’          síntesis               no
                      3’→ 5’      reparación


         II           3’→ 5’      reparación     5’→ 3’          síntesis               no



         III          3’→ 5’      reparación     5’→ 3’          síntesis               no




                                                 C.E.M HIPATIA-FUHEM
                                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                               Unidad 14. Genética molecular



3. La duplicación del ADN: Mecanismo de la duplicación en        procariotas

                         Fase de iniciación




                        Fase de elongación




                        Fase de terminación




                                      C.E.M HIPATIA-FUHEM
                                         Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                      Unidad 14. Genética molecular


     Fases de la replicación: iniciación
Consiste en el desenrollamiento y apertura de la doble hélice de ADN

                 Ori C (abundan secuencias
                      ricas en GATC)




                                               La replicación empieza en un
                                              punto del ADN donde abundan
                                                 las secuencias de bases
                                                       GATC (Ori C)
                                                 En él se separan las dos
                                                cadenas de ADN por acción
                                                     de las enzimas.




                                             C.E.M HIPATIA-FUHEM
                                                Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                    Unidad 14. Genética molecular


                 Fases de la replicación: iniciación
          Consiste en el desenrollamiento y apertura de la doble hélice de ADN
                  Ori C (abundan secuencias
                       ricas en GATC)                   Evitan las tensiones debidas a un superenrrollamiento
                                                                               Girasa
                                                            Topoisomerasa
                        Proteínas
                        específicas




                                                                                     Proteínas SSB

                                                                                          Impiden que el ADN
                                                                                           se vuelva a enrollar



                                               Helicasa
Las proteínas
específicas se
unen al punto                            La helicasa rompe los
 de iniciación                           enlaces de hidrógeno
                                        entre las bases y abre la
                                               doble hélice
                                                          C.E.M HIPATIA-FUHEM
                                                             Miguel Ángel Madrid
Biología. 2º bachillerato
                                                              Unidad 14. Genética molecular


           Fases de la replicación: iniciación


Resultado: se forma una burbuja de replicación en la que hay
dos zonas en forma de “Y”, llamadas horquillas de replicación,
      donde se sintetizan las nuevas cadenas de ADN




                                     C.E.M HIPATIA-FUHEM
                                        Miguel Ángel Madrid
Biología. 2º bachillerato
                          Unidad 14. Genética molecular

                            RECUERDA
                           La ADN polimerasa III:
                            Precisa ARN cebador
                            Lee en sentido 3´ 5
                         Sintetiza en sentido 5´ 3´




                                                Burbuja
                                                   de
                                              replicación
C.E.M HIPATIA-FUHEM
   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                           Unidad 14. Genética molecular

 El mecanismo de elongación o formación de las
           nuevas cadenas de ADN
             La ADN polimerasa recorre las hebras molde en el sentido 3’-5’ uniendo
             los nuevos nucleótidos en el extremo 3’.

                                                                               3’

                                                                               5’
                                                                          Una de las hebras se
               5’                                                         sintetiza de modo contínuo
                                      3’                                  por la ADN polimerasa III.
                                                  Fragmentos de           Es la conductora o lider.
                                     5’              Okazaki
               3’                          3’
                                                                  3’
                                                      5’                        3’
La ADN polimerasa III necesita
un fragmento de ARN (cebador
o primer) con el extremo 3’
libre para iniciar la síntesis.
                                                                               5’


     RECUERDA                                              La otra hebra se sintetiza de modo
                                                           discontinuo formándose fragmentos que
     La ADN polimerasa:
                                                           se unirán más tarde. Es la retardada.
     Precisa ARN cebador
     Lee en sentido 3´ 5
  Sintetiza en sentido 5´ 3´
                                                C.E.M HIPATIA-FUHEM
                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                   Unidad 14. Genética molecular




C.E.M HIPATIA-FUHEM 43
    Tema 6: Estructura   y
   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                  Unidad 14. Genética molecular


                                      La primasa (ARN polimerasa)
          3’                           sintetiza un ARN cebador o
                                                  primer

     5’                                                                              La ADN polimerasa III
                                                                                   reconoce los nucleótidos
                                                                                     y los empareja según
                          Cadena                                                      complementariedad
                          continua
                         conductora

                                                                  3’
                                                                                                     5’
               FRAGMENTO DE OKAZAKI
               ( 1000 – 2000 nucleótidos)              Cadena
                                                      retardada
                                                                           5’
                                                                                                    3’
                                              3’

                                                                                La primasa (ARN polimerasa)
                                                                                 sintetiza un ARN cebador o
                                                                                            primer


                                                               La ADN
5’                                                         plomimerasa III
                                                          sintetiza un corto
                                                         fragmento de ADN


                                                      C.E.M HIPATIA-FUHEM
                                                         Miguel Ángel Madrid
Biología. 2º bachillerato
                         Unidad 14. Genética molecular




C.E.M HIPATIA-FUHEM
   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                      Unidad 14. Genética molecular


                       El mecanismo de elongación (II)
 1    La primasa (ARN polim) sintetiza un cebador             2    Las ADN polimerasa III comienzan la síntesis
      en cada hebra de la burbuja de replicación.                  de la hebra conductora por el extremo 3’ de
                                                                   cada cebador.
                                    Cebador


                  Primasas


            Cebador


 3    La primasa sintetiza un nuevo cebador sobre             4    La ADN polimerasa III comienza a sintetizar un
      cada hebra retardada.                                        fragmento de ADN a partir del nuevo cebador.
                                     Hebra retardada




     Hebra retardada


 5    Cuando la ADN polimerasa III llega al cebador           6    La ligasa une los fragmentos de ADN.
      de ARN, lo elimina y lo reemplaza por ADN.
                                           Nuevo cebador

                                                                               Ligasas


Nuevo cebador
                                                           C.E.M HIPATIA-FUHEM
                                                              Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                           Unidad 14. Genética molecular

                                                                                              VOLVER
Síntesis de nuevas cadenas de ADN
                                                  Horquillas observadas

  5’                                                                                     3’


  3’                                                                                     5’




                                                       Ninguna polimerasa añade
                   Punto de inicio                     nucleótidos en estos puntos
  5’                                                                                     3’
                              3’     5’               3’
                                          5’
  3’                                                                                     5’



                                                 Origen de
                   Crecimiento                                      Crecimiento
                                                replicación
                    continuo                                        discontinuo

  5’                                                                                     3’


                                                                                         5’
  3’
                Fragmentos
                 de Okazaki
                                               C.E.M HIPATIA-FUHEM
                                                  Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                        Unidad 14. Genética molecular


                         Fases de terminación

 Tiene lugar cuando las dos horquillas de replicación del cromosoma circular de E. coli
se encuentran, y se han formado dos cromosomas completos que permanecen ligados




                                               C.E.M HIPATIA-FUHEM
                                                  Miguel Ángel Madrid
Biología. 2º bachillerato
                         Unidad 14. Genética molecular




       Burbuja de
       replicación
C.E.M HIPATIA-FUHEM
   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                   Unidad 14. Genética molecular




 CORRECCIÓN DE ERRORES DE LA ADN
            POLIMERASA
Gracias a su acción exonucleasa (elimina nucleótidos
        mal apareados y adiciona los correctos)
    Número de errores 1 por cada 100 000 bases




                                          C.E.M HIPATIA-FUHEM
                                             Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                 Unidad 14. Genética molecular


                Replicación en los eucariontes
        Es muy parecida a la de los procariontes, salvo en algunas diferencias:
Los fragmentos de Okazaki en eucariotas son más cortos, entre 150-200 nucleótidos (en
procariotas de 1000 – 2000 nucleótidos)
La replicación se inicia simultáneamente en carios puntos del cromosoma llamados replicones.

Existen cinco tipos de ADN polimerasas (α,       β, γ, δ, y ε ).
Las histonas se duplican durante la replicación. Junto al ADN formarán el nucleosoma. Los
nuevos nucleosomas se incorporan a la hebra retardada y los viejos en la conductora.




                                                                                                          Telómero
Cuando se elimina el último                                                                         3’
cebador, la ADN polimerasa                                         5’       3’                      5’
no podrá rellenar el hueco,        5’
                                                                                                    5’
al no poder sintetizar en       Cebador                                 Último cebador
dirección 3’ - 5’.
Debido a esto el extremo del                                                                       3’
                                                                                              5’
cromosoma (telómero) se va
acortando cada vez que la
célula se divide. Esto se                                                                          5’
                                La ADN polimerasa polimeriza                      Eliminación
asocia al envejecimiento y
                                     desde el extremo 3’ libre                   de cebadores
muerte celular.
                                                                                                    3’
                                                                                                   Hebra más corta
                                                                                         5’

                                                   C.E.M HIPATIA-FUHEM                              5’
                                                      Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                 Unidad 14. Genética molecular


   El mecanismo de duplicación del ADN en eucariotas
        Hebra conductora   Origen de la replicación                            Origen de la replicación




            Hebra
                                    Horquilla
          retardada
                                  de replicación

                                 Hebra
                               retardada




                                                                   Burbujas de replicación

Nucleosomas
                                     Hebra
                                   conductora
     Nuevos nucleosomas




                                                      C.E.M HIPATIA-FUHEM
                                                         Miguel Ángel Madrid
Biología. 2º bachillerato
                                                          Unidad 14. Genética molecular



              LA TELOMERASA
En las células que se dividen continuamente
     (células madre de los gametos, células
    embrionarias y células cancerosas) hay
   una enzima, denominada telomerasa, que
   impide el acortamiento de los telómeros. .
Se forma por una porción proteica y ARN que
               actúa como molde.
 A partir de este molde, la enzima sintetiza
    ADN para completar la hebra retardada.

                Recuerda: los telómeros son los extremos de los cromosomas
                La telomerasa podría detener el envejecimiento, pero guarda
                una estrecha relación con el cáncer. Los investigadores
                trabajan con ratones para alargar la vida sin aumentar el
                riesgo de cáncer.




                                 C.E.M HIPATIA-FUHEM
                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                  Unidad 14. Genética molecular




                                       María Blasco. Centro de
                                     Investigaciones oncológicas




La telomerasa podría detener el
envejecimiento, pero guarda una estrecha
relación con el cáncer. Los investigadores
trabajan con ratones para alargar la vida sin
aumentar el riesgo de cáncer.

                         C.E.M HIPATIA-FUHEM
                            Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                             Unidad 14. Genética molecular


4. La expresión del mensaje genético


            En 1970 Francis Crick enunció el Dogma Central de la Biología Molecular.




                                                          ARNt


           ADN                                ARNm                                PROTEÍNA
                      Transcripción                         Traducción


   Replicación     NÚCLEO                                  RIBOSOMAS



 Este esquema fue considerado durante muchos años el “dogma central de la biología molecular”.,
                         pero los cirus son una excepción a este dogma


                                                    C.E.M HIPATIA-FUHEM
                                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                              Unidad 14. Genética molecular


      REDEFINICIÓN DEL DOGMA CENTRAL DE
            LA BIOLOGÍA MOLECULAR
Algunos virus poseen ARN replicasa, capaz de obtener copias de su ARN. Otros poseen
transcriptasa inversa que sintetiza ADN a partir de ARN mediante un proceso de retrotranscripción.

          Transcriptasa
                inversa                                        ADNc
                                                                                                            ADNc
                                                               (complementario)
                                                                                                            bicatenario
                  ARN
                  vírico
                                                                                      Transcriptasa
           Envoltura                                                                  inversa
RETROVIRUS
                                                             Transcriptasa                               Transcriptasa
                                                             inversa                                     inversa

                                                                                            ADNc
                               Membrana plasmática                   Degradación            monocatenario
                                de la célula huésped                 del ARN

                           DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR

                           Transcripción
                  ADN                                  ARN                                   PROTEÍNAS
                                Transcripción                            Traducción
                                   inversa
            Replicación                                Replicación
                                                              C.E.M HIPATIA-FUHEM
                                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                           Unidad 14. Genética molecular


4. La expresión del mensaje genético




                    Las secuencias de ADN que pueden moverse
                     a diferentes partes del genoma de una célula
                         se conocen como transposones o «genes
                    saltarines». Fueron descubiertos por Bárbara
                           McClintock, por lo que recibió el premio
                                                   Nobel en 1983.



                    Transcripción                             Traducción
              ADN                         ARNm                                 Proteína
                    Transcripción
                       inversa
Duplicación


                                         Duplicación




                                              C.E.M HIPATIA-FUHEM
                                                 Miguel Ángel Madrid
DOGMA CENTRAL DE LA BIOLOGÌA MOLECULAR
 DOGMA CENTRAL DE LA BIOLOGÌA MOLECULAR                              Biología. 2º bachillerato
                                                               Unidad 14. Genética molecular




              3´                                                            5´
     Hebra molde
      Hebra molde
                             Transcripción
                              Transcripción


             5´                                                               3´




                              Traducción
                               Traducción




                                      C.E.M HIPATIA-FUHEM
                                         Miguel Ángel Madrid
Biología. 2º bachillerato
                         Unidad 14. Genética molecular




C.E.M HIPATIA-FUHEM
   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                       Unidad 14. Genética molecular




TRIPLETE
           ¿Qué es un triplete y un codon?

                                                                       ADN
AATTCGAGCTAGCAGCCACTTACGAGTACGTA
C
                                                                         ARN

ACUUUCCCGACGCAAAACGUUUUUCGAACUU

CODON
             Triplete: Cada una de las secuencias posibles de tres
             nucleótidos en el ADN.
             Codon: Secuencia de tres nucleótidos en el ARN




                              C.E.M HIPATIA-FUHEM
                                 Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                        Unidad 14. Genética molecular



     Síntesis de ARN: requisitos previos
La síntesis de ARN o transcripción necesita:


  CADENA DE ADN QUE ACTÚE COMO MOLDE                        • ARN polimerasa I      ARNr

  ARN -POLIMERARAS                     En eucariotas        • ARN polimerasa II    ARNm

                                                           • ARN polimerasa III    ARNt y ARNr
  RIBONUCLEÓTIDOS TRIFOSFATO DE A, G, C y U



      Bases
                         Ribosa




                                    Ribonucleótido
                                    trifosfato



¿Dónde ocurre?. NÚCLEO                         C.E.M HIPATIA-FUHEM
                                                  Miguel Ángel Madrid
Biología. 2º bachillerato
                                                             Unidad 14. Genética molecular


5. La transcricpción. Síntesis de ARN


                         RECUERDA




                  LA ARN polimerasa RECORRE LA
                    CADENA DE ADN EN SENTIDO
                 3` 5´Y AÑADE LOS NUCLEÓTIDOS
                   COMPLEMENTARIOS A LOS DE LA
                       CADENA DE ADN QUE SE
                            TRANSCRIBE




                                    C.E.M HIPATIA-FUHEM
                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                             Unidad 14. Genética molecular


5. La transcricpción. Síntesis de ARN


                      Fase de iniciación




                      Fase de elongación




                     Fase de terminación




                      Fase de maduración

                                    C.E.M HIPATIA-FUHEM
                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                   Unidad 14. Genética molecular



           El proceso de la transcripción
1          INICIACIÓN
    La ARN-polimerasa reconoce los centros promotores (ricos
    en A y T).                                                                      Cola poli-A

    Luego abre la doble hélice para que los ribonucleótidos se unan
    a la cadena molde.                                                                Poli-A
                                                 TERMINACIÓN             3            polimerasa

                    La ARN-polimerasa reconoce en el ADN unas señales
                    de terminación que indican el final de la transcripción.
                    En procariontes son secuencias palindrómicas.
                                                                                     Punto de
                    En eucariontes
                                                                                     corte
2         ELONGACIÓN
     La ARN-polimerasa avanza en sentido 3’-5’ y sintetiza
     el ARN en sentido 5’-3’. .                                                         Señal de
          Cadena molde de ADN (transcrita)                                              corte
    ARN
                                                        ARN - polimerasa




                                                                                  NO OLVIDES
                                             Cadena inactiva de ADN HIPATIA-FUHEM polimerasa lee en dirección
                                                                C.E.M          La ARN
                                                                   Miguel Ángel Madrid    3` 5´
Biología. 2º bachillerato
                                                                         Unidad 14. Genética molecular


                                                                                 LA LUPA AMPLÍA
           5. Transcripción: maduración en procariotas                           LA IMAGEN

     Promotor               ARN-polimerasa

5’                                              3’
3’                                              5’         No existe maduración del
                                                               ARNm, se unen a los
                                                            ribosomas y se traducen
                       Iniciación
5’                                              3’
3’                                              5’
                                                          Los ARNr y ARNt (transcritos
                ARN                                          primarios) precisan de un
                      Elongación                              proceso de maduración
5’
3’
                                                3’              para ser funciones
                                                5’



                      Finalización                        Los ARN que se forman son
5’                                              3’
3’                                              5’          policistrónicos (contienen
                                                               información para la
                                                                síntesis de varios
                      ARN transcrito completo                      polipéptidos)


                                                C.E.M HIPATIA-FUHEM
                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                         Unidad 14. Genética molecular


           Transcripción: maduración en procariotas
     Promotor               ARN-polimerasa

5’                                              3’
3’                                              5’



                       Iniciación
5’                                              3’
3’                                              5’

                ARN
                      Elongación
5’                                              3’
3’                                              5’



                      Finalización
5’                                              3’
3’                                              5’



                      ARN transcrito completo




                                                C.E.M HIPATIA-FUHEM
                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                   Unidad 14. Genética molecular

                                                                           Los ARN que se forman son
   Transcripción: maduración en eucariotas
                                                                                 monocistrónicos
                      Promotor             Unidad de transcripción

                         5’                                                           3’
  Iniciación
                         3’                                                           5’


                                           ARN

               ARN-polimerasa

1. Tras la unión de
    los 30 primeros
    ribonucleótidos      5’                                                           3’
      se añade una       3’                                                           5’
       caperuza de
    metilguanosina
          en 5´               m7-Gppp

 Elongación                   Capucha 5'




                         5’                                                           3’
                         3’                                                           5’

                                                                                                CONTINUAR
                              m7-Gppp

                                                          C.E.M HIPATIA-FUHEM
                                                             Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                               Unidad 14. Genética molecular


    Transcripción en eucariotas
               5’                                                                   3’
Finalización
               3’                                                                   5’



                                                                                         2. Después de
                                 PoliA-polimerasa
                                                                                         la   separación
                                                                                         del ARN, una
                    m7-Gppp                                                              enzima la poliA-
                                                                                         polimerasa
                    Capucha 5'                                                           añade       una
                                                             OH
                                                                                         secuencia     de
                                                                                         unos         200
                                                                                         nucleótidos de
                                                                                         adenina    (cola
                                                                                         de poli A)

               ARN heterogéneo
                   nuclear


                                                                   Cola de poli-A
                    m -Gppp
                      7                                                                  OH

                    Capucha 5'
                                                                                              CONTINUAR



                                                    C.E.M HIPATIA-FUHEM
                                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                            Unidad 14. Genética molecular


    Transcripción en eucariotas. Proceso de maduración
       Maduración      5’                                                              3’
                                 Exón 1            Intrón                Exón 2

                                                                                             Proteína



                    RNPpn

                                                                  Espliceosoma.



                            5’                                                 3’
3. Eliminación                                                                         Mecanismo de
de     intrones                                                                          splicing
(segmentos de
ARN que son se
traducen)


                                                                                             Intrón




                                          Exón 1              Exón 2                      El ARNm ya está en
                    ARNm                                                             condiciones de salir del núcleo
                                 5’                                       3’

                                                            C.E.M HIPATIA-FUHEM
                                                               Miguel Ángel Madrid
Biología. 2º bachillerato
                                                             Unidad 14. Genética molecular


                      ¿ LO SABÍAS?
 La toxicidad de la Amanita phalloides (provoca diarreas,
vómitos, dolores abdominales e incluso la muerte) se debe
 a una sustancia, 1 alfa amanitina, que no se destruye con
  la cocción y se comporta como un inhibidor de la ARN
 polimerasa II en eucariotas, lo que bloquea la síntesis de
                           ARNm




                                    C.E.M HIPATIA-FUHEM
                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                           Unidad 14. Genética molecular




                 COMPARACIÓN TRANSCRIPCIÓN
                     PROCARIOTAS                    EUCARIOTAS
Localización         Nucleoide (citoplasma)         Núcleo
Genes                Continuos                      Fragmentos (intrones y
                                                    exones)
ADN                  Bajo grado de                  Muy empaquetado
                     empaquetamiento
ARN polimerasa       1 ARN polimerasa que           ARN poli I: ARNr
                     sintetiza ARNm, ARNr,          ARN poli II: ARNm
                     ARNt…                          ARN poli III: ARNt
Tipos de genes       Policistrónicos                Monocistrónicos
Maduración           ARNr y ARNt                    ARNm




                                  C.E.M HIPATIA-FUHEM
                                     Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                            Unidad 14. Genética molecular


     6. El código genético


      ¿Cómo se pasaba de un
          lenguaje de cuatro
        letras a otro lenguaje
            formado por 20
        elementos distintos?




           Se necesitaba un                                      Ese diccionario es el
               diccionario                                          código genético

ARN polímero lineal de 4 nucleótidos diferentes.
   Proteínas: polímeros de 20 aminoácidos

                                                   C.E.M HIPATIA-FUHEM
                                                      Miguel Ángel Madrid
Biología. 2º bachillerato
                                                  Unidad 14. Genética molecular


El código genético




Si solo fuese 1 base
      41 = 4 aa
   INSUFICIENTE




Si solo fuesen 2 bases
       42 = 16 aa                       3 bases
    INSUFICIENTE                       43 = 64 aa
                                      SUFICIENTE


                         C.E.M HIPATIA-FUHEM
                            Miguel Ángel Madrid
Biología. 2º bachillerato
                                                    Unidad 14. Genética molecular


El código genético




                    3 bases
                   43 = 64 aa
           SUFICIENTE, pero sobran
            palabras, lo que significa
             que varios tripletes son
               sinónimos, porque
             codifican (significan) el
               mismo aminoácido


                           C.E.M HIPATIA-FUHEM
                              Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                    Unidad 14. Genética molecular
                                EL CÓDIGO GENÉTICO




       AUG




                  Iniciación      Ej. ¿Qué aminoácido está codificado
                                      por el codón GAC?
UAG   UAA   UGA   Terminación              C.E.M HIPATIA-FUHEM
                                              Miguel Ángel Madrid
Biología. 2º bachillerato
                                              Unidad 14. Genética molecular


El código genético




                                         El código genético
                                              establece una
                                               relación de
                                            correspondencia
                                             entre las bases
                                         nitrogenadas del ARN
                                           y los aminoácidos
                                               que codifica




                     C.E.M HIPATIA-FUHEM
                        Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                  Unidad 14. Genética molecular



      Características del código genético
     UNIVERSAL                                              DEGENERADO
                                                      Existen más codones (64) que aminoácidos (20).
El mismo para todos los organismos, incluso           A excepción de la metionina y el triptófano, un
los virus.                                            aminoácido está codificado por más de un
                                                      codón.
El código ha tenido un solo origen evolutivo.
                                                      Esto es una ventaja ante las mutaciones.
Existen excepciones en las mitocondrias y
algunos protozoos.                                       CARECE DE SOLAPAMIENTO


 SIN IMPERFECCIÓN                                     Los tripletes se disponen de manera
                                                      lineal y continua, sin espacios entre ellos
Cada codón solo codifica a un aminoácido.             y sin compartir bases nitrogenadas


                               Posibilidad de solapamiento
            Met          Gli          Tre       His           Ala         Fen          Ala




                                                      Met           Leu         Leu          Pro
                   Codones de iniciación               C.E.M HIPATIA-FUHEM
                                                                  Solapamiento
                                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                             Unidad 14. Genética molecular


7. La traducción. Biosíntesis de proteínas




     Si te has fijado, el proceso de transcripción es un
     proceso de copia donde no se cambia de idioma,
          pues se pasa del idioma del ADN a ARN




        Sin embargo, en la traducción, que no es un
     proceso de copia, si se cambia de idioma, se pasa
     del idioma de los ácidos nucleicos (A,G,C,U) al de
              las proteínas (20 aminoácidos)



                                    C.E.M HIPATIA-FUHEM
                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                                Unidad 14. Genética molecular

      EL PROCESO DE TRADUCCIÓN
                   ocurre
    RIBOSOMAS                 LA SÍNTESIS DE PROTEÍNAS

                                                            necesita



                                                                                   ENZIMAS Y           ARN DE
RIBOSOMAS        AMINOÁCIDOS                           ARN MENSAJERO                ENERGÍA         TRANSFERENCIA

Formados por       Donde se unen los                                                  Como la
                                                                                                                    Tiene
           SUBUNIDAD                                                                                                 dos
                                                   Donde se une el
                                                                                   AMINOACIL-ARNt                   zonas
            GRANDE
                                                                                     -SINTETASA
                                                                     Por donde
           SUBUNIDAD                                                 se une al
            PEQUEÑA
                                                                                                ANTICODÓN
                                                                                  Donde se
                               Donde se sitúa el




                 SITIO A                                 AMINOÁCIDO                             EXTREMO 3’
                                                                                   une el
 Tienen
   tres          SITIO P                                 POLIPÉPTIDO
 lugares
                 SITIO E                                  ARNt         C.E.M HIPATIA-FUHEM
                                                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                           Unidad 14. Genética molecular

                                                                                              VOLVER
   La traducción. Biosíntesis de proteínas


Veamos primero cómo es un ribosoma                         Cadena
                                                         polipeptídica
                                                         en formación
                                                                           Aminoácido

                                      ARNt
                                                                                    Aminoacil-ARNt
  Subunidad mayor




                                                                                          Anticodón

                                                                             3’
                                             5’

                                                                             ARNm
 Subunidad menor

             ZONA E: liberación: de donde salen los ARNt libres
             ZONA P: peptidil: donde se va formando la cadena polipeptídica
             ZONA A: aminoacil, donde entran los aminoácidos
                                                  C.E.M HIPATIA-FUHEM
                                                     Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                    Unidad 14. Genética molecular

Otra imagen por si no te queda claro…




         ZONA E: liberación: de donde salen los ARNt libres
         ZONA P: peptidil: donde se va formando la cadena polipeptídica
         ZONA A: aminoacil, donde entran los aminoácidos
                                           C.E.M HIPATIA-FUHEM
                                              Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                          Unidad 14. Genética molecular

Recordemos como era un ARNt




                                            (Unión a la                            (Unión al
                                              peptidil-                           ribosoma)
                                          transferasa en
                                            el ribosoma



 NOTA.- EXISTEN TANTOS RNAt como aminoácidos,
 uno para cada uno, en total 20 clases de RNAt        (Unión al codon complementario
                                                      del RNAm en el ribosoma)
                                                 C.E.M HIPATIA-FUHEM
                                                    Miguel Ángel Madrid
Biología. 2º bachillerato
                                                               Unidad 14. Genética molecular


Una imagen más simple del ARNt por si no te quedaba claro…
                              COOH

                          H   C     NH2        Aminoácido
                                                (serina)
                              CH2

                              OH             Aquí en el extremo 3`es donde se une
                                                    el aminoácido al ARNt
                                     Extremo 3`




                                                        ARNt




                                          Anticodón
                          U C G

                                    C.E.M HIPATIA-FUHEM
                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                              Unidad 14. Genética molecular


       La traducción. Biosíntesis de proteínas
                                    Paso previo:
 ESTA FASE PREVIA
                            Activación de los aminoácidos
 TIENE LUGAR EN EL
CITOPLASMA Y NO EN
   LOS RIBOSOMAS                                      ARNt




                                                                                  Aminoacil-ARNt
 Aminoacil-ARNt-sintetasa


          Cada aminoácido se une a una molécula de ARNt
           especifica gracias a la enzima aminoacil-ARNt-
                              sintetasa                                                    CONTINUAR



                                                     C.E.M HIPATIA-FUHEM
                                                        Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                Unidad 14. Genética molecular


La traducción. Síntesis de proteínas


                      Fase de iniciación




                      Fase de elongación




                     Fase de terminación




                                       C.E.M HIPATIA-FUHEM
                                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                            Unidad 14. Genética molecular


       La traducción. Biosíntesis de proteínas

                                            Iniciación de la síntesis




                                   3’
                                        U
                                                        5’
                                              A    C                                              Metionina

                              5’        A
                                             U          3’
                                                  G

     ARNt iniciador
                                                                                    E
                                                                                              A
                                                             GDP
                                                  GTP
                                             3’                                                               3’

5’                                                                    5’


                  Subunidad
                    menor



                                                                   C.E.M HIPATIA-FUHEM
                                                                      Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                                Unidad 14. Genética molecular


         La traducción. Biosíntesis de proteínas

                                   Elongación de la cadena polipeptídica

                 Aminoácido
                                                                          El aminoácido se             Se libera el ARNt que ha
                                        Enlace                          traslada al otro ARNt           cedido el aminoácido
                      Anticodón        peptídico
         ARNt


           P    A                                                        P                                      P
                                                                                                                     A
     E                                                                              A
                                                                    E
                                                                                                       E
                        GDP                                                                GDP
                     GTP                                                                GTP                                  3’

                      3’                              3’                                  3’
                                                                                                  5’
5’                            5’                           5’


         Complementariedad                                                                         El ribosoma se
            entre codón                                                                          trasloca un codon
            y anticodón




                                                                                                             CONTINUAR



                                                                C.E.M HIPATIA-FUHEM
                                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                                          Unidad 14. Genética molecular


         La traducción. Biosíntesis de proteínas

                                           Finalización de la síntesis


                                                                         Polipéptido
                                                                            libre
                             Último ARNt



                 P
                        A
             E



                                                                         3’
                               3’
                                             5’
    5’

                                                        Factor de
  El codón de finalización                              liberación
puede ser UAA, UAG o UGA

                                                                                         Separación del ARNm y las
          El triplete de terminación no es reconocido por ningún
                                                                                          subunidades ribosómicas
          ARNt, y sí por unos factores de liberación de naturaleza
         proteica que se sitúan en el sito A, y hacen que la peptidil
            transferasa separe la cadena polipetídica del ARNt
                                                                C.E.M HIPATIA-FUHEM
                                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                     Unidad 14. Genética molecular

           Polirribosomas en eucariotas
Si el ARN a traducir es lo suficientemente largo puede ser leído por más de un
ribosoma a la vez, formando un polirribosoma o polisoma. La síntesis ocurre a razón
de unos (15 aminoácidos unidos por segundo. Una proteína media (300 aa) se
sintetizaría en unos 15 segundos. Después, el RNAm es destruído ARNm



                                            Proteína en
                                            formación




       Microfotografía electrónica (MET,     Ribosoma
       falso color) de un polirribosoma.
                                            C.E.M HIPATIA-FUHEM
                                               Miguel Ángel Madrid
Biología. 2º bachillerato
                                                             Unidad 14. Genética molecular



                      ¿ LO SABÍAS?
 Determinados antibióticos se utilizan como dardos para
  destruir bacterias, al actuar sobre dianas moleculares
relacionadas con la traducción y bloquear algunas etapas
                 de la síntesis e proteínas

Estreptomicina: trisacárido que se une a la subunidad 30 S
del ribosoma procariota e interfiere en la iniciación de la
síntesis.
Eritromicina: bloque la traslocación del ribosoma e inhibe
la elongación.
Tetraciclina: Se une a la subunidad 30 s del ribosoma y
bloquea el sitio A, impidiendo la entrada del ARNt




                                    C.E.M HIPATIA-FUHEM
                                       Miguel Ángel Madrid
Biología. 2º bachillerato
                                                              Unidad 14. Genética molecular


 1. Estructura del genoma en procariotas y eucariotas
                           GENOMA
               Conjunto de genes de un organismo
NO TODO EL ADN CONTENIDO EN LOS CROMOSOMAS CODIFICA PARA
  PROTEÍNAS, EXISTE GRAN CANTIDAD DE GENES REGULADORES




                                     C.E.M HIPATIA-FUHEM
                                        Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                       Unidad 14. Genética molecular


    1. Estructura del genoma en procariotas y
                  ORGANIZACIÓN DEL GENOMA EN PROCARIOTAS




1 Cromosoma circular (ADNdc)
Presencia de plásmidos (número variable
según tipo de bacteria). Contienen genes no
esenciales para el crecimiento y la
reproducción de la célula. Replicación
independiente
1 200 – 12 000 genes
Genes continuos (toda la información
contenida en los genes se traduce en
proteínas)




                                              C.E.M HIPATIA-FUHEM
                                                 Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                       Unidad 14. Genética molecular


    1. Estructura del genoma en procariotas y
                       ORGANIZACIÓN DEL GENOMA EN VIRUS

1 Sola molécula lineal o circular de ADN o
ARN




                                              C.E.M HIPATIA-FUHEM
                                                 Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                    Unidad 14. Genética molecular


  1. Estructura del genoma en procariotas y
                 ORGANIZACIÓN DEL GENOMA EN EUCARIOTAS

La mayor parte localizado en el núcleo.
(repartido en los diferentes cromosomas
lineales)
Una pequeña parte en mitocondrias y
cloroplastos (vegetales): ADNdc (similar
procariotas)



Humanos: genoma nuclear:
    25 000 genes que codifican proteínas
    (exones) y los diversos tipos ARN (1,5 %
    del total); Genoma mitocondrial: 37
    genes
    ADN no codificante (98,5 %)



                                           C.E.M HIPATIA-FUHEM
                                              Miguel Ángel Madrid
Biología. 2º bachillerato
                                                Unidad 14. Genética molecular




ADN NO CODIFICANTE

             ADN repetitivo o satélite: situados en los
             extremos de los cromosomas y centrómeros.
             No se transcriben nunca

             ADN regulador (promotores…: Mucho de él
             hasta la fecha de función desconocida

            Intrones: situados en los extremos de los
            cromosomas y centrómeros. No se
            transcriben nunca




                       C.E.M HIPATIA-FUHEM
                          Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                          Unidad 14. Genética molecular



8. Genoma en organismos eucariontes
 No existe relación directa entre la complejidad del organismo y la cantidad de
 ADN.
 La mayor parte del ADN no codifica proteínas: ADN no codificante

 Una parte del genoma se encuentra en los                          ADN repetitivo satélite
 cloroplastos y las mitocondrias.
                                                                   ADN repetitivo intermedio

                                                                   ADN de intrones


                     ESTRUCTURA DE UN GEN EN EUCARIONTES




                               Gen
   Gen
   regulador

                                                                                  Intrones
                                 Operador            Exones: secuencias
                                                     codificantes
                            Promotor
                                                C.E.M HIPATIA-FUHEM
                                                   Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                      Unidad 14. Genética molecular



     EL PROYECTO GENOMA HUMANO
1955. Joe Hin: establece en 46 el número de cromosomas humanos.

1977. Se inicia secuenciación del ADN

1981. Se completa la secuenciación del genoma mitocondrial
humano

1995. Se completa la secuenciación del genoma de la bacteria
Haemophilus influenzae.

1996. Secuenciación del genoma del primer eucariota:
Saccharomyces cerevisiae

2000. Se completa la secuenciación del genoma del primer
organismo pluricelular, el gusano Caenorhabditis elegans.




                                             C.E.M HIPATIA-FUHEM
                                                Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                   Unidad 14. Genética molecular



EL PROYECTO GENOMA HUMANO
2000. Secuenciación del genoma de Drosophila melanogaster

2000. Secuenciación del genoma de la planta Arabidopsis thaliana


2001. Publicación del borrador de la secuencia completa del
genoma humano

2003. (Coincidiendo con el 50º aniversario del descubrimiento de la
estructura del ADN) Se completa la secuenciación del genoma
humano.




                                          C.E.M HIPATIA-FUHEM
                                             Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                  Unidad 14. Genética molecular



EL PROYECTO GENOMA HUMANO
GENÓMICA: Estudia el genoma de los diferentes organismos


1988: Congreso de los EEUU. Autorización de financiación. Creación
del consorcio público, dirigido por J.D. Watson. Colaboración con
Reino Unido, Francia, Alemania, China y Japón. Nacimiento del PGH.


1996. Craig Venter solicitó la patente de uno de los genes
secuenciados. Abandono del Consorcio público. Creación de Celera
Genomics (privado)

26 junio 2000. El Consorcio Público y Celera Genomics dieron a
conocer los borradores del PGH




                                         C.E.M HIPATIA-FUHEM
                                            Miguel Ángel Madrid
Biología. 2º bachillerato
                                                                  Unidad 14. Genética molecular




El 26 de junio de 2000 dos prestigiosas revistas científicas dieron a
conocer las dos versiones del borrador del PGH




                                         C.E.M HIPATIA-FUHEM
                                            Miguel Ángel Madrid
Ud.14. genética molecular
Ud.14. genética molecular
Ud.14. genética molecular
Ud.14. genética molecular
Ud.14. genética molecular

Más contenido relacionado

La actualidad más candente

Mitocondria
MitocondriaMitocondria
Mitosis y Meiosis
Mitosis y MeiosisMitosis y Meiosis
Mitosis y Meiosis
jent46
 
I10 mutaciones pdf1
I10 mutaciones pdf1I10 mutaciones pdf1
I10 mutaciones pdf1
biogeo
 
Transcripción y maduración del ARN
Transcripción y maduración del ARNTranscripción y maduración del ARN
Transcripción y maduración del ARN
Profe Ariel
 
Ciclo celular
Ciclo celularCiclo celular
Tema 17
Tema 17Tema 17
Tema 17
divina222
 
Mutaciones 2º bachillerato
Mutaciones 2º bachilleratoMutaciones 2º bachillerato
Mutaciones 2º bachillerato
mluisajuarez
 
Nucleo celular
Nucleo celularNucleo celular
Nucleo celular
Jairo Rivera
 
Adn
AdnAdn
C:\Users\Departamento B\Desktop\Mutaciones CromosóMicas Daniel V Y Ana
C:\Users\Departamento B\Desktop\Mutaciones CromosóMicas  Daniel V Y AnaC:\Users\Departamento B\Desktop\Mutaciones CromosóMicas  Daniel V Y Ana
C:\Users\Departamento B\Desktop\Mutaciones CromosóMicas Daniel V Y Ana
cipresdecartagena
 
3.3 Genetica
3.3 Genetica3.3 Genetica
3.3 Genetica
Jorge Arizpe Dodero
 
12 recombinación bacterian apr042
12 recombinación bacterian apr04212 recombinación bacterian apr042
12 recombinación bacterian apr042
Karla González
 
Transcripcion
TranscripcionTranscripcion
Transcripcion
Marlene Martinez
 
El ciclo celular
El ciclo celularEl ciclo celular
El ciclo celular
Belén Ruiz González
 
Recombinacion bacteriana
Recombinacion bacterianaRecombinacion bacteriana
Recombinacion bacteriana
Yamilee Farro
 
Erwin. ciclo celular
Erwin. ciclo celularErwin. ciclo celular
Erwin. ciclo celular
Erwin Chiquete, MD, PhD
 
Replicación del adn
Replicación del adnReplicación del adn
Replicación del adn
bbergado
 
Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...
Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...
Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...
Dian Alex Gonzalez
 
Biología molecular
Biología molecularBiología molecular
Biología molecular
Karla González
 
Mitosis y meiosis
Mitosis y meiosisMitosis y meiosis
Mitosis y meiosis
Carlos Mohr
 

La actualidad más candente (20)

Mitocondria
MitocondriaMitocondria
Mitocondria
 
Mitosis y Meiosis
Mitosis y MeiosisMitosis y Meiosis
Mitosis y Meiosis
 
I10 mutaciones pdf1
I10 mutaciones pdf1I10 mutaciones pdf1
I10 mutaciones pdf1
 
Transcripción y maduración del ARN
Transcripción y maduración del ARNTranscripción y maduración del ARN
Transcripción y maduración del ARN
 
Ciclo celular
Ciclo celularCiclo celular
Ciclo celular
 
Tema 17
Tema 17Tema 17
Tema 17
 
Mutaciones 2º bachillerato
Mutaciones 2º bachilleratoMutaciones 2º bachillerato
Mutaciones 2º bachillerato
 
Nucleo celular
Nucleo celularNucleo celular
Nucleo celular
 
Adn
AdnAdn
Adn
 
C:\Users\Departamento B\Desktop\Mutaciones CromosóMicas Daniel V Y Ana
C:\Users\Departamento B\Desktop\Mutaciones CromosóMicas  Daniel V Y AnaC:\Users\Departamento B\Desktop\Mutaciones CromosóMicas  Daniel V Y Ana
C:\Users\Departamento B\Desktop\Mutaciones CromosóMicas Daniel V Y Ana
 
3.3 Genetica
3.3 Genetica3.3 Genetica
3.3 Genetica
 
12 recombinación bacterian apr042
12 recombinación bacterian apr04212 recombinación bacterian apr042
12 recombinación bacterian apr042
 
Transcripcion
TranscripcionTranscripcion
Transcripcion
 
El ciclo celular
El ciclo celularEl ciclo celular
El ciclo celular
 
Recombinacion bacteriana
Recombinacion bacterianaRecombinacion bacteriana
Recombinacion bacteriana
 
Erwin. ciclo celular
Erwin. ciclo celularErwin. ciclo celular
Erwin. ciclo celular
 
Replicación del adn
Replicación del adnReplicación del adn
Replicación del adn
 
Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...
Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...
Tema 50 Bases moleculares de la transcripción; estructura y función del ARNm,...
 
Biología molecular
Biología molecularBiología molecular
Biología molecular
 
Mitosis y meiosis
Mitosis y meiosisMitosis y meiosis
Mitosis y meiosis
 

Destacado

Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
Julio Sanchez
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
sanchezguerreronuche
 
Ejercicios Genetica Molecular
Ejercicios Genetica MolecularEjercicios Genetica Molecular
Ejercicios Genetica Molecular
VICTOR M. VITORIA
 
Ud.14. genética molecular nuevo
Ud.14. genética molecular nuevoUd.14. genética molecular nuevo
Ud.14. genética molecular nuevo
biologiahipatia
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
mnmunaiz
 
Ud.11. anabolismo
Ud.11. anabolismoUd.11. anabolismo
Ud.11. anabolismo
biologiahipatia
 
Apuntes de genética molecular
Apuntes de genética molecularApuntes de genética molecular
Apuntes de genética molecular
biologiahipatia
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
Belén Ruiz González
 
Ud.10. metabolismo i
Ud.10. metabolismo iUd.10. metabolismo i
Ud.10. metabolismo i
biologiahipatia
 
Ud.16. microbiología
Ud.16. microbiologíaUd.16. microbiología
Ud.16. microbiología
biologiahipatia
 
4ºESO: Genetica Molecular
4ºESO: Genetica Molecular4ºESO: Genetica Molecular
4ºESO: Genetica Molecular
Alberto Díaz
 
4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillana4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillana
RosiJimenezBarrientos
 
Ud.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevoUd.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevo
biologiahipatia
 
Diapositivas genetica
Diapositivas geneticaDiapositivas genetica
Diapositivas genetica
UNIVERSIDAD PRIVADA CÉSAR VALLEJO
 
Ud.8. citología ii. citoplasma y org. no membranosos
Ud.8. citología ii. citoplasma y  org. no membranososUd.8. citología ii. citoplasma y  org. no membranosos
Ud.8. citología ii. citoplasma y org. no membranosos
biologiahipatia
 
Ud.4.. los lípidos
Ud.4.. los lípidosUd.4.. los lípidos
Ud.4.. los lípidos
biologiahipatia
 
Historia Genetica Molecular
Historia Genetica MolecularHistoria Genetica Molecular
Historia Genetica Molecular
Secretaria de educaciñon Distrital
 
Ud.2. bioelementos y agua
Ud.2. bioelementos y aguaUd.2. bioelementos y agua
Ud.2. bioelementos y agua
biologiahipatia
 
CATABOLISMO. 2º BACHILLER
CATABOLISMO. 2º BACHILLERCATABOLISMO. 2º BACHILLER
CATABOLISMO. 2º BACHILLER
Juan Carlos Bofill
 
Unidad 5
Unidad 5Unidad 5
Unidad 5
biologiahipatia
 

Destacado (20)

Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
 
Ejercicios Genetica Molecular
Ejercicios Genetica MolecularEjercicios Genetica Molecular
Ejercicios Genetica Molecular
 
Ud.14. genética molecular nuevo
Ud.14. genética molecular nuevoUd.14. genética molecular nuevo
Ud.14. genética molecular nuevo
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
 
Ud.11. anabolismo
Ud.11. anabolismoUd.11. anabolismo
Ud.11. anabolismo
 
Apuntes de genética molecular
Apuntes de genética molecularApuntes de genética molecular
Apuntes de genética molecular
 
Genetica molecular
Genetica molecularGenetica molecular
Genetica molecular
 
Ud.10. metabolismo i
Ud.10. metabolismo iUd.10. metabolismo i
Ud.10. metabolismo i
 
Ud.16. microbiología
Ud.16. microbiologíaUd.16. microbiología
Ud.16. microbiología
 
4ºESO: Genetica Molecular
4ºESO: Genetica Molecular4ºESO: Genetica Molecular
4ºESO: Genetica Molecular
 
4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillana4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillana
 
Ud.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevoUd.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevo
 
Diapositivas genetica
Diapositivas geneticaDiapositivas genetica
Diapositivas genetica
 
Ud.8. citología ii. citoplasma y org. no membranosos
Ud.8. citología ii. citoplasma y  org. no membranososUd.8. citología ii. citoplasma y  org. no membranosos
Ud.8. citología ii. citoplasma y org. no membranosos
 
Ud.4.. los lípidos
Ud.4.. los lípidosUd.4.. los lípidos
Ud.4.. los lípidos
 
Historia Genetica Molecular
Historia Genetica MolecularHistoria Genetica Molecular
Historia Genetica Molecular
 
Ud.2. bioelementos y agua
Ud.2. bioelementos y aguaUd.2. bioelementos y agua
Ud.2. bioelementos y agua
 
CATABOLISMO. 2º BACHILLER
CATABOLISMO. 2º BACHILLERCATABOLISMO. 2º BACHILLER
CATABOLISMO. 2º BACHILLER
 
Unidad 5
Unidad 5Unidad 5
Unidad 5
 

Similar a Ud.14. genética molecular

Ud.7. citología i
Ud.7. citología iUd.7. citología i
Ud.7. citología i
biologiahipatia
 
Ud.7. citología i
Ud.7. citología iUd.7. citología i
Ud.7. citología i
biologiahipatia
 
Revisión del Proyecto proteoma humano
Revisión del Proyecto proteoma humanoRevisión del Proyecto proteoma humano
Revisión del Proyecto proteoma humano
Karina Morrison
 
Tema 15. mutaciones
Tema 15. mutacionesTema 15. mutaciones
Tema 15. mutaciones
biologiahipatia
 
Bioenergética y mente trascendente
Bioenergética y mente trascendenteBioenergética y mente trascendente
Bioenergética y mente trascendente
CLAUDIO MEZA
 
Clases biomol (1)
Clases biomol (1)Clases biomol (1)
Clases biomol (1)
biomolslides
 
Micologia Y Mapas Conceptuales
Micologia Y Mapas ConceptualesMicologia Y Mapas Conceptuales
Micologia Y Mapas Conceptuales
Francisco Javier León
 
Trangénicos y tecnologia del d na recombinante
Trangénicos y tecnologia del d na recombinanteTrangénicos y tecnologia del d na recombinante
Trangénicos y tecnologia del d na recombinante
Marión Alejandra
 

Similar a Ud.14. genética molecular (8)

Ud.7. citología i
Ud.7. citología iUd.7. citología i
Ud.7. citología i
 
Ud.7. citología i
Ud.7. citología iUd.7. citología i
Ud.7. citología i
 
Revisión del Proyecto proteoma humano
Revisión del Proyecto proteoma humanoRevisión del Proyecto proteoma humano
Revisión del Proyecto proteoma humano
 
Tema 15. mutaciones
Tema 15. mutacionesTema 15. mutaciones
Tema 15. mutaciones
 
Bioenergética y mente trascendente
Bioenergética y mente trascendenteBioenergética y mente trascendente
Bioenergética y mente trascendente
 
Clases biomol (1)
Clases biomol (1)Clases biomol (1)
Clases biomol (1)
 
Micologia Y Mapas Conceptuales
Micologia Y Mapas ConceptualesMicologia Y Mapas Conceptuales
Micologia Y Mapas Conceptuales
 
Trangénicos y tecnologia del d na recombinante
Trangénicos y tecnologia del d na recombinanteTrangénicos y tecnologia del d na recombinante
Trangénicos y tecnologia del d na recombinante
 

Más de biologiahipatia

Genética mendeliana
Genética mendelianaGenética mendeliana
Genética mendeliana
biologiahipatia
 
Unidad 10. metabolismo I. Catabolismo
Unidad 10. metabolismo I. CatabolismoUnidad 10. metabolismo I. Catabolismo
Unidad 10. metabolismo I. Catabolismo
biologiahipatia
 
Unidad 5 (2). Las enzimas
Unidad 5 (2). Las enzimasUnidad 5 (2). Las enzimas
Unidad 5 (2). Las enzimas
biologiahipatia
 
Ud. 20. ingenieria genética
Ud. 20. ingenieria genéticaUd. 20. ingenieria genética
Ud. 20. ingenieria genética
biologiahipatia
 
Virus
VirusVirus
In. genética hipatia
In. genética hipatiaIn. genética hipatia
In. genética hipatia
biologiahipatia
 
Ud. 20. ingenieria genética
Ud. 20. ingenieria genéticaUd. 20. ingenieria genética
Ud. 20. ingenieria genética
biologiahipatia
 
Ud.16. microbiología
Ud.16. microbiologíaUd.16. microbiología
Ud.16. microbiología
biologiahipatia
 
Unidad de microbiología
Unidad de microbiologíaUnidad de microbiología
Unidad de microbiología
biologiahipatia
 
T15. mutaciones hipatia
T15. mutaciones hipatiaT15. mutaciones hipatia
T15. mutaciones hipatia
biologiahipatia
 
Tema 15. mutaciones
Tema 15. mutacionesTema 15. mutaciones
Tema 15. mutaciones
biologiahipatia
 
Inmunologia ii
Inmunologia iiInmunologia ii
Inmunologia ii
biologiahipatia
 
Inmunología i
Inmunología iInmunología i
Inmunología i
biologiahipatia
 
Ud.18. inmunología 1
Ud.18. inmunología 1Ud.18. inmunología 1
Ud.18. inmunología 1
biologiahipatia
 
T15. mutaciones hipatia
T15. mutaciones hipatiaT15. mutaciones hipatia
T15. mutaciones hipatia
biologiahipatia
 
Ud.15. mutaciones
Ud.15. mutacionesUd.15. mutaciones
Ud.15. mutaciones
biologiahipatia
 
Unidad genética hipatia
Unidad genética  hipatiaUnidad genética  hipatia
Unidad genética hipatia
biologiahipatia
 
Unidad 11. metabolismo ii. anabolismo copia
Unidad 11. metabolismo ii. anabolismo   copiaUnidad 11. metabolismo ii. anabolismo   copia
Unidad 11. metabolismo ii. anabolismo copia
biologiahipatia
 
Unidad reproducción celular
Unidad reproducción celularUnidad reproducción celular
Unidad reproducción celular
biologiahipatia
 

Más de biologiahipatia (19)

Genética mendeliana
Genética mendelianaGenética mendeliana
Genética mendeliana
 
Unidad 10. metabolismo I. Catabolismo
Unidad 10. metabolismo I. CatabolismoUnidad 10. metabolismo I. Catabolismo
Unidad 10. metabolismo I. Catabolismo
 
Unidad 5 (2). Las enzimas
Unidad 5 (2). Las enzimasUnidad 5 (2). Las enzimas
Unidad 5 (2). Las enzimas
 
Ud. 20. ingenieria genética
Ud. 20. ingenieria genéticaUd. 20. ingenieria genética
Ud. 20. ingenieria genética
 
Virus
VirusVirus
Virus
 
In. genética hipatia
In. genética hipatiaIn. genética hipatia
In. genética hipatia
 
Ud. 20. ingenieria genética
Ud. 20. ingenieria genéticaUd. 20. ingenieria genética
Ud. 20. ingenieria genética
 
Ud.16. microbiología
Ud.16. microbiologíaUd.16. microbiología
Ud.16. microbiología
 
Unidad de microbiología
Unidad de microbiologíaUnidad de microbiología
Unidad de microbiología
 
T15. mutaciones hipatia
T15. mutaciones hipatiaT15. mutaciones hipatia
T15. mutaciones hipatia
 
Tema 15. mutaciones
Tema 15. mutacionesTema 15. mutaciones
Tema 15. mutaciones
 
Inmunologia ii
Inmunologia iiInmunologia ii
Inmunologia ii
 
Inmunología i
Inmunología iInmunología i
Inmunología i
 
Ud.18. inmunología 1
Ud.18. inmunología 1Ud.18. inmunología 1
Ud.18. inmunología 1
 
T15. mutaciones hipatia
T15. mutaciones hipatiaT15. mutaciones hipatia
T15. mutaciones hipatia
 
Ud.15. mutaciones
Ud.15. mutacionesUd.15. mutaciones
Ud.15. mutaciones
 
Unidad genética hipatia
Unidad genética  hipatiaUnidad genética  hipatia
Unidad genética hipatia
 
Unidad 11. metabolismo ii. anabolismo copia
Unidad 11. metabolismo ii. anabolismo   copiaUnidad 11. metabolismo ii. anabolismo   copia
Unidad 11. metabolismo ii. anabolismo copia
 
Unidad reproducción celular
Unidad reproducción celularUnidad reproducción celular
Unidad reproducción celular
 

Ud.14. genética molecular

  • 1. Biología. 2º bachillerato Unidad 14. Genética molecular Genética molecular 14 C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 2. Biología. 2º bachillerato Unidad 14. Genética molecular Genética molecular 14 1. El ADN como depositario de la información genética. 2. Concepto molecular de gen. 3. Replicación del ADN 1. Etapas de la replicación 2. Diferencias entre el proceso replicativo en procariotas y eucariotas. 4. Expresión de la información genética: dogma central de la biología molecular. 5. Transcripción. 6. El código genético 7. Traducción. 8. El genoma de procariotas y eucariotas 9. El proyecto genoma humano. 10. Concepto de proteoma y proteómica. Aplicaciones en biociencias. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 3. Biología. 2º bachillerato Unidad 14. Genética molecular El ADN como portador de información genética Interfase Análisis de los Cromosomas. (ADN + proteínas) “Collar de perlas” Fibra de ADN unida a proteínas C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 4. Biología. 2º bachillerato Unidad 14. Genética molecular El ADN como portador de información genética Interfase ¿Qué molécula posee la información genética? “Collar de perlas” Fibra de ADN unida a proteínas C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 5. Biología. 2º bachillerato Unidad 14. Genética molecular El ADN como portador de información genética Interfase ¿Las proteínas en su secuencia de aminoácidos? “Collar de perlas” Fibra de ADN unida a proteínas C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 6. Biología. 2º bachillerato Unidad 14. Genética molecular El ADN como portador de información genética Interfase ¿El ADN en su secuencia de nucleótidos? “Collar de perlas” Fibra de ADN unida a proteínas C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 7. Biología. 2º bachillerato Unidad 14. Genética molecular 1. ADN COMO MATERIAL GENÉTICO Primeras evidencias: Las proteínas. El ADN tiene una estructura demasiado sencilla. Las proteínas son más complejas y tienen funciones catalíticas. ¿Quién es el depositario de la 1928. Experimento de información Griffith (buscando vacuna contra la neumonía provocada por genética? Streptococcus pneumoniae) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 8. Biología. 2º bachillerato Unidad 14. Genética molecular 1. ADN COMO MATERIAL GENÉTICO Streptococcus pneumoniae (presenta dos variantes o cepas distintas) Cepa S: (del inglés smooth, liso). Poseen cápsula gelatinosa de polisacáridos que impide que el sistema inmunológico del ratón las ataque. Provocan la enfermedad Cepa R: (del inglés rough, rugoso). Sin cápsula gelatinosa de polisacáridos. Forman colonias rugosas. No provocan la enfermedad ya que el sistema inmune del ratón las ataca rápidamente. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 9. Biología. 2º bachillerato Unidad 14. Genética molecular Experiencias de F. Griffith Bacterias S Bacteria con cápsula muertas por (virulenta) calor Tipo S 1 De los ratones muertos se extraen bacterias 2 De los ratones inoculados no se extraen vivas de la cepa S bacterias vivas Bacterias R Bacteria sin cápsula vivas Bacterias S (no virulenta) muertas por Tipo R calor 3 De los ratones inoculados no se extraen 4 De los ratones muertos se extraen bacterias bacterias vivas, pues no crecen en el animal. vivas de la cepa S C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 10. Biología. 2º bachillerato Unidad 14. Genética molecular CONCLUSIÓN. En las bacterias muertas (cepa S) existía algo, llamado PRINCIPIO TRANSFORMANTE que era captado por las bacterias vivas no virulentas (cepa R) y transformaba sus caracteres hereditarios convirtiéndose en virulentas. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 11. Biología. 2º bachillerato Unidad 14. Genética molecular EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN UN MEDIO CON DNA PURIFICADO PROCEDENTE DE BACTERIAS S) Cultivaron las bacterias en tubos de ensayo (in vitro) Fueron destruyendo, uno por uno, todos los componentes bioquímicos de las células S para evitar la transformación e identificar el responsable. Degradaron polisacáridos de la pared y al inyectarlas en el ratón la transformación se producía. A continuación degradaron proteínas y la transformación se producía. Así sucesivamente hasta que atacar al ADN de las bacterias. La transformación no se producía C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 12. Biología. 2º bachillerato Unidad 14. Genética molecular EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN UN MEDIO CON DNA PURIFICADO PROCEDENTE DE BACTERIAS S) La molécula de ADN contiene la información necesaria para convertir las bacterias R no virulentas en bacterias S virulentas. Demostraron además, del papel biológico del ADN, que las bacterias pueden intercambiar material genético (transformación) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 13. Biología. 2º bachillerato Unidad 14. Genética molecular 1. Se inoculan ratones con cepas S, contraen la enfermedad y mueren. De ellos se extraen bacterias S vivas. 2. Los ratones inoculados con cepas R no contraen la enfermedad. De ellos se extraen bacterias vivas pues no crecen en el animal 3. Se inoculan ratones con cepas S, muertas por el calor. No contraen la enfermedad. De ellos no se extraen bacterias vivas. 4. Los ratones inoculados con cepas S, muertas por el calor y, simultáneamente, cepas R vivas contraen la enfermedad y mueren. De ellos se extraen bacterias vivas S. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 14. Biología. 2º bachillerato Unidad 14. Genética molecular En 1944 Avery y colaboradores demostraron que el principio transformante era el ADN, que determinaba o no la producción de la cápsula bacteriana. CONCLUSIÓN El ADN era el material genético en bacterias. En 1952 se demostró que era el material genético en el resto de organismos C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 15. Biología. 2º bachillerato Unidad 14. Genética molecular El concepto molecular de gen Genética clásica Un gen contiene información para un determinado carácter El concepto de gen ha ido cambiando según aumentaban los conocimientos sobre genética molecular. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 16. Biología. 2º bachillerato Unidad 14. Genética molecular 2. CONCEPTO MOLECULAR DE GEN Experimento de G. Beadle y E. Tatum con el hongo Neurospora crassa Sólo precisa una fuente de carbono, biotina y ciertos minerales. Sometieron al hongo a ciertas dosis de rayos X. Obtuvieron mutantes incapaces de sintetizar determinados aminoácidos, por lo que solo sobrevivían al añadir al medio los aminoácidos. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 17. Biología. 2º bachillerato Unidad 14. Genética molecular 2. CONCEPTO MOLECULAR DE GEN Experimento de G. Beadle y E. Tatum con el hongo Neurospora crassa Descubrieron : A cada mutante le faltaba el enzima específico que catalizaba algún paso de la síntesis del aminoácido al que habían alterado. Los mutantes se diferenciaban de la cepa salvaje en un solo gen. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 18. Biología. 2º bachillerato Unidad 14. Genética molecular 2. CONCEPTO MOLECULAR DE GEN Experimento de G. Beadle y E. Tatum con el hongo Neurospora crassa Descubrieron : Si se altera el gen, no se fabrica la enzima correspondiente y la ruta se bloquea. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 19. Biología. 2º bachillerato Unidad 14. Genética molecular 2. CONCEPTO MOLECULAR DE GEN 1 gen 1 enzima 1 gen 1 proteína 1 gen 1 cadena polipeptídica C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 20. Biología. 2º bachillerato Unidad 14. Genética molecular 2. CONCEPTO MOLECULAR DE GEN Desde el punto de vista funcional: Fragmento del ADN que lleva la información para fabricar una cadena polipeptídica de una proteína, necesaria para que se exprese un carácter en un individuo C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 21. Biología. 2º bachillerato Unidad 14. Genética molecular REPASEMOS ALGUNOS CONCEPTOS C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 22. Biología. 2º bachillerato REPASEMOS ALGUNOS CONCEPTOS Unidad 14. Genética molecular El ciclo celular Fase permanente en células que no entran nunca en mitosis. Síntesis de proteínas y Estado de quiescencia. aumento del tamaño celular. Fase G1 Fase G0 0 1 Replicación del ADN y síntesis de histonas. Citocinesis División del Fase S citoplasma Interfase Fase de mitosis División celular Transcripción y traducción de genes que Fase G2 codifican proteínas necesarias para la 2 división. Duplicación de los centriolos C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 23. Biología. 2º bachillerato Unidad 14. Genética molecular 3. REPLICACIÓN (DUPLICACIÓN) DEL ADN Capacidad de hacer copias de si mismo. Esto permite transmitir la información genética a las células hijas. La replicación permite a las células hijas contener el mismo ADN que la célula madre. Las células duplican su ADN antes de la división celular (en eucariotas en la fase S de la interfase). C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 24. Biología. 2º bachillerato Unidad 14. Genética molecular 3. REPLICACIÓN DEL ADN ¿Cómo se produce la duplicación? 3 hipótesis Hipótesis Hipótesis Hipótesis semiconservativa conservativa dispersiva Cadena antigua Cadena nueva C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 25. Biología. 2º bachillerato Unidad 14. Genética molecular TEORÍA CONSERVATIVA Una doble hélice conserva las dos cadenas originales, y la otra está formada por las dos cadenas de nueva C.E.M HIPATIA-FUHEM síntesis. Miguel Ángel Madrid
  • 26. Biología. 2º bachillerato Unidad 14. Genética molecular TEORÍA DISPERSIVA ADN copia Cada una de las dos cadenas hijas contiene fragmentos de la cadena original y fragmentos de la nueva C.E.M HIPATIA-FUHEM síntesis Miguel Ángel Madrid
  • 27. Biología. 2º bachillerato Unidad 14. Genética molecular TEORÍA SEMICONSERVATIVA Cada doble hélice conserva una hélice de las dos originales y sintetiza una nueva (Watson y Crick) HIPATIA-FUHEM C.E.M Miguel Ángel Madrid
  • 28. Biología. 2º bachillerato Unidad 14. Genética molecular La duplicación del ADN Experimento de Meselson y Stahl (1958) Medio N15 Medio N14 ADN N14 ADN N14-15 ADN N15 ADN inicial ADN después ADN después ADN después de la 1.ª de la 2.ª de la 3.ª duplicación duplicación duplicación 1- Cultivaron bacterias en un medio con N-15 (Las bases nitrogenadas incorporaron el isótopo). 2- Transfirieron las bacterias a un medio con N-14. El ADN obtenido tenia la misma proporción N14, N15. Cada bacteria había heredado la mitad de ADN de su progenitora y la otra mitad la sintetizaba de los componentes del medio. C.E.M HIPATIA-FUHEM 3- Aparecían ADN hibrido (N14-N15) y ADN solo con N14 Miguel Ángel Madrid
  • 29. Biología. 2º bachillerato Unidad 14. Genética molecular 3. La duplicación del ADN Núcleo (eucariotas) Nucleoide (procariotas) ¿Dónde ocurre? Matriz (mitocondrias) Estroma (cloroplastos) FASE S DEL ¿Cuándo ocurre? CICLO CELULAR (en interfase) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 30. Biología. 2º bachillerato Unidad 14. Genética molecular 3. La duplicación del ADN Principales características de la replicación  Es semiconservativa. Se produce por adición de mononucleótidos en sentido 5´ 3`  Es bidireccional. Se forman dos horquillas de replicación que avanzan en sentidos opuestos.  En virus y bacterias hay un único punto de inicio, mientras que en eucariotas hay varios. Es semidiscontinua. En una cadena (llamada conductora) se sintetizan fragmentos bastante grandes de forma continua, mientras que en la otra (llamada retardada) la síntesis es discontinua, es decir, se sintetizan pequeños fragmentos de forma separada y después se unen (los llamados fragmentos de Okazaki). Ello se debe a que las dos cadenas son antiparalelas y a que la síntesis es siempre en sentido 5´  3´ C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 31. Biología. 2º bachillerato Unidad 14. Genética molecular 3. La duplicación del ADN ¿Qué necesitamos? - ADN molde - Nucleótidos: ATP, GTP,CTP,TTP - Proteínas SSB (impiden que se enrede el ADN) - Enzimas: - Helicasas: rompen puentes de H entre las dos cadenas complementarias - Topoisomeras (girasas). Desenrollan ADN, evitan tensiones - ADN ligasas (unen fragmentos ADN mediante enlaces fosfodiéster). Así sellan el hueco entre dos fragmentos de Okazaki. - ARN polimerasas (también llamadas primasas). Sintetizan fragmentos de ARN (llamados ARN cebador) usando como molde ADN y actúa como iniciador de la síntesis de ADN. - Nucleasas. Rompen enlaces fosfodiéster entre nucleótidos, escinden ARN cebador y reparan lesiones en el ADN. - ADN polimerasas. Catalizan la formación de enlaces fosfodiéster entre nucleótidos. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 32. Biología. 2º bachillerato Unidad 14. Genética molecular 3. La duplicación del ADN Sintetiza el ARN ARN POLIMERASA cebador usando (primasa) como molde el ADN ARN polimerasa ARN cebador ADN (40-50 nucleótidos) 3` 5` ADN molde ADN polimerasa C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 33. Biología. 2º bachillerato Unidad 14. Genética molecular 3. La duplicación del ADN Función polimerasa Precisa ARN cebador (primer o iniciador) y la cadena molde de ADN Lee en sentido 3´ 5´ ADN POLIMERASA Función exonucleasa Detecta errores, elimina nucleótidos cuyas bases están mal emparentadas y ARN cebador ARN polimerasa ARN cebador ADN (40-50 nucleótidos) 5` 3` 3` 5` ADN molde ADN polimerasa C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 34. Biología. 2º bachillerato Unidad 14. Genética molecular En procariotas distinguimos: ADN POLIMERASA I (Retira fragmentos ARN cebador: exonucleasa Sintetiza ADN en los huecos: polimerasa Es correctora, ya que repara errores de la síntesis de ADN) ADN POLIMERASA II (Interviene en procesos de reparación del ADN Tiene actividad polimerasa en sentido 5` 3´y exonucleasa en 3´ 5´) ADN POLIMERASA III (Sintetiza ADN en sentido 5´ 3´: polimerasa) RECUERDA La ADN polimerasa: Precisa ARN cebador Lee en sentido 3´ 5 Sintetiza en sentido 5´ 3´ C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 35. Biología. 2º bachillerato Unidad 14. Genética molecular RECUERDA La actividad polimerasa consiste en catalizar la unión de nucleótidos a la cadena de ácido nucleico que se está sintetizando. La actividad exonucleasa consiste en escindir nucleótidos de los extremos de los ácidos nucleicos. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 36. Biología. 2º bachillerato Unidad 14. Genética molecular Fases de la replicación: elongación Junto a las enzimas que participan en la iniciación, en esta fase actúan las ADN polimerasas. EXONUCLEASA POLIMERIZACIÓN POLIMERASA INICIACIÓN dirección función dirección función elimina 5’→ 3’ I cebador 5’→ 3’ síntesis no 3’→ 5’ reparación II 3’→ 5’ reparación 5’→ 3’ síntesis no III 3’→ 5’ reparación 5’→ 3’ síntesis no C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 37. Biología. 2º bachillerato Unidad 14. Genética molecular 3. La duplicación del ADN: Mecanismo de la duplicación en procariotas Fase de iniciación Fase de elongación Fase de terminación C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 38. Biología. 2º bachillerato Unidad 14. Genética molecular Fases de la replicación: iniciación Consiste en el desenrollamiento y apertura de la doble hélice de ADN Ori C (abundan secuencias ricas en GATC) La replicación empieza en un punto del ADN donde abundan las secuencias de bases GATC (Ori C) En él se separan las dos cadenas de ADN por acción de las enzimas. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 39. Biología. 2º bachillerato Unidad 14. Genética molecular Fases de la replicación: iniciación Consiste en el desenrollamiento y apertura de la doble hélice de ADN Ori C (abundan secuencias ricas en GATC) Evitan las tensiones debidas a un superenrrollamiento Girasa Topoisomerasa Proteínas específicas Proteínas SSB Impiden que el ADN se vuelva a enrollar Helicasa Las proteínas específicas se unen al punto La helicasa rompe los de iniciación enlaces de hidrógeno entre las bases y abre la doble hélice C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 40. Biología. 2º bachillerato Unidad 14. Genética molecular Fases de la replicación: iniciación Resultado: se forma una burbuja de replicación en la que hay dos zonas en forma de “Y”, llamadas horquillas de replicación, donde se sintetizan las nuevas cadenas de ADN C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 41. Biología. 2º bachillerato Unidad 14. Genética molecular RECUERDA La ADN polimerasa III: Precisa ARN cebador Lee en sentido 3´ 5 Sintetiza en sentido 5´ 3´ Burbuja de replicación C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 42. Biología. 2º bachillerato Unidad 14. Genética molecular El mecanismo de elongación o formación de las nuevas cadenas de ADN La ADN polimerasa recorre las hebras molde en el sentido 3’-5’ uniendo los nuevos nucleótidos en el extremo 3’. 3’ 5’ Una de las hebras se 5’ sintetiza de modo contínuo 3’ por la ADN polimerasa III. Fragmentos de Es la conductora o lider. 5’ Okazaki 3’ 3’ 3’ 5’ 3’ La ADN polimerasa III necesita un fragmento de ARN (cebador o primer) con el extremo 3’ libre para iniciar la síntesis. 5’ RECUERDA La otra hebra se sintetiza de modo discontinuo formándose fragmentos que La ADN polimerasa: se unirán más tarde. Es la retardada. Precisa ARN cebador Lee en sentido 3´ 5 Sintetiza en sentido 5´ 3´ C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 43. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM 43 Tema 6: Estructura y Miguel Ángel Madrid
  • 44. Biología. 2º bachillerato Unidad 14. Genética molecular La primasa (ARN polimerasa) 3’ sintetiza un ARN cebador o primer 5’ La ADN polimerasa III reconoce los nucleótidos y los empareja según Cadena complementariedad continua conductora 3’ 5’ FRAGMENTO DE OKAZAKI ( 1000 – 2000 nucleótidos) Cadena retardada 5’ 3’ 3’ La primasa (ARN polimerasa) sintetiza un ARN cebador o primer La ADN 5’ plomimerasa III sintetiza un corto fragmento de ADN C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 45. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 46. Biología. 2º bachillerato Unidad 14. Genética molecular El mecanismo de elongación (II) 1 La primasa (ARN polim) sintetiza un cebador 2 Las ADN polimerasa III comienzan la síntesis en cada hebra de la burbuja de replicación. de la hebra conductora por el extremo 3’ de cada cebador. Cebador Primasas Cebador 3 La primasa sintetiza un nuevo cebador sobre 4 La ADN polimerasa III comienza a sintetizar un cada hebra retardada. fragmento de ADN a partir del nuevo cebador. Hebra retardada Hebra retardada 5 Cuando la ADN polimerasa III llega al cebador 6 La ligasa une los fragmentos de ADN. de ARN, lo elimina y lo reemplaza por ADN. Nuevo cebador Ligasas Nuevo cebador C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 47. Biología. 2º bachillerato Unidad 14. Genética molecular VOLVER Síntesis de nuevas cadenas de ADN Horquillas observadas 5’ 3’ 3’ 5’ Ninguna polimerasa añade Punto de inicio nucleótidos en estos puntos 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ Origen de Crecimiento Crecimiento replicación continuo discontinuo 5’ 3’ 5’ 3’ Fragmentos de Okazaki C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 48. Biología. 2º bachillerato Unidad 14. Genética molecular Fases de terminación Tiene lugar cuando las dos horquillas de replicación del cromosoma circular de E. coli se encuentran, y se han formado dos cromosomas completos que permanecen ligados C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 49. Biología. 2º bachillerato Unidad 14. Genética molecular Burbuja de replicación C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 50. Biología. 2º bachillerato Unidad 14. Genética molecular CORRECCIÓN DE ERRORES DE LA ADN POLIMERASA Gracias a su acción exonucleasa (elimina nucleótidos mal apareados y adiciona los correctos) Número de errores 1 por cada 100 000 bases C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 51. Biología. 2º bachillerato Unidad 14. Genética molecular Replicación en los eucariontes Es muy parecida a la de los procariontes, salvo en algunas diferencias: Los fragmentos de Okazaki en eucariotas son más cortos, entre 150-200 nucleótidos (en procariotas de 1000 – 2000 nucleótidos) La replicación se inicia simultáneamente en carios puntos del cromosoma llamados replicones. Existen cinco tipos de ADN polimerasas (α, β, γ, δ, y ε ). Las histonas se duplican durante la replicación. Junto al ADN formarán el nucleosoma. Los nuevos nucleosomas se incorporan a la hebra retardada y los viejos en la conductora. Telómero Cuando se elimina el último 3’ cebador, la ADN polimerasa 5’ 3’ 5’ no podrá rellenar el hueco, 5’ 5’ al no poder sintetizar en Cebador Último cebador dirección 3’ - 5’. Debido a esto el extremo del 3’ 5’ cromosoma (telómero) se va acortando cada vez que la célula se divide. Esto se 5’ La ADN polimerasa polimeriza Eliminación asocia al envejecimiento y desde el extremo 3’ libre de cebadores muerte celular. 3’ Hebra más corta 5’ C.E.M HIPATIA-FUHEM 5’ Miguel Ángel Madrid
  • 52. Biología. 2º bachillerato Unidad 14. Genética molecular El mecanismo de duplicación del ADN en eucariotas Hebra conductora Origen de la replicación Origen de la replicación Hebra Horquilla retardada de replicación Hebra retardada Burbujas de replicación Nucleosomas Hebra conductora Nuevos nucleosomas C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 53. Biología. 2º bachillerato Unidad 14. Genética molecular LA TELOMERASA En las células que se dividen continuamente (células madre de los gametos, células embrionarias y células cancerosas) hay una enzima, denominada telomerasa, que impide el acortamiento de los telómeros. . Se forma por una porción proteica y ARN que actúa como molde. A partir de este molde, la enzima sintetiza ADN para completar la hebra retardada. Recuerda: los telómeros son los extremos de los cromosomas La telomerasa podría detener el envejecimiento, pero guarda una estrecha relación con el cáncer. Los investigadores trabajan con ratones para alargar la vida sin aumentar el riesgo de cáncer. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 54. Biología. 2º bachillerato Unidad 14. Genética molecular María Blasco. Centro de Investigaciones oncológicas La telomerasa podría detener el envejecimiento, pero guarda una estrecha relación con el cáncer. Los investigadores trabajan con ratones para alargar la vida sin aumentar el riesgo de cáncer. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 55. Biología. 2º bachillerato Unidad 14. Genética molecular 4. La expresión del mensaje genético En 1970 Francis Crick enunció el Dogma Central de la Biología Molecular. ARNt ADN ARNm PROTEÍNA Transcripción Traducción Replicación NÚCLEO RIBOSOMAS Este esquema fue considerado durante muchos años el “dogma central de la biología molecular”., pero los cirus son una excepción a este dogma C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 56. Biología. 2º bachillerato Unidad 14. Genética molecular REDEFINICIÓN DEL DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR Algunos virus poseen ARN replicasa, capaz de obtener copias de su ARN. Otros poseen transcriptasa inversa que sintetiza ADN a partir de ARN mediante un proceso de retrotranscripción. Transcriptasa inversa ADNc ADNc (complementario) bicatenario ARN vírico Transcriptasa Envoltura inversa RETROVIRUS Transcriptasa Transcriptasa inversa inversa ADNc Membrana plasmática Degradación monocatenario de la célula huésped del ARN DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR Transcripción ADN ARN PROTEÍNAS Transcripción Traducción inversa Replicación Replicación C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 57. Biología. 2º bachillerato Unidad 14. Genética molecular 4. La expresión del mensaje genético Las secuencias de ADN que pueden moverse a diferentes partes del genoma de una célula se conocen como transposones o «genes saltarines». Fueron descubiertos por Bárbara McClintock, por lo que recibió el premio Nobel en 1983. Transcripción Traducción ADN ARNm Proteína Transcripción inversa Duplicación Duplicación C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 58. DOGMA CENTRAL DE LA BIOLOGÌA MOLECULAR DOGMA CENTRAL DE LA BIOLOGÌA MOLECULAR Biología. 2º bachillerato Unidad 14. Genética molecular 3´ 5´ Hebra molde Hebra molde Transcripción Transcripción 5´ 3´ Traducción Traducción C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 59. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 60. Biología. 2º bachillerato Unidad 14. Genética molecular TRIPLETE ¿Qué es un triplete y un codon? ADN AATTCGAGCTAGCAGCCACTTACGAGTACGTA C ARN ACUUUCCCGACGCAAAACGUUUUUCGAACUU CODON Triplete: Cada una de las secuencias posibles de tres nucleótidos en el ADN. Codon: Secuencia de tres nucleótidos en el ARN C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 61. Biología. 2º bachillerato Unidad 14. Genética molecular Síntesis de ARN: requisitos previos La síntesis de ARN o transcripción necesita: CADENA DE ADN QUE ACTÚE COMO MOLDE • ARN polimerasa I ARNr ARN -POLIMERARAS En eucariotas • ARN polimerasa II ARNm • ARN polimerasa III ARNt y ARNr RIBONUCLEÓTIDOS TRIFOSFATO DE A, G, C y U Bases Ribosa Ribonucleótido trifosfato ¿Dónde ocurre?. NÚCLEO C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 62. Biología. 2º bachillerato Unidad 14. Genética molecular 5. La transcricpción. Síntesis de ARN RECUERDA LA ARN polimerasa RECORRE LA CADENA DE ADN EN SENTIDO 3` 5´Y AÑADE LOS NUCLEÓTIDOS COMPLEMENTARIOS A LOS DE LA CADENA DE ADN QUE SE TRANSCRIBE C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 63. Biología. 2º bachillerato Unidad 14. Genética molecular 5. La transcricpción. Síntesis de ARN Fase de iniciación Fase de elongación Fase de terminación Fase de maduración C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 64. Biología. 2º bachillerato Unidad 14. Genética molecular El proceso de la transcripción 1 INICIACIÓN La ARN-polimerasa reconoce los centros promotores (ricos en A y T). Cola poli-A Luego abre la doble hélice para que los ribonucleótidos se unan a la cadena molde. Poli-A TERMINACIÓN 3 polimerasa La ARN-polimerasa reconoce en el ADN unas señales de terminación que indican el final de la transcripción. En procariontes son secuencias palindrómicas. Punto de En eucariontes corte 2 ELONGACIÓN La ARN-polimerasa avanza en sentido 3’-5’ y sintetiza el ARN en sentido 5’-3’. . Señal de Cadena molde de ADN (transcrita) corte ARN ARN - polimerasa NO OLVIDES Cadena inactiva de ADN HIPATIA-FUHEM polimerasa lee en dirección C.E.M La ARN Miguel Ángel Madrid 3` 5´
  • 65. Biología. 2º bachillerato Unidad 14. Genética molecular LA LUPA AMPLÍA 5. Transcripción: maduración en procariotas LA IMAGEN Promotor ARN-polimerasa 5’ 3’ 3’ 5’ No existe maduración del ARNm, se unen a los ribosomas y se traducen Iniciación 5’ 3’ 3’ 5’ Los ARNr y ARNt (transcritos ARN primarios) precisan de un Elongación proceso de maduración 5’ 3’ 3’ para ser funciones 5’ Finalización Los ARN que se forman son 5’ 3’ 3’ 5’ policistrónicos (contienen información para la síntesis de varios ARN transcrito completo polipéptidos) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 66. Biología. 2º bachillerato Unidad 14. Genética molecular Transcripción: maduración en procariotas Promotor ARN-polimerasa 5’ 3’ 3’ 5’ Iniciación 5’ 3’ 3’ 5’ ARN Elongación 5’ 3’ 3’ 5’ Finalización 5’ 3’ 3’ 5’ ARN transcrito completo C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 67. Biología. 2º bachillerato Unidad 14. Genética molecular Los ARN que se forman son Transcripción: maduración en eucariotas monocistrónicos Promotor Unidad de transcripción 5’ 3’ Iniciación 3’ 5’ ARN ARN-polimerasa 1. Tras la unión de los 30 primeros ribonucleótidos 5’ 3’ se añade una 3’ 5’ caperuza de metilguanosina en 5´ m7-Gppp Elongación Capucha 5' 5’ 3’ 3’ 5’ CONTINUAR m7-Gppp C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 68. Biología. 2º bachillerato Unidad 14. Genética molecular Transcripción en eucariotas 5’ 3’ Finalización 3’ 5’ 2. Después de PoliA-polimerasa la separación del ARN, una m7-Gppp enzima la poliA- polimerasa Capucha 5' añade una OH secuencia de unos 200 nucleótidos de adenina (cola de poli A) ARN heterogéneo nuclear Cola de poli-A m -Gppp 7 OH Capucha 5' CONTINUAR C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 69. Biología. 2º bachillerato Unidad 14. Genética molecular Transcripción en eucariotas. Proceso de maduración Maduración 5’ 3’ Exón 1 Intrón Exón 2 Proteína RNPpn Espliceosoma. 5’ 3’ 3. Eliminación Mecanismo de de intrones splicing (segmentos de ARN que son se traducen) Intrón Exón 1 Exón 2 El ARNm ya está en ARNm condiciones de salir del núcleo 5’ 3’ C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 70. Biología. 2º bachillerato Unidad 14. Genética molecular ¿ LO SABÍAS? La toxicidad de la Amanita phalloides (provoca diarreas, vómitos, dolores abdominales e incluso la muerte) se debe a una sustancia, 1 alfa amanitina, que no se destruye con la cocción y se comporta como un inhibidor de la ARN polimerasa II en eucariotas, lo que bloquea la síntesis de ARNm C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 71. Biología. 2º bachillerato Unidad 14. Genética molecular COMPARACIÓN TRANSCRIPCIÓN PROCARIOTAS EUCARIOTAS Localización Nucleoide (citoplasma) Núcleo Genes Continuos Fragmentos (intrones y exones) ADN Bajo grado de Muy empaquetado empaquetamiento ARN polimerasa 1 ARN polimerasa que ARN poli I: ARNr sintetiza ARNm, ARNr, ARN poli II: ARNm ARNt… ARN poli III: ARNt Tipos de genes Policistrónicos Monocistrónicos Maduración ARNr y ARNt ARNm C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 72. Biología. 2º bachillerato Unidad 14. Genética molecular 6. El código genético ¿Cómo se pasaba de un lenguaje de cuatro letras a otro lenguaje formado por 20 elementos distintos? Se necesitaba un Ese diccionario es el diccionario código genético ARN polímero lineal de 4 nucleótidos diferentes. Proteínas: polímeros de 20 aminoácidos C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 73. Biología. 2º bachillerato Unidad 14. Genética molecular El código genético Si solo fuese 1 base 41 = 4 aa INSUFICIENTE Si solo fuesen 2 bases 42 = 16 aa 3 bases INSUFICIENTE 43 = 64 aa SUFICIENTE C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 74. Biología. 2º bachillerato Unidad 14. Genética molecular El código genético 3 bases 43 = 64 aa SUFICIENTE, pero sobran palabras, lo que significa que varios tripletes son sinónimos, porque codifican (significan) el mismo aminoácido C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 75. Biología. 2º bachillerato Unidad 14. Genética molecular EL CÓDIGO GENÉTICO AUG Iniciación Ej. ¿Qué aminoácido está codificado por el codón GAC? UAG UAA UGA Terminación C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 76. Biología. 2º bachillerato Unidad 14. Genética molecular El código genético El código genético establece una relación de correspondencia entre las bases nitrogenadas del ARN y los aminoácidos que codifica C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 77. Biología. 2º bachillerato Unidad 14. Genética molecular Características del código genético UNIVERSAL DEGENERADO Existen más codones (64) que aminoácidos (20). El mismo para todos los organismos, incluso A excepción de la metionina y el triptófano, un los virus. aminoácido está codificado por más de un codón. El código ha tenido un solo origen evolutivo. Esto es una ventaja ante las mutaciones. Existen excepciones en las mitocondrias y algunos protozoos. CARECE DE SOLAPAMIENTO SIN IMPERFECCIÓN Los tripletes se disponen de manera lineal y continua, sin espacios entre ellos Cada codón solo codifica a un aminoácido. y sin compartir bases nitrogenadas Posibilidad de solapamiento Met Gli Tre His Ala Fen Ala Met Leu Leu Pro Codones de iniciación C.E.M HIPATIA-FUHEM Solapamiento Miguel Ángel Madrid
  • 78. Biología. 2º bachillerato Unidad 14. Genética molecular 7. La traducción. Biosíntesis de proteínas Si te has fijado, el proceso de transcripción es un proceso de copia donde no se cambia de idioma, pues se pasa del idioma del ADN a ARN Sin embargo, en la traducción, que no es un proceso de copia, si se cambia de idioma, se pasa del idioma de los ácidos nucleicos (A,G,C,U) al de las proteínas (20 aminoácidos) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 79. Biología. 2º bachillerato Unidad 14. Genética molecular EL PROCESO DE TRADUCCIÓN ocurre RIBOSOMAS LA SÍNTESIS DE PROTEÍNAS necesita ENZIMAS Y ARN DE RIBOSOMAS AMINOÁCIDOS ARN MENSAJERO ENERGÍA TRANSFERENCIA Formados por Donde se unen los Como la Tiene SUBUNIDAD dos Donde se une el AMINOACIL-ARNt zonas GRANDE -SINTETASA Por donde SUBUNIDAD se une al PEQUEÑA ANTICODÓN Donde se Donde se sitúa el SITIO A AMINOÁCIDO EXTREMO 3’ une el Tienen tres SITIO P POLIPÉPTIDO lugares SITIO E ARNt C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 80. Biología. 2º bachillerato Unidad 14. Genética molecular VOLVER La traducción. Biosíntesis de proteínas Veamos primero cómo es un ribosoma Cadena polipeptídica en formación Aminoácido ARNt Aminoacil-ARNt Subunidad mayor Anticodón 3’ 5’ ARNm Subunidad menor ZONA E: liberación: de donde salen los ARNt libres ZONA P: peptidil: donde se va formando la cadena polipeptídica ZONA A: aminoacil, donde entran los aminoácidos C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 81. Biología. 2º bachillerato Unidad 14. Genética molecular Otra imagen por si no te queda claro… ZONA E: liberación: de donde salen los ARNt libres ZONA P: peptidil: donde se va formando la cadena polipeptídica ZONA A: aminoacil, donde entran los aminoácidos C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 82. Biología. 2º bachillerato Unidad 14. Genética molecular Recordemos como era un ARNt (Unión a la (Unión al peptidil- ribosoma) transferasa en el ribosoma NOTA.- EXISTEN TANTOS RNAt como aminoácidos, uno para cada uno, en total 20 clases de RNAt (Unión al codon complementario del RNAm en el ribosoma) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 83. Biología. 2º bachillerato Unidad 14. Genética molecular Una imagen más simple del ARNt por si no te quedaba claro… COOH H C NH2 Aminoácido (serina) CH2 OH Aquí en el extremo 3`es donde se une el aminoácido al ARNt Extremo 3` ARNt Anticodón U C G C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 84. Biología. 2º bachillerato Unidad 14. Genética molecular La traducción. Biosíntesis de proteínas Paso previo: ESTA FASE PREVIA Activación de los aminoácidos TIENE LUGAR EN EL CITOPLASMA Y NO EN LOS RIBOSOMAS ARNt Aminoacil-ARNt Aminoacil-ARNt-sintetasa Cada aminoácido se une a una molécula de ARNt especifica gracias a la enzima aminoacil-ARNt- sintetasa CONTINUAR C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 85. Biología. 2º bachillerato Unidad 14. Genética molecular La traducción. Síntesis de proteínas Fase de iniciación Fase de elongación Fase de terminación C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 86. Biología. 2º bachillerato Unidad 14. Genética molecular La traducción. Biosíntesis de proteínas Iniciación de la síntesis 3’ U 5’ A C Metionina 5’ A U 3’ G ARNt iniciador E A GDP GTP 3’ 3’ 5’ 5’ Subunidad menor C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 87. Biología. 2º bachillerato Unidad 14. Genética molecular La traducción. Biosíntesis de proteínas Elongación de la cadena polipeptídica Aminoácido El aminoácido se Se libera el ARNt que ha Enlace traslada al otro ARNt cedido el aminoácido Anticodón peptídico ARNt P A P P A E A E E GDP GDP GTP GTP 3’ 3’ 3’ 3’ 5’ 5’ 5’ 5’ Complementariedad El ribosoma se entre codón trasloca un codon y anticodón CONTINUAR C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 88. Biología. 2º bachillerato Unidad 14. Genética molecular La traducción. Biosíntesis de proteínas Finalización de la síntesis Polipéptido libre Último ARNt P A E 3’ 3’ 5’ 5’ Factor de El codón de finalización liberación puede ser UAA, UAG o UGA Separación del ARNm y las El triplete de terminación no es reconocido por ningún subunidades ribosómicas ARNt, y sí por unos factores de liberación de naturaleza proteica que se sitúan en el sito A, y hacen que la peptidil transferasa separe la cadena polipetídica del ARNt C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 89. Biología. 2º bachillerato Unidad 14. Genética molecular Polirribosomas en eucariotas Si el ARN a traducir es lo suficientemente largo puede ser leído por más de un ribosoma a la vez, formando un polirribosoma o polisoma. La síntesis ocurre a razón de unos (15 aminoácidos unidos por segundo. Una proteína media (300 aa) se sintetizaría en unos 15 segundos. Después, el RNAm es destruído ARNm Proteína en formación Microfotografía electrónica (MET, Ribosoma falso color) de un polirribosoma. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 90. Biología. 2º bachillerato Unidad 14. Genética molecular ¿ LO SABÍAS? Determinados antibióticos se utilizan como dardos para destruir bacterias, al actuar sobre dianas moleculares relacionadas con la traducción y bloquear algunas etapas de la síntesis e proteínas Estreptomicina: trisacárido que se une a la subunidad 30 S del ribosoma procariota e interfiere en la iniciación de la síntesis. Eritromicina: bloque la traslocación del ribosoma e inhibe la elongación. Tetraciclina: Se une a la subunidad 30 s del ribosoma y bloquea el sitio A, impidiendo la entrada del ARNt C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 91. Biología. 2º bachillerato Unidad 14. Genética molecular 1. Estructura del genoma en procariotas y eucariotas GENOMA Conjunto de genes de un organismo NO TODO EL ADN CONTENIDO EN LOS CROMOSOMAS CODIFICA PARA PROTEÍNAS, EXISTE GRAN CANTIDAD DE GENES REGULADORES C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 92. Biología. 2º bachillerato Unidad 14. Genética molecular 1. Estructura del genoma en procariotas y ORGANIZACIÓN DEL GENOMA EN PROCARIOTAS 1 Cromosoma circular (ADNdc) Presencia de plásmidos (número variable según tipo de bacteria). Contienen genes no esenciales para el crecimiento y la reproducción de la célula. Replicación independiente 1 200 – 12 000 genes Genes continuos (toda la información contenida en los genes se traduce en proteínas) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 93. Biología. 2º bachillerato Unidad 14. Genética molecular 1. Estructura del genoma en procariotas y ORGANIZACIÓN DEL GENOMA EN VIRUS 1 Sola molécula lineal o circular de ADN o ARN C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 94. Biología. 2º bachillerato Unidad 14. Genética molecular 1. Estructura del genoma en procariotas y ORGANIZACIÓN DEL GENOMA EN EUCARIOTAS La mayor parte localizado en el núcleo. (repartido en los diferentes cromosomas lineales) Una pequeña parte en mitocondrias y cloroplastos (vegetales): ADNdc (similar procariotas) Humanos: genoma nuclear: 25 000 genes que codifican proteínas (exones) y los diversos tipos ARN (1,5 % del total); Genoma mitocondrial: 37 genes ADN no codificante (98,5 %) C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 95. Biología. 2º bachillerato Unidad 14. Genética molecular ADN NO CODIFICANTE ADN repetitivo o satélite: situados en los extremos de los cromosomas y centrómeros. No se transcriben nunca ADN regulador (promotores…: Mucho de él hasta la fecha de función desconocida Intrones: situados en los extremos de los cromosomas y centrómeros. No se transcriben nunca C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 96. Biología. 2º bachillerato Unidad 14. Genética molecular 8. Genoma en organismos eucariontes No existe relación directa entre la complejidad del organismo y la cantidad de ADN. La mayor parte del ADN no codifica proteínas: ADN no codificante Una parte del genoma se encuentra en los ADN repetitivo satélite cloroplastos y las mitocondrias. ADN repetitivo intermedio ADN de intrones ESTRUCTURA DE UN GEN EN EUCARIONTES Gen Gen regulador Intrones Operador Exones: secuencias codificantes Promotor C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 97. Biología. 2º bachillerato Unidad 14. Genética molecular EL PROYECTO GENOMA HUMANO 1955. Joe Hin: establece en 46 el número de cromosomas humanos. 1977. Se inicia secuenciación del ADN 1981. Se completa la secuenciación del genoma mitocondrial humano 1995. Se completa la secuenciación del genoma de la bacteria Haemophilus influenzae. 1996. Secuenciación del genoma del primer eucariota: Saccharomyces cerevisiae 2000. Se completa la secuenciación del genoma del primer organismo pluricelular, el gusano Caenorhabditis elegans. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 98. Biología. 2º bachillerato Unidad 14. Genética molecular EL PROYECTO GENOMA HUMANO 2000. Secuenciación del genoma de Drosophila melanogaster 2000. Secuenciación del genoma de la planta Arabidopsis thaliana 2001. Publicación del borrador de la secuencia completa del genoma humano 2003. (Coincidiendo con el 50º aniversario del descubrimiento de la estructura del ADN) Se completa la secuenciación del genoma humano. C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 99. Biología. 2º bachillerato Unidad 14. Genética molecular EL PROYECTO GENOMA HUMANO GENÓMICA: Estudia el genoma de los diferentes organismos 1988: Congreso de los EEUU. Autorización de financiación. Creación del consorcio público, dirigido por J.D. Watson. Colaboración con Reino Unido, Francia, Alemania, China y Japón. Nacimiento del PGH. 1996. Craig Venter solicitó la patente de uno de los genes secuenciados. Abandono del Consorcio público. Creación de Celera Genomics (privado) 26 junio 2000. El Consorcio Público y Celera Genomics dieron a conocer los borradores del PGH C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  • 100. Biología. 2º bachillerato Unidad 14. Genética molecular El 26 de junio de 2000 dos prestigiosas revistas científicas dieron a conocer las dos versiones del borrador del PGH C.E.M HIPATIA-FUHEM Miguel Ángel Madrid