SlideShare una empresa de Scribd logo
1 de 33
Unidad 5

Nucleótidos y ácidos nucleicos
1.
2.
3.
4.
5.
6.
7.

Nucleósidos y nucleótidos
Nucleótidos de interés biológico
Polinucleótidos. Ácidos nucleicos
Estructura del ARN
Estructura del ADN
Variaciones en la estructura del ADN
La cromatina

I.E.S. Los Boliches
Biología 2º Bachillerato
*Nucleósidos: son el resultado de la
unión de una base nitrogenada con la
ribosa o con la desoxirribosa mediante un
enlace β-N-glucosídico. Este enlace se
establece entre el N-9 de las púricas o el
N-1 de las pirimidínicas y el C-1' de la
pentosa (indicamos 1', 2', etc. en lugar de 1, 2, etc.
para evitar confusión con la numeración de los
átomos de la base).

*Nucleótidos: son ésteres fosforilados de
los nucleósidos, por lo que a veces se les
denomina nucleósidos-fosfato. Podría
producirse el éster con los hidroxilos 2', 3' y 5'
de los ribonucleótidos o con los 3' y 5' de los
desoxirribonucleótidos. Sin embargo los 2'
fosfato y los 3' fosfato son escasos.
La presencia de fosfato confiere carácter
ácido a la molécula de los nucleótidos.

Ejemplos
Ejemplo de ribonucleótido trifosfatado:

H+
La presencia de fosfato confiere
carácter ácido a la molécula de los
nucleótidos

H+

H+
Fosfatos de adenosina (adenosín fosfatos)
Intervienen en las reacciones metabólicas en que se libera o consume energía, ya
que los enlaces entre fosfatos de los nucleótidos acumulan energía química que
puede transferirse a otras sustancias cuando dichos enlaces se hidrolizan:

ATP + H2O
ADP + H2O

ADP + Pi + Energía
AMP + Pi + Energía

De igual manera, la energía desprendida en muchas reacciones químicas y procesos fisiológicos
puede aprovecharse para sintetizar las formas energéticas de los adenosín-fosfatos:

AMP + Pi + Energía
ADP + Pi + Energía

ADP + H2O
ATP + H2O

El ATP es denominado a menudo “la moneda energética de la célula”
El AMP cíclico (AMPc)
Denominado “segundo mensajero” en la recepción
de señales por parte de la célula.

El grupo fosfato
forma enlaces éster
con los carbonos 5´
y 3´ de la ribosa
oxidado

Nicotinamida

NAD
AMP

reducido

oxidado

reducido
Coenzimas derivadas de nucleótidos

Coenzima A (CoA)
Derivado del ADP con
ácido pantoténico (vit. B5)
y b-aminoetanotiol
Interviene en la activación
de los ácidos orgánicos
(ác. grasos…) para su
metabolismo
La CoA se enlaza con
ácidos orgánicos
mediante la formación
de enlaces tio-éster:
R-CO-SCoA

Flavín nucleótidos (FMN, FAD)
Piridín nucleótidos (NAD, NADP)
Coenzima A
3.- Polinucleótidos. Ácidos nucleicos
Polinucleótido = polímero de nucleótidos
unidos por enlaces fosfodiéster

Estructura de un polirribonucleótido
3.- Polinucleótidos. Ácidos nucleicos
Polinucleótido = polímero de nucleótidos
unidos por enlaces fosfodiéster

Estructura de un polirribonucleótido
3.- Polinucleótidos. Ácidos nucleicos
Polinucleótido = polímero de nucleótidos
unidos por enlaces fosfodiéster
El grupo fosfato de un
nucleótido (que estaba
unido al C 5´ de la
pentosa), se une
también por un enlace
éster al C 3´ del
nucleótido siguiente.

Lateralmente
quedan las
bases
nitrogenadas

Estructura de un polirribonucleótido

Cadena en la que alternan las pentosas y los Pi
3.- Polinucleótidos. Ácidos nucleicos
P

Extremo 5´

O
L
A
R

(No estamos hablando de polaridad eléctrica)

I
D
A
D

Extremo 3´
5´- 3´
3.- Polinucleótidos. Ácidos nucleicos
Con ribosa => POLIRRIBONUCLEOTIDOS => ARN ( = RNA ) (varios tipos)
Con desoxirribosa => POLIDESOXIRRIBONUCLEÓTIDOS = ADN ( = DNA)
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
Cuando va a copiarse el ADN ocurre esto:

1º se abre la doble cadena:
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
ATTCGCGGCATTAATCCG
TAAGCGCCGTAATTAGGC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG

2º se van añadiendo nuevas letras, de forma complementaria:
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
GTACCTAG
ATTCGCGGCATTAATCCG
T
C
T
A
TAAGCGCCGTAATTAGGC ATACCTAGT
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
La doble cadena se
terminará abriendo del todo

C
CA

T
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
Cuando va a copiarse el ADN ocurre esto:

1º se abre la doble cadena:
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
ATTCGCGGCATTAATCCG
TAAGCGCCGTAATTAGGC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG

2º se van añadiendo nuevas letras, de forma complementaria:
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
GTACCTAG
ATTCGCGGCATTAATCCG
T
C
T
A
TAAGCGCCGTAATTAGGC ATACCTAGT
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
La doble cadena se
terminará abriendo del todo

C
CA

T
3º Continúa el proceso de añadir “letras” hasta formarse
dos doble cadenas hijas, idénticas a la original:
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
En rojo se muestran las nuevas “letras” que se han ido uniendo
de la manera “correcta” o complementaria (A con T y C con G).
De este modo, cada una de las cadenas
originales ha ser vido de MOLDE par a cr ear otr a
A veces se producen errores en este proceso, dando lugar a
genes alterados, distintos al original. Son las MUTACIONES.
Estos son algunos de los dibujos de la replicación o duplicación del ADN que
pueden encontrarse en Internet:
Los genes del ADN
son capaces de
sacar copias de su
información en
forma de otra
molécula: El ARN
(ácido ribonucleico)

La letra U (Uracilo) sustituye
a la T en el ARN

GGCGCCUAAAUUUG
Las cadenas de ARN son más cortas
que las de ADN y están formadas por
una cadena simple (no doble como
ocurría con el ADN)
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
Cuando se tr anscr ibe el A DN a A RN ocur re esto:
Gen que va a transcribirse

A DN

1º se abre una parte de la doble cadena de ADN:
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
ATTCGCGGCATTAATCCGATACCTAGTA
TACCTAG
TAAGCGCCGTAATTAGGCTATGGATCAT
ATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG

2º se copia la información del gen añadiendo letras, de
forma complementaria, para formar ARN:

ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC
ATTCGCGGCATTAATCCGATACCTAGTAGGCGCCUAAAUUUGTACCTAG
TAAGCGCCGTAATTAGGCTATGGATCAT
ATGGATC
TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
La doble cadena de ADN NO se
terminará abriendo del todo. Sólo
se transcribe a ARN la información
de algunos genes.

Gen trascrito a ARN
La letra U (Uracilo) sustituye
a la T en el ARN

U

G
A

C

A RN
Núcleo celular
Finalmente, el
ARN sale
fuera del
núcleo.
Citoplasma

GCG
G

Este ARN también se
llama ARN mensajero,
porque lleva un mensaje
para fabricar proteínas.

UUG
AAU
CUA
C

ARN

Gracias a los
ribosomas, en el
citoplasma, la
información que
lleva el ARN es
“leída” por los
ribosomas para
formar proteínas
en el proceso
llamado
TRADUCCIÓN o
SÍNTESIS DE
PROTEÍNAS
ribosomas
Ocurre en el citoplasma celular, fuera del núcleo.
La información del ARN mensajero es “leída” por los ribosomas
para fabricar proteínas.
Cada grupo de tres bases (o “letras”) del ARN mensajero
determina la unión, a la cadena proteica, de uno de los 20
aminoácidos que existen.

GGCGCCUAAAUUUAUGGCACCAUGCCAUG
4.- Estructura del ARN
ARNm: Lineal, largo (masa molecular 105 – 106). Es la copia de un fragmento
de ADN con sentido biológico (copia de un gen). Con tripletes=codones
ARNr: Más corto, con regiones plegadas y con bases apareadas. Forma, junto
con proteínas ribosómicas, la estructura de ribosomas. Hay unos 3 ó 4 tipos.

Brazo
aceptor
Ribosoma
(ARNr + Prot.)

ARNm con tripletes
(codones)

ARNt: Pequeño. Estructura en “hoja de trébol”
Hay unos 50 tipos de ARNt
ARNt
Otros ARN: P.ej. Los que forman el material
genético de algunos virus.
5.- Estructura del ADN

Rosalind Franklin
5.- Estructura del ADN

-Doble hélice con enrrollamiento
a la derecha y plectonémico.
-Dos cadenas antiparalelas
-Bases n. con anillos
perpendiculares al eje (como
escalones de una escalera de
caracol).
-Bases (=> y dos cadenas)
unidas por puentes de hidrógeno
entre las bases complementarias
7.- La cromatina
-En células eucariotas, visible únicamente en células en interfase o reposo (sin
dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas].
-Formado por: ADN + PROTEÍNAS

-HISTONAS
-NO HISTONAS
La existencia de cromatina se explica
porque la célula debe resolver dos
problemas:
-La enorme cantidad-longitud de ADN
-La gran cantidad de Pi => elevada
acidez y gran acumulación de cargas
negativas

HISTONAS:
-Muy básicas debido a muchos
aa Lys y Arg (lisina y arginina)
-Hay varios tipos de histonas,
todas de p.m. bajo
7.- La cromatina
-En células eucariotas, visible únicamente en células en interfase o reposo (sin
dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas].
-Formado por: ADN + PROTEÍNAS

-HISTONAS
-NO HISTONAS
Con número fijo de
nucleótidos (146 pares) en
torno a cada octámero

HISTONAS:
-Muy básicas debido a muchos
aa Lys y Arg (lisina y arginina)
-Hay varios tipos de histonas,
todas de p.m. bajo

H2A
H2B
H3
H4
7.- La cromatina
-En células eucariotas, visible únicamente en células en interfase o reposo (sin
dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas].
-Formado por: ADN + PROTEÍNAS

-HISTONAS
-NO HISTONAS
“Collar de perlas”
“Solenoide”

Nuevos
plegamientos y
arrollamientos
consiguen un gran
empaquetamiento
hasta formar los
cromosomas.

HISTONAS:
-Muy básicas debido a muchos
aa Lys y Arg (lisina y arginina)
-Hay varios tipos de histonas,
todas de p.m. bajo

Es importante comprender que este
empaquetamiento debe desaparecer
para que un gen se exprese. El octámero
de histonas debe desmontarse, por lo
que se piensa que deben tener, además
de una función estructural, una función
en la regulación de la expresión génica.
7.- La cromatina
-En células eucariotas, visible únicamente en células en interfase o reposo (sin
dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas].
-Formado por: ADN + PROTEÍNAS

-HISTONAS
-NO HISTONAS

Variadas:
-Algunas con función estructural,
contribuyendo a fijar la forma de
filamentos > 30nm y cromosomas.
-Otras con actividad en replicación,
transcripción y regulación de la
expresión génica.
-Otras son necesarias para formar
estructuras del núcleo (nucléolo,
matriz nuclear…).

Más contenido relacionado

La actualidad más candente

Organización celular para slideshare
Organización celular para slideshareOrganización celular para slideshare
Organización celular para slideshare
Carlos Mohr
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
u.una
 

La actualidad más candente (20)

Proteinas
ProteinasProteinas
Proteinas
 
16.aminoacidos, peptidos y proteinas
16.aminoacidos, peptidos y proteinas   16.aminoacidos, peptidos y proteinas
16.aminoacidos, peptidos y proteinas
 
Lípidos
LípidosLípidos
Lípidos
 
Los ácidos nucleicos
Los ácidos nucleicosLos ácidos nucleicos
Los ácidos nucleicos
 
Enzimas
EnzimasEnzimas
Enzimas
 
Proteínas
ProteínasProteínas
Proteínas
 
Lípidos
LípidosLípidos
Lípidos
 
Aminoácidos
AminoácidosAminoácidos
Aminoácidos
 
proteinas y aminoacidos
proteinas y aminoacidosproteinas y aminoacidos
proteinas y aminoacidos
 
metabolismo de lipidos
metabolismo de lipidosmetabolismo de lipidos
metabolismo de lipidos
 
Organización celular para slideshare
Organización celular para slideshareOrganización celular para slideshare
Organización celular para slideshare
 
CARBOHIDRATOS
CARBOHIDRATOSCARBOHIDRATOS
CARBOHIDRATOS
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
Beta oxidación
Beta   oxidaciónBeta   oxidación
Beta oxidación
 
Hidratos de carbono
Hidratos de carbonoHidratos de carbono
Hidratos de carbono
 
T6 - Nucleótidos y ácidos nucleicos.
T6 - Nucleótidos y ácidos nucleicos.T6 - Nucleótidos y ácidos nucleicos.
T6 - Nucleótidos y ácidos nucleicos.
 
Biomoleculas
BiomoleculasBiomoleculas
Biomoleculas
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
Bioenergética
BioenergéticaBioenergética
Bioenergética
 

Destacado (11)

Arn tipos y funciones.
Arn tipos y funciones.Arn tipos y funciones.
Arn tipos y funciones.
 
Ud.5 (2). enzimas
Ud.5 (2). enzimasUd.5 (2). enzimas
Ud.5 (2). enzimas
 
Proteínas
ProteínasProteínas
Proteínas
 
Tema 5 acidos nucleicos
Tema 5 acidos nucleicosTema 5 acidos nucleicos
Tema 5 acidos nucleicos
 
Polisacridos 110529141856-phpapp02
Polisacridos 110529141856-phpapp02Polisacridos 110529141856-phpapp02
Polisacridos 110529141856-phpapp02
 
Lípidos santillana
Lípidos santillanaLípidos santillana
Lípidos santillana
 
Unidad 6. nucleótidos y ácidos nucleicos
Unidad 6. nucleótidos y ácidos nucleicosUnidad 6. nucleótidos y ácidos nucleicos
Unidad 6. nucleótidos y ácidos nucleicos
 
V I T A M I N A S
V I T A M I N A SV I T A M I N A S
V I T A M I N A S
 
Cromosomas y Cariotipo.
Cromosomas y Cariotipo.Cromosomas y Cariotipo.
Cromosomas y Cariotipo.
 
Tema 5
Tema 5Tema 5
Tema 5
 
Membrana plasmática
Membrana plasmáticaMembrana plasmática
Membrana plasmática
 

Similar a Nucleótidos y ácidos nucleicos

La información genética
La información genéticaLa información genética
La información genética
jujosansan
 
Acidos nucleicos2013
Acidos nucleicos2013Acidos nucleicos2013
Acidos nucleicos2013
Julio Sanchez
 
Transcripción y Traducción
Transcripción y TraducciónTranscripción y Traducción
Transcripción y Traducción
Camila Barrios T
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
tubiologia
 
La genética molecular
La genética molecularLa genética molecular
La genética molecular
eugenia6709
 
La genética molecular
La genética molecularLa genética molecular
La genética molecular
eugenia6709
 
La genética molecular
La genética molecularLa genética molecular
La genética molecular
eugenia6709
 
Duplicación de ADN y Transcripcion de ADN para formar ARN
Duplicación de ADN y Transcripcion de ADN para formar ARNDuplicación de ADN y Transcripcion de ADN para formar ARN
Duplicación de ADN y Transcripcion de ADN para formar ARN
Aleidy Aranguren-Parra
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
guest666ea5
 
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
juliomsanjuan
 

Similar a Nucleótidos y ácidos nucleicos (20)

DNA
DNADNA
DNA
 
LosNucleótidos y los Ácidos Nucleicos
LosNucleótidos y los Ácidos NucleicosLosNucleótidos y los Ácidos Nucleicos
LosNucleótidos y los Ácidos Nucleicos
 
Ácidos nucleicos 2014
Ácidos nucleicos 2014Ácidos nucleicos 2014
Ácidos nucleicos 2014
 
Ác. nucleicos 2023.pdf
Ác. nucleicos 2023.pdfÁc. nucleicos 2023.pdf
Ác. nucleicos 2023.pdf
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
La información genética
La información genéticaLa información genética
La información genética
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
El ADN
El ADNEl ADN
El ADN
 
Acidos nucleicos
Acidos   nucleicosAcidos   nucleicos
Acidos nucleicos
 
Acidos nucleicos2013
Acidos nucleicos2013Acidos nucleicos2013
Acidos nucleicos2013
 
Genética Molecular
Genética MolecularGenética Molecular
Genética Molecular
 
Transcripción y Traducción
Transcripción y TraducciónTranscripción y Traducción
Transcripción y Traducción
 
Tema4 los genes y la manipulacion
Tema4 los genes y la manipulacionTema4 los genes y la manipulacion
Tema4 los genes y la manipulacion
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
 
La genética molecular
La genética molecularLa genética molecular
La genética molecular
 
La genética molecular
La genética molecularLa genética molecular
La genética molecular
 
La genética molecular
La genética molecularLa genética molecular
La genética molecular
 
Duplicación de ADN y Transcripcion de ADN para formar ARN
Duplicación de ADN y Transcripcion de ADN para formar ARNDuplicación de ADN y Transcripcion de ADN para formar ARN
Duplicación de ADN y Transcripcion de ADN para formar ARN
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
 
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
 

Más de IES Suel - Ciencias Naturales

Orgánulos energéticos: mitocondrias y cloroplastos
Orgánulos energéticos: mitocondrias y cloroplastosOrgánulos energéticos: mitocondrias y cloroplastos
Orgánulos energéticos: mitocondrias y cloroplastos
IES Suel - Ciencias Naturales
 

Más de IES Suel - Ciencias Naturales (20)

Inmunología
InmunologíaInmunología
Inmunología
 
Respiración y fotosíntesis
Respiración y fotosíntesisRespiración y fotosíntesis
Respiración y fotosíntesis
 
Introducción al metabolismo
Introducción al metabolismoIntroducción al metabolismo
Introducción al metabolismo
 
Núcleo. Mitosis y meiosis
Núcleo. Mitosis y meiosisNúcleo. Mitosis y meiosis
Núcleo. Mitosis y meiosis
 
Orgánulos energéticos: mitocondrias y cloroplastos
Orgánulos energéticos: mitocondrias y cloroplastosOrgánulos energéticos: mitocondrias y cloroplastos
Orgánulos energéticos: mitocondrias y cloroplastos
 
Ribosomas y sistemas de endomembranas
Ribosomas y sistemas de endomembranasRibosomas y sistemas de endomembranas
Ribosomas y sistemas de endomembranas
 
Citosol y citoesqueleto
Citosol y citoesqueletoCitosol y citoesqueleto
Citosol y citoesqueleto
 
La envoltura celular
La envoltura celularLa envoltura celular
La envoltura celular
 
Glúcidos
GlúcidosGlúcidos
Glúcidos
 
Bioelementos y biomoléculas inorgánicas
Bioelementos y biomoléculas inorgánicasBioelementos y biomoléculas inorgánicas
Bioelementos y biomoléculas inorgánicas
 
El origen de la especie humana
El origen de la especie humanaEl origen de la especie humana
El origen de la especie humana
 
Genética molecular: Transcripción
Genética molecular: TranscripciónGenética molecular: Transcripción
Genética molecular: Transcripción
 
Genetica molecular: Replicación
Genetica molecular: ReplicaciónGenetica molecular: Replicación
Genetica molecular: Replicación
 
Evolución 1.- Fijismo y evolucionismo
Evolución 1.- Fijismo y evolucionismoEvolución 1.- Fijismo y evolucionismo
Evolución 1.- Fijismo y evolucionismo
 
Evolución 2.- Pruebas evolutivas
Evolución 2.- Pruebas evolutivasEvolución 2.- Pruebas evolutivas
Evolución 2.- Pruebas evolutivas
 
Evolución 3.- Teorías evolutivas
Evolución 3.- Teorías evolutivasEvolución 3.- Teorías evolutivas
Evolución 3.- Teorías evolutivas
 
Evolución 4.- Formación de nuevas especies
Evolución 4.- Formación de nuevas especiesEvolución 4.- Formación de nuevas especies
Evolución 4.- Formación de nuevas especies
 
Evolución 5.- Mecanismos evolutivos
Evolución 5.- Mecanismos evolutivosEvolución 5.- Mecanismos evolutivos
Evolución 5.- Mecanismos evolutivos
 
Evolución 6.- El origen de la vida
Evolución 6.- El origen de la vidaEvolución 6.- El origen de la vida
Evolución 6.- El origen de la vida
 
La piel
La pielLa piel
La piel
 

Último

ANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdf
ANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdfANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdf
ANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdf
lvela1316
 
Ediciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D Ccesa007.pdf
Ediciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D  Ccesa007.pdfEdiciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D  Ccesa007.pdf
Ediciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D Ccesa007.pdf
Demetrio Ccesa Rayme
 
RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...
RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...
RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...
helmer del pozo cruz
 

Último (20)

Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...
Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...
Realitat o fake news? – Què causa el canvi climàtic? - Modificacions dels pat...
 
Diapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanente
Diapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanenteDiapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanente
Diapositivas unidad de trabajo 7 sobre Coloración temporal y semipermanente
 
flujo de materia y energía ecosistemas.
flujo de materia y  energía ecosistemas.flujo de materia y  energía ecosistemas.
flujo de materia y energía ecosistemas.
 
Síndrome piramidal 2024 según alvarez, farrera y wuani
Síndrome piramidal 2024 según alvarez, farrera y wuaniSíndrome piramidal 2024 según alvarez, farrera y wuani
Síndrome piramidal 2024 según alvarez, farrera y wuani
 
Seguridad y virus informáticos 12°B 2024
Seguridad y virus informáticos 12°B 2024Seguridad y virus informáticos 12°B 2024
Seguridad y virus informáticos 12°B 2024
 
cuadernillo_cuentos_de_los_valores_elprofe20 (1).docx
cuadernillo_cuentos_de_los_valores_elprofe20 (1).docxcuadernillo_cuentos_de_los_valores_elprofe20 (1).docx
cuadernillo_cuentos_de_los_valores_elprofe20 (1).docx
 
Los caminos del saber matematicas 7°.pdf
Los caminos del saber matematicas 7°.pdfLos caminos del saber matematicas 7°.pdf
Los caminos del saber matematicas 7°.pdf
 
El liderazgo en la empresa sostenible, introducción, definición y ejemplo.
El liderazgo en la empresa sostenible, introducción, definición y ejemplo.El liderazgo en la empresa sostenible, introducción, definición y ejemplo.
El liderazgo en la empresa sostenible, introducción, definición y ejemplo.
 
2. Entornos Virtuales de Aprendizaje.pptx
2. Entornos Virtuales de Aprendizaje.pptx2. Entornos Virtuales de Aprendizaje.pptx
2. Entornos Virtuales de Aprendizaje.pptx
 
ANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdf
ANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdfANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdf
ANTOLOGIA COMPLETA ANITA LA ABEJITA PARA LA LECTOESCRITURA EN PRIMER GRADO.pdf
 
Ediciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D Ccesa007.pdf
Ediciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D  Ccesa007.pdfEdiciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D  Ccesa007.pdf
Ediciones Previas Proyecto de Innovacion Pedagogica ORIGAMI 3D Ccesa007.pdf
 
¿Que es Fuerza? online 2024 Repaso CRECE.pptx
¿Que es Fuerza? online 2024 Repaso CRECE.pptx¿Que es Fuerza? online 2024 Repaso CRECE.pptx
¿Que es Fuerza? online 2024 Repaso CRECE.pptx
 
MINEDU BASES JUEGOS ESCOLARES DEPORTIVOS PARADEPORTIVOS 2024.docx
MINEDU BASES JUEGOS ESCOLARES DEPORTIVOS PARADEPORTIVOS 2024.docxMINEDU BASES JUEGOS ESCOLARES DEPORTIVOS PARADEPORTIVOS 2024.docx
MINEDU BASES JUEGOS ESCOLARES DEPORTIVOS PARADEPORTIVOS 2024.docx
 
RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...
RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...
RESOLUCION_VICE_MINISTERIAL-00048-2024-M-EVALUACIÓN EVALAUCION FORMATIVA MINE...
 
POEMAS ILUSTRADOS DE LUÍSA VILLALTA. Elaborados polos alumnos de 4º PDC do IE...
POEMAS ILUSTRADOS DE LUÍSA VILLALTA. Elaborados polos alumnos de 4º PDC do IE...POEMAS ILUSTRADOS DE LUÍSA VILLALTA. Elaborados polos alumnos de 4º PDC do IE...
POEMAS ILUSTRADOS DE LUÍSA VILLALTA. Elaborados polos alumnos de 4º PDC do IE...
 
ciclos biogeoquimicas y flujo de materia ecosistemas
ciclos biogeoquimicas y flujo de materia ecosistemasciclos biogeoquimicas y flujo de materia ecosistemas
ciclos biogeoquimicas y flujo de materia ecosistemas
 
ACERTIJO SOPA DE LETRAS OLÍMPICA. Por JAVIER SOLIS NOYOLA
ACERTIJO SOPA DE LETRAS OLÍMPICA. Por JAVIER SOLIS NOYOLAACERTIJO SOPA DE LETRAS OLÍMPICA. Por JAVIER SOLIS NOYOLA
ACERTIJO SOPA DE LETRAS OLÍMPICA. Por JAVIER SOLIS NOYOLA
 
Época colonial: vestimenta, costumbres y juegos de la época
Época colonial: vestimenta, costumbres y juegos de la épocaÉpoca colonial: vestimenta, costumbres y juegos de la época
Época colonial: vestimenta, costumbres y juegos de la época
 
2.15. Calendario Civico Escolar 2024.docx
2.15. Calendario Civico Escolar 2024.docx2.15. Calendario Civico Escolar 2024.docx
2.15. Calendario Civico Escolar 2024.docx
 
Estudios Sociales libro 8vo grado Básico
Estudios Sociales libro 8vo grado BásicoEstudios Sociales libro 8vo grado Básico
Estudios Sociales libro 8vo grado Básico
 

Nucleótidos y ácidos nucleicos

  • 1. Unidad 5 Nucleótidos y ácidos nucleicos 1. 2. 3. 4. 5. 6. 7. Nucleósidos y nucleótidos Nucleótidos de interés biológico Polinucleótidos. Ácidos nucleicos Estructura del ARN Estructura del ADN Variaciones en la estructura del ADN La cromatina I.E.S. Los Boliches Biología 2º Bachillerato
  • 2.
  • 3. *Nucleósidos: son el resultado de la unión de una base nitrogenada con la ribosa o con la desoxirribosa mediante un enlace β-N-glucosídico. Este enlace se establece entre el N-9 de las púricas o el N-1 de las pirimidínicas y el C-1' de la pentosa (indicamos 1', 2', etc. en lugar de 1, 2, etc. para evitar confusión con la numeración de los átomos de la base). *Nucleótidos: son ésteres fosforilados de los nucleósidos, por lo que a veces se les denomina nucleósidos-fosfato. Podría producirse el éster con los hidroxilos 2', 3' y 5' de los ribonucleótidos o con los 3' y 5' de los desoxirribonucleótidos. Sin embargo los 2' fosfato y los 3' fosfato son escasos. La presencia de fosfato confiere carácter ácido a la molécula de los nucleótidos. Ejemplos
  • 4.
  • 5. Ejemplo de ribonucleótido trifosfatado: H+ La presencia de fosfato confiere carácter ácido a la molécula de los nucleótidos H+ H+
  • 6.
  • 7. Fosfatos de adenosina (adenosín fosfatos) Intervienen en las reacciones metabólicas en que se libera o consume energía, ya que los enlaces entre fosfatos de los nucleótidos acumulan energía química que puede transferirse a otras sustancias cuando dichos enlaces se hidrolizan: ATP + H2O ADP + H2O ADP + Pi + Energía AMP + Pi + Energía De igual manera, la energía desprendida en muchas reacciones químicas y procesos fisiológicos puede aprovecharse para sintetizar las formas energéticas de los adenosín-fosfatos: AMP + Pi + Energía ADP + Pi + Energía ADP + H2O ATP + H2O El ATP es denominado a menudo “la moneda energética de la célula”
  • 8. El AMP cíclico (AMPc) Denominado “segundo mensajero” en la recepción de señales por parte de la célula. El grupo fosfato forma enlaces éster con los carbonos 5´ y 3´ de la ribosa
  • 9.
  • 10.
  • 12. Coenzimas derivadas de nucleótidos Coenzima A (CoA) Derivado del ADP con ácido pantoténico (vit. B5) y b-aminoetanotiol Interviene en la activación de los ácidos orgánicos (ác. grasos…) para su metabolismo La CoA se enlaza con ácidos orgánicos mediante la formación de enlaces tio-éster: R-CO-SCoA Flavín nucleótidos (FMN, FAD) Piridín nucleótidos (NAD, NADP) Coenzima A
  • 13. 3.- Polinucleótidos. Ácidos nucleicos Polinucleótido = polímero de nucleótidos unidos por enlaces fosfodiéster Estructura de un polirribonucleótido
  • 14. 3.- Polinucleótidos. Ácidos nucleicos Polinucleótido = polímero de nucleótidos unidos por enlaces fosfodiéster Estructura de un polirribonucleótido
  • 15. 3.- Polinucleótidos. Ácidos nucleicos Polinucleótido = polímero de nucleótidos unidos por enlaces fosfodiéster El grupo fosfato de un nucleótido (que estaba unido al C 5´ de la pentosa), se une también por un enlace éster al C 3´ del nucleótido siguiente. Lateralmente quedan las bases nitrogenadas Estructura de un polirribonucleótido Cadena en la que alternan las pentosas y los Pi
  • 16. 3.- Polinucleótidos. Ácidos nucleicos P Extremo 5´ O L A R (No estamos hablando de polaridad eléctrica) I D A D Extremo 3´ 5´- 3´
  • 17. 3.- Polinucleótidos. Ácidos nucleicos Con ribosa => POLIRRIBONUCLEOTIDOS => ARN ( = RNA ) (varios tipos) Con desoxirribosa => POLIDESOXIRRIBONUCLEÓTIDOS = ADN ( = DNA)
  • 18.
  • 19. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando va a copiarse el ADN ocurre esto: 1º se abre la doble cadena: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG 2º se van añadiendo nuevas letras, de forma complementaria: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC GTACCTAG ATTCGCGGCATTAATCCG T C T A TAAGCGCCGTAATTAGGC ATACCTAGT TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG La doble cadena se terminará abriendo del todo C CA T
  • 20. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando va a copiarse el ADN ocurre esto: 1º se abre la doble cadena: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG 2º se van añadiendo nuevas letras, de forma complementaria: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC GTACCTAG ATTCGCGGCATTAATCCG T C T A TAAGCGCCGTAATTAGGC ATACCTAGT TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG La doble cadena se terminará abriendo del todo C CA T
  • 21. 3º Continúa el proceso de añadir “letras” hasta formarse dos doble cadenas hijas, idénticas a la original: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG En rojo se muestran las nuevas “letras” que se han ido uniendo de la manera “correcta” o complementaria (A con T y C con G). De este modo, cada una de las cadenas originales ha ser vido de MOLDE par a cr ear otr a A veces se producen errores en este proceso, dando lugar a genes alterados, distintos al original. Son las MUTACIONES.
  • 22. Estos son algunos de los dibujos de la replicación o duplicación del ADN que pueden encontrarse en Internet:
  • 23. Los genes del ADN son capaces de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) La letra U (Uracilo) sustituye a la T en el ARN GGCGCCUAAAUUUG Las cadenas de ARN son más cortas que las de ADN y están formadas por una cadena simple (no doble como ocurría con el ADN)
  • 24. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando se tr anscr ibe el A DN a A RN ocur re esto: Gen que va a transcribirse A DN 1º se abre una parte de la doble cadena de ADN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA TACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG 2º se copia la información del gen añadiendo letras, de forma complementaria, para formar ARN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTAGGCGCCUAAAUUUGTACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG La doble cadena de ADN NO se terminará abriendo del todo. Sólo se transcribe a ARN la información de algunos genes. Gen trascrito a ARN La letra U (Uracilo) sustituye a la T en el ARN U G A C A RN
  • 25. Núcleo celular Finalmente, el ARN sale fuera del núcleo. Citoplasma GCG G Este ARN también se llama ARN mensajero, porque lleva un mensaje para fabricar proteínas. UUG AAU CUA C ARN Gracias a los ribosomas, en el citoplasma, la información que lleva el ARN es “leída” por los ribosomas para formar proteínas en el proceso llamado TRADUCCIÓN o SÍNTESIS DE PROTEÍNAS ribosomas
  • 26. Ocurre en el citoplasma celular, fuera del núcleo. La información del ARN mensajero es “leída” por los ribosomas para fabricar proteínas. Cada grupo de tres bases (o “letras”) del ARN mensajero determina la unión, a la cadena proteica, de uno de los 20 aminoácidos que existen. GGCGCCUAAAUUUAUGGCACCAUGCCAUG
  • 27. 4.- Estructura del ARN ARNm: Lineal, largo (masa molecular 105 – 106). Es la copia de un fragmento de ADN con sentido biológico (copia de un gen). Con tripletes=codones ARNr: Más corto, con regiones plegadas y con bases apareadas. Forma, junto con proteínas ribosómicas, la estructura de ribosomas. Hay unos 3 ó 4 tipos. Brazo aceptor Ribosoma (ARNr + Prot.) ARNm con tripletes (codones) ARNt: Pequeño. Estructura en “hoja de trébol” Hay unos 50 tipos de ARNt ARNt Otros ARN: P.ej. Los que forman el material genético de algunos virus.
  • 28. 5.- Estructura del ADN Rosalind Franklin
  • 29. 5.- Estructura del ADN -Doble hélice con enrrollamiento a la derecha y plectonémico. -Dos cadenas antiparalelas -Bases n. con anillos perpendiculares al eje (como escalones de una escalera de caracol). -Bases (=> y dos cadenas) unidas por puentes de hidrógeno entre las bases complementarias
  • 30. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS La existencia de cromatina se explica porque la célula debe resolver dos problemas: -La enorme cantidad-longitud de ADN -La gran cantidad de Pi => elevada acidez y gran acumulación de cargas negativas HISTONAS: -Muy básicas debido a muchos aa Lys y Arg (lisina y arginina) -Hay varios tipos de histonas, todas de p.m. bajo
  • 31. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS Con número fijo de nucleótidos (146 pares) en torno a cada octámero HISTONAS: -Muy básicas debido a muchos aa Lys y Arg (lisina y arginina) -Hay varios tipos de histonas, todas de p.m. bajo H2A H2B H3 H4
  • 32. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS “Collar de perlas” “Solenoide” Nuevos plegamientos y arrollamientos consiguen un gran empaquetamiento hasta formar los cromosomas. HISTONAS: -Muy básicas debido a muchos aa Lys y Arg (lisina y arginina) -Hay varios tipos de histonas, todas de p.m. bajo Es importante comprender que este empaquetamiento debe desaparecer para que un gen se exprese. El octámero de histonas debe desmontarse, por lo que se piensa que deben tener, además de una función estructural, una función en la regulación de la expresión génica.
  • 33. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS Variadas: -Algunas con función estructural, contribuyendo a fijar la forma de filamentos > 30nm y cromosomas. -Otras con actividad en replicación, transcripción y regulación de la expresión génica. -Otras son necesarias para formar estructuras del núcleo (nucléolo, matriz nuclear…).