1. Research Article
Identification of Candida Species Associated with
Texto adicional Texto adicional
Texto Vulvovaginal Candidiasis by Multiplex PCR
adicional texto adicional
Texto adicional texto adicional
Mahnaz Mahmoudi Rad, Ameneh Sh Zafarghandi, Maryam Amel Zabihi,
Mahkam Tavallaee and Yasaman Mirdamadi.
Molecular Biology
Students: Maria Teresa Obando Saenz
John Sebastián Henao Espinosa
2012

2. Introduction
Vulvovaginal Candidiasis is a common infection. The prevalence of this
Texto adicional Texto adicional
disease is increasing because of different consequences like the
Texto adicional texto adicional
Texto adicional texto adicionalof
extensive utilization broad- spectrum antibiotics.
Approximately, half the female population have Candida in the vaginal
flora .This study is necessary to know the differentiation of diverse species
of Candida, the improvements in molecular assay technology for
identifying Candida species has overcome some types of limits during the
last 2 years.

3. About Candida
• The gender Candida belong to the filum Ascomycota, subfilum
Ascomycotina, class Ascomycetes, order Saccharomycetales and family
saccharomycetaceae.
• It includes average 154 species, where candida albicans is the most
frequent species.
• Candida is considerated like a normal part of the human flora.
• It is the most frequent cause of human mycosis.
• The gender candida can be found in the leaves, soil, flowers and water.

4. Vulvovaginal Candidiasis
• It is the second cause most common of vaginal infection.
• Higher prevalence in women aged 20-40
• Risk Factors: Sexual relations, contraception, femenine hygiene products,
antibiotics
• Vulvovaginal candidiasis is easily treatable now, even with single-dose, but
at times the symptoms can be confused with other diseases

5. PCR
• Developed by Kary Mullis in the 1980´s.
• The objective is the amplification of genes or a DNA fragment or indirectly
through RNA, present in diverse mixtures of different sources
• It is based on enzymatic in vitro amplification. It is the geometrical increase
in the number of copies of a particular DNA sequence
• Principles: - Double-stranded DNA denaturation in order to obtain single
strands of the DNA molecule
- Specific hybridization with an oligonucleotide ( primer ) of
single strands.
- Single strand replication by a DNA polymerase starting from
the oligonucleotide as a starter.

6. Relationship between PCR, Candida and Vulvovaginal Candidiasis
• Using techniques like PCR which can identify the nonalbicans species and
can report an exact result is very useful for choosing a specific disease
diagnosis and adecuated treatment

7. General Objective
• The aim of this study was to identify different species of vaginal Candida
isolates in an Iranian patient population by using of some multiplex PCR
techniques

8. Materiales y métodos
• Se hizo el muestreo dentro de la vagina con un hisopo estéril por el
investigador y fue cultivado en un medio agar dextrosa sabouraud.
• Participantes del estudio: mujeres con signos y síntomas de Candidiasis
Vulvovaginal que fueron admitidas en el centro de ginecología del Hospital
Educacional Mahdieh, Irán
• Cada paciente fue evaluada solo una vez durante los dos años que duró el
estudio
• Los participantes que presentaron los signos menos de 4 veces durante el
previo año fueron clasificados como no recurrentes.

9. • Materiales y métodos
• Los participantes que presentaron picazón vaginal y secreciones iguales o
mayor a 4 veces durante el año fueron considerados recurrentes
• La muestra fue recolectada de los 100 primeros pacientes Recurrentes y
de los 100 primeros pacientes No Recurrentes.
• De las 200 personas seleccionadas, fueron excluidas 25 por
contaminación o porque no se observaba crecimiento de los hongos.
• Los pacientes formularon un cuestionario con respecto a sus
características demográficas y de comportamiento.

10. Materiales y métodos
• Todos firmaron un consentimiento informado sobre el estudio que se iba a
realizar y se protegió estrictamente la confidencialidad de ellas.
• Las colonias de especies Candida también fueron identificadas por la
formación del tubo germinativo en suero, producción de clamidosporas en
CMA y absorción de carbohidratos usando el kit API 20C-AUX .
• La extracción del DNA se hizo por medio de un kit para extracción de DNA
• Se utilizaron varias pruebas PCR mediante la utilización de un kit de
mezcla de estas.

11. Materiales y métodos
•Los primers utilizados en esta reacción se sintetizaron en TAGC
(Berlín, Alemania) incluyendo primers universales (ITS1 [5´-
TCCGTAGGTGAACTTGCGG - 3´] and ITS2 [ 5´- GCTGCGTTCTTCATCGATGC -
3´] y primers específicos para C. albicans ( CA3 [ 5´-
GGTTTGCTTGAAAGACGGGTAG -3´] y CA4 [ 5´-
AGTTTGAAGATATACGTGGTAG 3´] )
• Una porción conservada del DNAr 18s y del 28s fueron amplificadas
usando los primers ITS1 e ITS2
• El proceso de amplificación de PCR se llevó a cabo con un ciclador
térmico Eppendorf bajo las siguientes condiciones:
-Denaturación inicial ( 94°C, 3 min)
- 35 ciclor de denaturación ( 94°C, 1 min)
- Endurecimiento por calor y sucesivo enfriado (60°C, 1min)
- Extensión ( 72°C, 1 min )

12. Materiales y métodos
• Controles positivos fueron incluidos en cada experimento con PCR
y consitían en un cebador para cada Candida
• Dos bandas de DNA fueron correspondientes para C. albicans
mientras que una sola banda fue correspondiente para las otras
especies de Candida.
• Una evaluación de las diferentes especies de CVVR y NRVC
también se hizo.
• La estadística descriptiva, prueba de chi cuadrado y la correlación
de Spearman se utilizó para analizar los datos.
•Los productos de la PCR fueron analizados por electroforesis a través
de gel de agarosa (2%) que contiene Bromuro de Etidio

13. Resultados
• No hubo diferencia significativa
de edad entre NRVVC y
RVVC, media de 32,4 años
• Mujeres mayores tienen
mayor prevalencia de ser
infectadas con C. galbrata;
que las mujeres jóvenes
Correlation of participants’ age range and
isolated C.glabrata.

14. Resultados
Multiplex PCR using primers ITS1,
ITS2, CA3, and CA4.
-Lane 1: 50-bp DNA ladder.
-Lane 2: negative control.
-Lanes 3 to 8, 11 to 13 and 15 to 16:
eleven clinical isolates.
-Lane 9: mixed reference strains C.
krusei CBS573, C. albicans
ATCC14053, and C. glabrata
CBS2175
-Lane 10: reference strain C.
tropicalis CBS94, and
-Lane 14: reference strain C.
parapsilosis CBS2195.

15. Resultados
• Infección por una especie de Candida 89.7%
• Infección por más de una especie de Candida 10.3%
• Hubo más prevalencia de C. albicans (65.1%) y C. glabrata (13.1%)
• Infección mixta más frecuente por C. glabrata and C. albicans (5.7%)

16. Resultados
• Pacientes con NRVVC tenían una sola especie de Candida (90.2%)
• Pacientes con RVVC 89.7%
• Los resultados que presentó la PCR múltiple coincidieron con los resultados
de la prueba de tubo germinal y la producción clamidosporas en CMA y kit
de API 20C-AUX.

17. Discussion
AUTHOR STATEMENT YES OR NO
N. M. Tarini, W. The multiplex PCR method is a highly YES
Mardiastuti, F. Ibrahim, sensitive and specific technique based
A. Yasmon, and S. on the results of the previous studies
Djauzi.
S. R. Fan, X. P. Liu, The results of this study showed that NO
and J. W. Li. 10.3% of participants were infected with
more than one species of Candida which
is a higher rate compared to the other
studies conducted in China

18. AUTHOR STATEMENT YES OR NO
S. R. Fan, X. P. Liu, The first and second most common YES
and J. W. Li, K. H. Abu- isolated species in this study were C.
Elteen, F. I. albicans and C. glabratawhich was in
Okungbowa, O. S. agreement with similar studies
Isikhuemhen, and A. P. conducted worldwide
O. Dede.
K. H. Abu-Elteen, F. J. The prevalence of other species had the YES
Fleury, R. A. Falleiros same pattern in our study as seen in
De P´adua, E. earlier findings
Guilhermetti, and T. I.
Estivalet Svidzinski.

19. Conclusions
• Doctors have to use the best method for the patients, it has to be ethical,
safe and useful for everybody
• If PCR exam is useful to identify Candida species this assey is a good
method to guide the treatment to patients with candidiasis
• The candidiasis like a sexually transmitted disease can prevent without
promiscuity
• The study of other methods to identify Candida species is a possibility to find
the best way, fast, effective, economic and optimal, this can be PCR