Transcriptomica PDF

779 visualizaciones

Publicado el

Publicado en: Ciencias
0 comentarios
0 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

Sin descargas
Visualizaciones
Visualizaciones totales
779
En SlideShare
0
De insertados
0
Número de insertados
3
Acciones
Compartido
0
Descargas
32
Comentarios
0
Recomendaciones
0
Insertados 0
No insertados

No hay notas en la diapositiva.

Transcriptomica PDF

  1. 1. Transcriptómica
  2. 2. Vida – una receta para hacer proteínas proteínaDNA RNA TraducciónTranscripción
  3. 3. El Dogma Central de la Biología Molecular
  4. 4. El Dogma Central de la Biología Molecular
  5. 5. Genoma -> Transcriptoma ->Proteoma ¿Qué es la Información Biológica?
  6. 6. Tres niveles básicos de información biológica: Genoma: la información genética común a todas las células del organismo. Transcriptoma: la parte del genoma que se expresa en una célula en una etapa específica de su desarrollo. Proteoma: las proteínas que interactuan para dar a la célula su carácter individual. Del GENOMA estático, único al PROTEOMA dinámico, múltiple. ¿Qué es la Información Biológica?
  7. 7. La era de la genómica
  8. 8. La genómica se ha desarrollado como consecuencia de los avances en Biología Molecular e Informática. La introducción y popularización de las tecnologías de alta procesividad ha cambiado drásticamente la manera en que se abordan los problemas biológicos y se prueban las hipótesis.
  9. 9. • El objetivo de la genómica funcional es generar un catálogo de todos los genes y de su función. • Para comprender el comportamiento de los sistemas biológicos y de los algoritmos genéticos que permiten el funcionamiento celular y el desarrollo de los organismos. Genómica funcional
  10. 10. • La genómica funcional engloba el estudio del: • Transcriptoma: conjunto completo de transcritos. • Proteoma: conjunto de proteínas codificadas por un genoma. • Interactoma: interacción de estos productos. Genómica funcional
  11. 11. • Planteamiento clásico: • Dirigido por una hipótesis. • Limitado el número de genes estudiados. • Planteamiento genómico: • No hay hipótesis de partida. • Información sobre miles de genes. Genómica funcional
  12. 12. Del genotipo al fenotipo >protein kunase acctgttgatggcgacagggactgtatgctgatct atgctgatgcatgcatgctgactactgatgtgggg gctattgacttgatgtctatc.... …codifican proteínas... …cuya estructura influye en la función... Genes en el DNA... …además el ambiente... …producen el fenotipo final El paradigma pre-genómico
  13. 13. Secuenciación genoma Espectrometría de masas para complejos proteícos La visión post-genómica Microarrays de DNA Literatura, bases de datos ¿Quién? ¿Donde, cómo y cuanto? ¿Qué sabemos? ¿En qué manera? SNPs ¿Y quién más?
  14. 14. Transcriptoma
  15. 15. Estudio de los perfiles de expresión de todos los genes presentes en el genoma. El método más utilizado es el de microarrays de DNA, que permite el análisis simultaneo de la expresión de miles de genes.
  16. 16. G T A A T C C T C | | | | | | | | | C A T T A G G A G DNA G U A A U C C RNA polimerasa mRNA Transcripción
  17. 17. • Varios niveles de regulación: transcripción, maduración, transporte al citoplasma, degradación, traducción, post-traducción. • Los genes no actúan de forma aislada. • Existen redes de interacción: • Física (directa o indirecta). • Funcional. Regulación de la expresión génica
  18. 18. • Pasado: técnicas tradicionales para medir la expresión génica, como Northern y RT-PCR. • Desarrollo tecnológico: • Expressed Sequenced Tags (ESTs). • Serial analysis gene expression (SAGE). • Suppression substractive hybridization (SSH). • Microarrays de DNA. Sistemas de detección de la expresión génica
  19. 19. Cambio de escala: del gen al genoma
  20. 20. Cambio de escala: del gen al genoma
  21. 21. • Independientes de conocimiento previo: • ESTs • SAGE • SSH • Dependientes de conocimiento previo: • Microarrays de DNA Tecnicas genómicas de alta procesividad
  22. 22. • Generación de colecciones de ESTs (etiquetas de secuencia expresadas). • La complejidad de los genomas eucariotas hace aconsejable no abordar inicialmente el estudio del genoma completo. • Es preferible estudiar aquellos genes que se están expresando en un momento determinado de la vida del organismo. ESTs (Expressed Sequenced Tags)
  23. 23. ESTs
  24. 24. • Genoteca de cDNA: colección de fragmentos de DNA clonados que representan el conjunto de genes que se están expresando en un órgano o tejido determinado, o bajo una situación particular o momento de desarrollo. • Las genotecas de cDNA se secuencian de forma masiva para generar miles de secuencias parciales o ESTs de 200-500 bp. ESTs
  25. 25. ESTs
  26. 26. • Las diferencias en la expresión de genes pueden ser identificadas considerando el número de veces en que aparece representada una EST particular. • Las ESTs por su propia naturaleza, son incompletas y, hasta cierto punto, imprecisas. • Las ESTs también suelen ser suficientes para la identificación de los genes mediante comparación con las bases de datos. ESTs
  27. 27. • Versión acelerada de la secuenciación de ESTs. • Un segmento corto procedente de un mRNA (etiqueta SAGE) es suficiente para identificar inequívocamente a un gen completo. • La etiqueta corta tiene que estar ubicada en una posición definida dentro de la secuencia del mRNA. Tecnología SAGE (Serial Analysis Gene Expression)
  28. 28. • Generación de etiquetas SAGE (Tags) de secuencias (10-14 bases). • Ligación de las etiquetas SAGE para obtener concatémeros que pueden ser clonados y secuenciados. • Comparación de los datos de secuencia para determinar diferencias en la expresión de los genes. Tecnología SAGE
  29. 29. Tecnología SAGE
  30. 30. Tecnología SAGE
  31. 31. Tecnología SAGE
  32. 32. • Principalmente los ESTs brindan información de secuencia, mientras que el SAGE provee datos cuantitativos describiendo la abundancia de transcritos. • Determina el nivel de expresión para cada gen, y contribuye al descubrimiento de nuevos genes. • Muy buena correlación con la abundancia de RNA mensajero en la célula. Tecnología SAGE: Ventajas
  33. 33. • Muy laborioso, laboratorios especializados y complejidad análisis de datos. • Problemas técnicos: • Digestión incompleta con la enzima que genera extremos cohesivos. • Problemas con la secuenciación masiva. Tecnología SAGE: Problemas
  34. 34. Tecnología SSH
  35. 35. Tecnología SSH
  36. 36. Microarrays de DNA
  37. 37. • Los microarrays de DNA surgen de la necesidad de analizar la cantidad de información procedente de los grandes proyectos de secuenciación de genomas. • Permiten elaborar mapas finos de transcripción y proporcionan información indirecta de los niveles de proteínas. Microarrays de DNA
  38. 38. • El análisis de microarrays de DNA es una nueva tecnología que permite estudiar simultáneamente la expresión de miles de genes y analizar su expresión bajo distintas condiciones experimentales. • Los microarrays de DNA constan de miles de conjuntos ordenados de moléculas de DNA de secuencia conocida depositados en un soporte sólido (~ 2 cm2) como cristal, nylon o silicio. • Cada combinación (gen/muestra) se localiza de forma inequívoca en un punto del microarray. Microarrays de DNA
  39. 39. • Los microarrays de DNA permiten la medida simultánea de los niveles de expresión de miles de genes (sondas) en un solo experimento de hibridación con una mezcla compleja de DNA o RNA (dianas). • Sondas: secuencias de DNA conocidas (oligonucleótidos o productos de PCR) inmovilizadas ordenadamente sobre una superficie sólida. • Dianas: muestra problema de DNA o RNA marcada cuya abundancia será determinada por hibridación. Microarrays de DNA
  40. 40. Microarrays de DNA - El concepto Medir el nivel de transcritos (mRNA) de un gran número de genes simultáneamente para determinar que genes se están expresando en la célula. CELL RNA
  41. 41. • El objetivo de los experimentos con microarrays de DNA es comparar la expresión de múltiples genes (transcripción) en distintas condiciones: • Momentos distintos del tiempo • Tejidos distintos • Tejidos sanos o enfermos (p.e. Tumores) • Se basan en tecnologías conocidas como la hibridación y la fluorescencia. Microarrays de DNA – El objetivo
  42. 42. Microarrays de DNA - Hibridación A A A T T G G C C T A T G A T G C C A A A T T G G C C T A T G A T G C C
  43. 43. Mediante hibridación, pueden detectar DNA o RNA: Si el DNA o RNA hibridado está marcado fluorescentemente puede ser cuantificado mediante escaneado del chip de DNA. Microarrays de DNA - Hibridación
  44. 44. • Cada sonda del microarray de DNA está diseñada para unirse a un gen de forma específica. • Diseño de sondas específicas: • Especificidad de secuencia. • Tms homogéneas. • Sin estructuras secundarias. • Cada sonda está dispuesta de forma ordenada sobre el microarray de DNA. Microarrays de DNA – Sondas
  45. 45. Sondas de DNA específicas de gen cDNA marcado gen mRNA Microarrays de DNA – El proceso
  46. 46. • Los microarrays de DNA están formados por 100 - 1 millón de sondas de DNA sobre una superficie de 1 cm por 1 cm (chip de DNA). • Los resultados de microarrays de DNA se basan en el concepto de “culpable por asociación”. • Genes que son co-regulados (patrón similar de comportamiento) es probable que estén funcionalmente relacionados formando parte del mismo proceso biológico. Microarrays de DNA – El resultado
  47. 47. • Los microarrays de DNA son una revolución por su capacidad de realizar experimentos inconcebibles hasta hace poco tiempo. • Los nuevos chips de DNA podrán contener (y por tanto estudiar) el genoma humano en 2 cm2. • Esto genera cantidades ingentes de datos que deben ser almacenadas, procesadas y analizadas: - Al tratarse de una nueva técnica la mayor parte de métodos, protocólos o estándares se están aún definiendo. Microarrays de DNA – El reto
  48. 48. • 45 Genes de Arabidopsis y 3 genes control: total 48 señales. El primer Microarray de DNA • Schena et al., (1995). Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270, 467-470.
  49. 49. Microarrays de DNA – Experimento básico • Un experimento básico de microarrays de DNA consiste en: 1- Diseño y fabricación del microarray. 2- Preparación de la muestra e hibridación. 3- Escaneo del microarray. 4- Análisis de imagen. 5- Análisis de los resultados.
  50. 50. Preparación Muestra Hibridación Diseño Array Diseño Sonda PREGUNTA Diseño Experimental Compra Chip/Array RESPUESTA Análisis Avanzado de Datos Extracción de Genes Relevantes Análisis Estadístico Preprocesamiento de datos Normalización Análisis de Imagen Microarrays de DNA
  51. 51. Microarrays de DNA – Experimento básico
  52. 52. Diseño y fabricación
  53. 53. Diseño y fabricación • La primera fase del diseño del microarray de DNA consiste en la selección de los genes que se desean incorporar al experimento. • Las secuencias necesarias pueden obtenerse, por ejemplo, de una base de datos de ESTs. • Puede haber problemas en la identificación de las secuencias : • Errores de secuenciación • Splicing alternativo • Contaminación
  54. 54. Diseño y fabricación - Sondas • Una vez seleccionados los genes se realizan múltiples copias de cada uno mediante PCR, y los productos (sondas) se depositan en el sustrato. • Tipos de sondas: • Genotecas de cDNA (Stanford microarrays) • Oligonucleótidos (Affymetrix) • El soporte sólido (sustrato) del microarray suele ser cristal, y también membranas de nylon o plástico.
  55. 55. Diseño y fabricación – Adhesión sondas • La adhesión de las sondas sobre el sustrato puede hacerse mediante diversas técnicas: • Impresión mecánica (capilaridad) o microinyección (Ink-jet) → Stanford microarrays • Fotolitografía → Affymetrix • Existen dos tipos de tecnologías de microarrays de DNA: • Arrays de cDNAs: Stanford Microarrays. • Arrays de oligonucleótidos: Affymetrix.
  56. 56. Preparación de la muestra
  57. 57. Preparación de la muestra • Paralelamente al diseño y fabricación del microarray que contiene los genes (sondas) cuya expresión se desea estudiar... • ...deben prepararse las muestras problema (dianas) en las que se desea estudiar la expresión de estos genes. • Extracción de todo el mRNA de las células en las condiciones que se desea estudiar, y posterior marcaje del mRNA.
  58. 58. Preparación de la muestra 1. Diseño experimental ¿Pregunta? ¿Réplicas? 2. Realizar experimento 4. Marcaje RNA ¿Amplificación? ¿Directo o indirecto? ¿Tipo de marcaje? silvestre mutante 3. Precipitar RNA ¿Eucariota/procariota? ¿Pared celular?
  59. 59. Hibridación
  60. 60. Hibridación • Una vez preparadas y marcadas las muestras problema (dianas) se depositan sobre las sondas en el microarray de DNA. • Esto hará que los cDNAs o cRNAs de las muestras problema se puedan hibridar con los de cada gen contenido en las sondas del microarray de DNA. • La hibridación tendrá lugar en un grado proporcional a la expresión del gen de cada sonda en cada muestra problema.
  61. 61. Hibridación • En arrays de cDNA las muestras problema se juntan y se hibridan en un único microarray. • En arrays de oligonucleótidos las muestras se hibridan por separado en dos microarrays idénticos. • Tras la hibridación, el microarray se lava para eliminar el material que no se ha hibridado. • La intensidad de la señal de hibridación resultante es proporcional a la cantidad de mRNA que corresponde a esa secuencia en la muestra original.
  62. 62. Hibridación • La detección de la hibridación es un paso clave para determinar qué sondas se han unido a sus dianas complementarias procedentes de la muestra. • Las principales técnicas de detección de la hibridación requieren del marcaje previo de las dianas: • cDNA: Stanford Microarrays. • cRNA: Affymetrix.
  63. 63. Cy5 Cy3 Arrays de cDNA Arrays de oligonucleótidos Microarrays de DNA: el paradigma de una técnica post-genómica
  64. 64. Microarrays de DNA - La tecnología Stanford Microarrays Affymetrix (GENECHIP)
  65. 65. Stanford Microarrays
  66. 66. Stanford Microarrays – Arrays de cDNA Portas de cristal Impresión de las sondas Post-procesamiento Hibridación
  67. 67. Stanford microarrays – Impresión robótica Arrays de cDNA
  68. 68. Stanford microarrays – Impresión robótica Mecánica (capilaridad) Ink-jet (microinyección)
  69. 69. Stanford microarrays – Impresión robótica • Tamaño del lunar: 100-300 µm (Ø) • Espaciado: 150-300 µm • Número lunares I. mecánica: 250-1000 lunares/cm2 • Número lunares Ink-jet: >2500 lunares/cm2 • Cantidad DNA: <10 pg DNA • Tipo de substrato: • Portas recubiertos (polylisina, silano, superaldehido, estreptavidina) • Membrana de nylon
  70. 70. Stanford microarrays – Perfiles de expresión génica Clones DNA PCR Purificar productos Impresión robótica Preparar Microarray Muestra A Aislar RNA Marcaje con Cy5 Aislar RNA y marcar Muestra B Aislar RNA Marcaje con Cy3 Mezclar, hibridar sondas y analizar datos Hibridar al microarray Lavar Analizar datos
  71. 71. Stanford microarrays – Marcaje dianas (cDNA) Fluorescencia (Cyanine 3 vs. Cyanine 5) Radioactividad (3H vs. 35S o 33P vs. 14C) Los dos marcajes más comunes son los fluorocromos de cianina: Cy3, absorción 554 nm, emisión 568 nm Cy5, absorción 650 nm, emisión 672 nm Pero también se utilizan fluorocromos Alexa: Alexa Fluor 546 Alexa Fluor 647
  72. 72. Stanford microarrays – Marcaje dianas (cDNA) Excitation Emission Excitation Emission
  73. 73. Stanford microarrays – Marcaje dianas (cDNA)
  74. 74. Retrotranscripción: Obtener cadenas de cDNA complementarias al mRNA G U A A U C C U C Transcriptasa Reversa mRNA cDNA C A T T A G G A G C A T T A G G A GC A T T A G G A G C A T T A G G A G T T A G G A G C A T T A G G A G C A T T A G G A G C A T T A G G A G C A T T A G G A G C A T T A G G A G Stanford microarrays: marcaje dianas (cDNA)
  75. 75. Cy5 Cy3 Stanford microarrays: marcaje dianas (cDNA)
  76. 76. Cy5 Cy3 Stanford microarrays: el proceso
  77. 77. mRNAmRNA cDNAcDNA Cy3-cDNACy5-cDNA Muestra A Muestra B Stanford microarrays IMPRESIÓN SONDAS
  78. 78. Stanford microarrays – Detección marcaje • Las muestras hibridadas sobre el microarray se iluminan sucesivamente con luz láser de dos colores distintos para estimular la fluorescencia de uno u otro fluorocromo. • La cantidad de mRNA unido a una muestra se puede medir por la intensidad de la fluorescencia emitida al ser iluminada por el láser del color correspondiente.
  79. 79. Stanford microarrays – Detección marcaje
  80. 80. Stanford microarrays – Detección marcaje • Si la muestra 1 se marca con rojo y la muestra 2 con verde se obtendra en cada punto del microarray que: • Si el RNA de la muestra 1 abunda más que el de la otra muestra se detecta como un punto rojo. • Si el RNA de la muestra 2 abunda más que el de la otra muestra se detecta como un punto verde. • Si ambos se expresan por igual se detecta como un punto amarillo. • Si en ninguna de las dos muestras hay mRNA se detecta como un punto negro.
  81. 81. Stanford microarrays – Detección marcaje • Las intensidades de las fluorescencias emitidas permiten determinar los niveles relativos de expresión de los genes en ambas muestras problema.
  82. 82. Stanford microarrays: problemas
  83. 83. Stanford microarrays: problemas
  84. 84. La tecnología Affymetrix
  85. 85. La tecnología Affymetrix - Genechip®
  86. 86. La tecnología Affymetrix - Sondas • Arrays de oligonucleótidos: síntesis in situ de oligonucleótidos de 25 bases sobre una superficie cuadrada de cristal (1.3 cm x 1.3 cm) mediante fotolitografía. • 11-20 parejas de sondas específicas para cada gen. • Sobrerepresentación extremos 3´de los mRNA. • Seleccionadas para maximizar las temperaturas de hibridación y la especificidad.
  87. 87. La tecnología Affymetrix - Sondas • Tamaño del lunar: ~150 µm (Ø). • Densidad: 10.000-250.000 oligonucleótidos/cm2. • Millones de copias de cada oligonucleótido específico (107-108 copias). • Un array de oligonucleótidos puede contener 400.000 sondas (aproximadamente 20.000 genes). • El array de S. cerevisae contiene 6.000 oligos, que representan todos sus genes conocidos.
  88. 88. La tecnología Affymetrix - Sondas • Para cada gen existen dos sondas: una de homología perfecta (PM, Perfect Match) de 25 bases y otra con una error deliberado/mutación (MM, MisMatch) en la zona central. • Buena calidad de datos/ baja varianza. • La presencia de numerosos genes de control permite una casi perfecta normalización entre diferentes experimentos.
  89. 89. La tecnología Affymetrix - Sondas Cada gen está representado por dos sondas: - Perfect Match (PM) - MisMatch (MM) – control hibridación PM MM PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT
  90. 90. Cada sonda tiene 25 bases 22-40 sondas por gen Parejas de sondas: • Perfect Match (PM) • MisMatch (MM) La tecnología Affymetrix - Sondas
  91. 91. Cy5 Cy3 La tecnología Affymetrix: síntesis sondas Síntesis in situ mediante fotolitografía
  92. 92. TTT T T TT T T T A A AA A A A AAA Espaciadores unidos a la superficie de cristal con grupos protectores fotolábiles Mask #1 Mask #2 La tecnología Affymetrix – Síntesis sondas
  93. 93. O O O O O Luz (desprotección) HO HO O O O T T O O O T T C C O Luz (desprotección) T T O O O C A T A T A G C T G T T C C G MMááscarascara SustratoSustrato MMááscarascara SustratoSustrato TT –– CC –– REPETIRREPETIR La tecnología Affymetrix – Síntesis sondas
  94. 94. Cy5 Cy3 La tecnología Affymetrix: marcaje dianas (cRNA) cRNA fragmentados y biotinilados aislados después de amplificación lineal
  95. 95. La tecnología Affymetrix - Equipamiento Fluidic Station Scanner
  96. 96. La tecnología Affymetrix – El proceso
  97. 97. Cy5 Cy3 La tecnología Affymetrix: el proceso
  98. 98. Cy5 Cy3 La tecnología Affymetrix: detección marcaje
  99. 99. La tecnología Affymetrix – El experimento
  100. 100. 2424µµmm Imágen de un Genechip hibridado >200,000 differentes sondas complementarias Diana cRNA de cadena sencilla marcado Sonda Oligonucleotido * * * * * 1.28cm GeneChip Célula de hibridación La tecnología Affymetrix Millones de copias de cada oligonucleótido específico (107-108 copias)
  101. 101. La tecnología Affymetrix
  102. 102. La tecnología Affymetrix – Arrays comerciales Humano Ratón Rata Arabidopsis C. elegans Perro Drosophila E. coli P. aeruginosa Plasmodium/Anopheles Vitis vinifera (uva) Xenopus laevis S. cerevisiae Pez cebra
  103. 103. Resumen Microarrays de DNA
  104. 104. Microarrays de DNA - Comparativa Stanford microarrays: Flexible, también especies sin secuenciar Requiere menor presupuesto Calidad de datos: media-alta Affymetrix: No flexible, sólo especies secuenciadas Equipamiento caro Calidad de datos: alta
  105. 105. Análisis de imágen
  106. 106. Preparación Muestra Hibridación Diseño Array Diseño Sonda PREGUNTA Diseño Experimental Compra Chip/Array RESPUESTA Análisis Avanzado de Datos Extracción de Genes Relevantes Análisis Estadístico Pre-procesamiento de datos Normalización Análisis de Imagen Microarrays de DNA
  107. 107. • Esta nueva forma de experimentar requiere de nuevas herramientas de análisis y visualización de resultados. • Cada experimento de microarrays de DNA genera una gran cantidad de datos y es preciso realizar un procesamiento apropiado de los mismos. • Transformación de las imágenes en números. Análisis de imágen
  108. 108. Análisis de imágen Escaneado -Escáner Confocal -Escáner CCD Formatos archivos imágen Análisis de imágen -Localización de los puntos -Segmentación de los puntos -Evaluación calidad de los datos
  109. 109. Análisis de imágen – Escaneado Escaneado del porta
  110. 110. Análisis de imágen – Escáner confocal Microscopía confocal
  111. 111. Cámara CCD Filtro emisión Filtro excitación Beamsplitter Luz blanca Análisis de imágen – Escáner CCD
  112. 112. Los escáners generan un archivo gráfico y el formato de archivo de imágen más común es TIFF de 16 bits. Un archivo TIFF de 16 bits describe cada pixel en una imagen con una intensidad entre 0 y 65535. Normalmente dos escáners en diferentes longitudes de onda originan dos archivos monócromos que se superponen. Canal Cy3 Canal Cy5 COMPOSICIÓN Análisis de imágen – Formato archivos imágen
  113. 113. DOS COLORES Muestra 1 marcada en rojo (Cy5) Muestra 2 marcada en verde (Cy3) Rojo: gen inducido en Muestra 1 Verde: gen inducido en Muestra 2 Amarillo:-niveles similares de expresión Rojo/Verde: ratio de expresión UN COLOR La intensidad de la expresión de un gen utilizando las sondas (PM) (en algunos casos MM- control) Los archivos gráficos generados por el escáner se analizan mediante diferentes programas informáticos. PM/MM Análisis de imágen – Formato archivos imágen
  114. 114. Hígado (Cy5) / Cerebro (Cy3) Pérfiles de expresión génica en Hígado y Cerebro Análisis de imágen – Stanford microarrays
  115. 115. Affymetrix Human Genome U95A Genechip hibridado con cerebro fetal Análisis de imágen – La tecnologia Affymetrix
  116. 116. La identificación y cuantificación de las señales de hibridación (puntos) puede realizarse de forma manual, automática y semiautomática. Se dibuja una parrilla sobre la imagen para ayudar al programa en la identificación de puntos individuales. Análisis de imágen – Localización de los puntos
  117. 117. ImaGene, QuantArrayHistogram method SpotAdaptive shape GenePix, DappleAdaptive circle ScanAlyze, GenePix, QuantArrayFixed circle Análisis de imágen – Segmentación de los puntos Clasificación de cada pixel en cada imagen como señal o ruido de fondo. Para cada punto individual obtener las medidas de: Señal, Fondo y Calidad. Método Programa
  118. 118. Intensidad de los puntos: calculo de la media de los pixel en cada punto. Corrección del ruido de fondo: local o global. Análisis de imágen – Segmentación de los puntos
  119. 119. La mayor parte de las irregularidades se pueden detectar por las siguientes medidas: Variabilidad de la intensidad Desviación del tamaño de punto Desviación de la circularidad Intensidad de señal relativa al fondo Desviación de la posición en la parrilla Análisis de imágen – Evaluación calidad de los datos En base a estas medidas, se pueden descartar puntos irregulares.
  120. 120. Análisis de imágen – Evaluación calidad de los datos
  121. 121. Field Meta Row Meta Column Row Column Gene_ID Flag Signal Mean Background Mean A 1 1 1 2 ZY030076 0 4655 463 A 1 1 1 3 ZY030066 0 15938 405 A 1 1 1 4 ZY029209 0 7441 390 A 1 1 1 5 ZY030089 0 1842 399 A 1 1 1 6 ZY030084 0 6864 401 A 1 1 1 7 ZY007003 2 471 481 A 1 1 1 8 ZY006869 0 8576 447 A 1 1 1 9 ZY007954 0 4965 405 A 1 1 1 10 ZY006866 0 2236 374 A 1 1 1 11 ZY006782 0 2088 355 A 1 1 1 12 ZY006907 0 4726 342 A 1 1 1 13 ZY006593 0 4437 338 A 1 1 1 14 ZY006850 0 917 321 Análisis de imágen – Evaluación calidad de los datos Matriz de datos de expresión génica
  122. 122. Normalización
  123. 123. Preparación Muestra Hibridación Diseño Array Diseño Sonda PREGUNTA Diseño Experimental Compra Chip/Array RESPUESTA Análisis Avanzado de Datos Extracción de Genes Relevantes Análisis Estadístico Pre-procesamiento de datos Normalización Análisis de Imagen Microarrays de DNA
  124. 124. • En general, los niveles de expresión de genes individuales se miden por: • log (R/G) • log (PM/MM) • En cualquier experimento biológico es esencial conocer el grado de reproducibilidad de las medidas. • La repetición de experimentos de microarrays es costosa. • El factor limitante puede ser la cantidad de muestra biológica. Normalización
  125. 125. • Pre-procesamiento de datos iniciales previo al análisis estadístico y análisis avanzado de los datos. • Cada valor de intensidad proviene de una imagen independiente y es necesario hacer que estos valores sean comparables. Ajuste básico: igualar la intensidad media de las imágenes. • Las intensidades no son únicamente concentraciones de mRNA, hay múltiples fuentes de variación que pueden afectar y desviar seriamente la interpretación de los resultados. Normalización
  126. 126. Normalización – Fuentes de variación Contaminación de tejidos Degradación Purificación RNA Transcripción reversa Eficiencia de amplificación Eficiencia de marcaje (Cy3/Cy5) Soporte unión DNA Spotting Otros temas relacionados con la preparación del array Corrección del fondo Segmentación de la imagen Eficiencia y especificidad de hibridación Efectos espaciales
  127. 127. (a) Después de normalización por intensidad media (b) Después de normalización por Lowess (c) Después de normalización teniendo en cuenta efectos espaciales Antes (izda.) y después normalización (dcha.). (A) BoxPlots (B) BoxPlots de subarrays (C) MA plots (ratio versus intensidad) A B C Normalización
  128. 128. Análisis Estadístico
  129. 129. Preparación Muestra Hibridación Diseño Array Diseño Sonda PREGUNTA Diseño Experimental Compra Chip/Array RESPUESTA Análisis Avanzado de Datos Extracción de Genes Relevantes Análisis Estadístico Pre-procesamiento de datos Normalización Análisis de Imagen Microarrays de DNA
  130. 130. • Prácticamente cualquier técnica estadística tiene cabida en los estudios de microarrays de DNA. • La técnica de agrupamiento de datos más popular es el análisis de conglomerados: • A partir de la matriz de datos de expresión génica. • Busca formar “grupos naturales” (conglomerados o clusters) de genes o de condiciones experimentales que permitan responder las preguntas del estudio. Análisis estadístico
  131. 131. • El análisis de conglomerados permite visualizar aquellos genes cuyos perfiles de expresión son más similares. • Para facilitar la visualización los números vuelven a convertirse en colores. Análisis estadístico
  132. 132. • Otra forma usual de representar los datos es a través de un gráfico que muestre como varia la expresión del gen entre los distintos experimentos. Análisis estadístico
  133. 133. Análisis de resultados
  134. 134. Preparación Muestra Hibridación Diseño Array Diseño Sonda PREGUNTA Diseño Experimental Compra Chip/Array RESPUESTA Análisis Avanzado de Datos Extracción de Genes Relevantes Análisis Estadístico Pre-procesamiento de datos Normalización Análisis de Imagen Microarrays de DNA
  135. 135. • Una vez extraída la información de las imágenes hay que analizar e interpretar los resultados. • ¿Cómo es posible organizar, visualizar y explorar el significado de millones de datos de expresión de miles de genes bajo cientos de condiciones distintas?. • La forma de analizar los datos dependerá de lo que se desee averiguar. Análisis de resultados
  136. 136. • Los patrones o perfiles de expresión génica se pueden estudiar desde dos puntos de vista: • A) Comparaciones enfocadas en los genes: análisis de la expresión específica de los genes en experimentos comparativos (p.e . Tejidos diferentes). • B) Comparaciones enfocadas en las muestras: estudio de las alteraciones del nivel de expresión en una determinada situación fisiológica o patológica con el objetivo de identificar los genes implicados. Análisis de resultados
  137. 137. • A) Comparaciones enfocadas en los genes: Análisis de los valores de inducción/represión en una serie de experimentos comparativos. • Esto permite la identificación de grupos de expresión, genes con patrones de expresión correlacionados. • Si un número de genes se inducen/reprimen de la misma manera en varias situaciones, es probable que: • Los genes estén regulados conjuntamente o, • Los genes estén relacionados funcionalmente (participan en el mismo proceso biológico). Análisis de resultados
  138. 138. • B) Comparaciones enfocadas en las muestras: Diferencias a nivel fenotípico son la causa de diferencias a nivel molecular que, en muchos casos, pueden detectarse midiendo los niveles de expresión génica. • Identificación de genes implicados en procesos biológicos o condiciones experimentales de interés (p.e. Tratamiento hormonal, tumores, etc.). • También se pueden identificar perfiles de expresión de genes con capacidad de diagnóstico. Análisis de resultados
  139. 139. Análisis de resultados
  140. 140. • Estudios de expresión diferencial de genes • Análisis de patógenos • Identificación de enfermedades genéticas complejas • Detección de mutaciones y de Polimorfismos simples de nucleótido (SNPs) • Farmacogenómica • Diseño y descubrimiento de fármacos • Estudios toxicológicos Análisis de resultados - Aplicaciones
  141. 141. Análisis de resultados - Aplicaciones Estudio de expresión diferencial de genes Identificación de genes implicados en procesos biológicos de interés
  142. 142. Análisis de resultados - Aplicaciones Estudio de distintos genotipos / Farmacogenómica Respuesta a fármacos, toxicidad, predisposición desarrollo enfermedades, etc.

×