SlideShare una empresa de Scribd logo
BIOLOGÍA MOLECULAR Se encarga del estudio de la vida a nivel molecular. Especialmente explica cómo son los mecanismos de expresión de la información genética contenida en el ADN. ESTRUCTURA DEL ADN:
 
RELACIÓN ENTRE LOS GENES Y LAS PROTEÍNAS Este es uno de los descubrimientos más importantes del siglo XX y de toda la Historia de la Ciencia y de la Humanidad: DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR Este dogma ya no tiene validez ya que ciertos virus como el del SIDA tienen ARN de material genético que usan para fabricar ADN que se inserte en el cromosoma de la célula a la que infectan. Transcriptasa inversa ADN ARN Proteínas ADN ARN Proteínas
Esto significa que el ADN es capaz de sacar copias idénticas de sí mismo Esto significa que el ADN es capaz de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) Esto significa que el mensaje de los genes, en forma de ARN, sirve para formar proteínas Replicación Transcripción Traducción Estos son los nombres de estos procesos. Veamos cómo son… ADN ARN Proteínas
Replicación ADN El ADN es capaz de sacar copias idénticas de sí mismo Esto ocurre antes de que la célula se divida. Esto es lógico, puesto que las células hijas deben llevar toda la información genética.
ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando va a copiarse el ADN ocurre esto: ATTCGCGGCATTAATCCG ATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGC TATGGATCATGGCGCCTAAATTTGTACCTAG 1º se abre la doble cadena: 2º se van añadiendo nuevas letras,  de forma complementaria : ATTCGCGGCATTAATCCG ATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGC TATGGATCATGGCGCCTAAATTTGTACCTAG C T C C A A ATACCTAGT T T GTACCTAG La doble cadena se terminará abriendo del todo
3º Continúa el proceso de añadir “letras” hasta formarse dos doble cadenas hijas, idénticas a la original: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG En rojo se muestran las nuevas “letras” que se han ido uniendo de la manera “correcta” o complementaria (A con T y C con G). De este modo, cada una de las cadenas originales ha servido de MOLDE para crear otra por lo que se dice que la  REPLICACIÓN DEL ADN ES SEMICONSERVATIVA A veces se producen errores en este proceso, dando lugar a genes alterados, distintos al original. Son las  MUTACIONES .
Estos son algunos de los dibujos de la replicación o duplicación del ADN que pueden encontrarse en Internet:
REPLICACIÓN DEL  ADN
REPLICACIÓN DEL  ADN
Transcripción ADN ARN Los genes del ADN son capaces de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) GGCGCCUAAAUUUG Las cadenas de ARN son más cortas que las de ADN y están formadas por una cadena simple (no doble como ocurría con el ADN) La letra U (Uracilo) sustituye a la T en el ARN
1º se abre una parte de la doble cadena de ADN: 2º se copia la información del gen añadiendo letras, de forma complementaria, para formar ARN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando se transcribe el ADN a ARN ocurre esto: ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA  TAAGCGCCGTAATTAGGCTATGGATCAT  TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG La doble cadena de ADN  NO  se terminará abriendo del todo. Sólo se transcribe a ARN la información de algunos genes. ADN ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA GGCGCCUAAAUUUG TAAGCGCCGTAATTAGGCTATGGATCAT  TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG C G U A La letra U (Uracilo) sustituye a la T en el ARN ARN Gen trascrito a ARN Gen que va a transcribirse Transcripción
Transcripción GGCGCCUAAAUUUG Finalmente, el ARN sale fuera del núcleo. Gracias a los ribosomas, en el citoplasma, la información que lleva el ARN es “leída” por los ribosomas para formar proteínas en el proceso llamado TRADUCCIÓN o SÍNTESIS DE PROTEÍNAS ARN ribosomas Este ARN también se llama  ARN mensajero , porque lleva un mensaje para fabricar proteínas. Núcleo celular Citoplasma Clic aquí para ver un vídeo de la Transcripción
Ocurre en el citoplasma celular, fuera del núcleo. La información del ARN mensajero es “leída” por los ribosomas para fabricar proteínas. Cada grupo de tres bases (o “letras”) del ARN mensajero determina la unión, a la cadena proteica, de uno de los 20 aminoácidos que existen ( CÓDIGO GENÉTICO ) Clic aquí para ver un vídeo de la traducción o síntesis de proteínas Traducción
TRADUCCIÓN O SÍNTESIS DE PROTEÍNAS
LAS   MUTACIONES Son alteraciones del material genético. POSITIVO : Gracias a ellas se añade variabilidad genética a los individuos de una población con lo que se puede dar la evolución de las especies. NEGATIVO : algunas son perjudiciales para el individuo que las tiene, incluso pueden producirle la muerte.  ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],EUPLOIDÍAS (afectan al número de juegos cromosómicos) Monoploidías: un solo juego de cromosomas (n) Poliploidías: más de dos juegos de cromosomas (3n, 4n…) ANEUPLOIDÍAS (falta o sobra algún cromosoma) Monosomías: un cromosoma de menos (2n-1) Trisomías: un cromosoma de más (2n+1) Tetrasomías: dos cromosomas de más (2n+2)
ANEUPLOIDÍAS HUMANAS MÁS FRECUENTES ALTERACIÓN SÍNDROME CUADRO CLÍNICO Trisomía del 21  (1,5/10000 nacidos) Down Retraso mental Rasgos faciales mongoloides Alteraciones oculares, cardiacas, braquicefalia Trisomía del 18 (1/6667 nacidos) Edwards Deficiencia mental profunda Malformaciones renales y cardiacas Trisomía del 13 (1/4600 nacidos) Patau Deficiencia mental profunda Malformaciones cardiacas, genitales, cerebrales y renales. XO (0,3/1000 nacidos) Turner Genitales infantiles Esterilidad Estatura baja XXX (1/1000 nacidos) Triple X Retraso mental. Alteraciones neuropsíquicas XXY (1,4/10000 nacidos) Klinefelter Genitales pequeños Retraso mental moderado XYY (1/2000 nacidos) Duplo Y Trastornos de conducta (agresividad) Estatura elevada
AMNIOCENTESIS Prueba diagnóstica para detectar mutaciones cromosómicas estructurales y numéricas en el embrión
 
CARIOTIPO  HUMANO
INGENIERÍA GENÉTICA : Son las técnicas que permiten manipular el ADN , modificando el genoma de los seres vivos.  ADN RECOMBINANTE : Es ADN que tiene distinta procedencia. Por ejemplo es introducir ADN de un humano (gen de la insulina) en una bacteria para que produzca esta hormona para su uso por los diabéticos. Para ellos es necesario dos cosas: 1 . Cortar el ADN e introducir en el genoma la secuencia de ADN  que quiero. Esto se hace gracias a las  ENDONUCLEASAS DE RESTRICCIÓN  ( reconocen y cortan secuencias específicas de ADN) De esta manera podemos introducir en ese hueco el nuevo ADN.
2 .  Amplificación del ADN : es necesario para poder trabajar con el ADN fabricar muchas copias de la secuencia de ADN que queremos introducir. Esto se consigue gracias a la  PCR (reacción en cadena de la polimerasa)
PROYECTO GENOMA HUMANO Se trata del proyecto de secuenciar todo el ADN contenido en los 16 cromosomas humanos. Esta tarea se finaliza el 26/06/2000 después de 10 años de investigación. ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
BIOTECNOLOGÍA La  biotecnología  es un campo de aplicación de la biología que utiliza organismos vivos en beneficio humano. Hay dos tipos de biotecnología: Biotecnología tradicional Biotecnología actual Basada en el  uso de microorganismos. Basada en los logros obtenidos por la  ingeniería genética . Aplicaciones: 1. Alimentación. 2. Farmacia e industria química. 3. Medio ambiente. Aplicaciones: 1. Agricultura y ganadería 2. Aplicaciones biosanitarias.
Desde tiempos remotos, y sin conocer su fundamento, el ser humano ha utilizado procesos biotecnológicos para fabricar productos de uso común. Se basa en aprovecharnos del proceso de  FERMENTACIÓN  que realizan las levaduras y algunas bacterias BIOTECNOLOGÍA TRADICIONAL 1. Alimentación Bebidas alcohólicas: Lácteos: Pan: Es un producto biotecnológico en el que participa la  levadura  Saccharomyces cerevisiae . A partir de la leche y gracias a la acción de algunas  bacterias, se fabrican productos lácteos como el queso y el yogur. Se producen por la  fermentación realizada por  Saccharomyces cerevisiae. Esta levadura utiliza los glúcidos de diversos productos (mosto, malta, etcétera).
BIOTECNOLOGÍA TRADICIONAL Además de algunos alimentos, hay otros muchos productos obtenidos por biotecnología: 2. Farmacia e industria química Productos químicos industriales Antibióticos : Vacunas: Las vacunas son microorganismos (atenuados o muertos) o parte de ellos sin virulencia. Los antibióticos son producidos por ciertos microorganismos como los mohos (Penicilium) Algunos microorganismos producen sustancias que se utilizan en la industria.
BIOTECNOLOGÍA TRADICIONAL La utilización de  microorganismos  también se realiza en actividades relacionadas con la conservación del medio ambiente: 3. Medio ambiente Degradación de hidrocarburos : Reciclaje de agua: Residuos : La descomposición de la materia orgánica de las basuras se realiza mediante microorganismos y se transforma la materia orgánica en  COMPOST  (abono) En las plantas de tratamiento de aguas se utiliza la acción bacteriana que se alimentan de la materia orgánica del agua reduciendo significativamente la contaminación de las aguas residuales . Algunas bacterias son capaces de degradar hidrocarburos, y son muy útiles en la lucha contra vertidos de petróleo.
BIOTECNOLOGÍA ACTUAL •  Clonación Aplicaciones agrícolas y ganaderas I clonación de organismos: Clonación génica: 1. Se fragmenta el ADN con enzimas  de restricci ón y se aisla el gen. 2. Se obtiene un  vector bacteriano. 3. Se forma un ADN  Recombinante con la  participaci ón de una  enzima ligasa 4. Se introduce en la c élula hospedadora. 5. Se selecciona el clon deseado y se producen las c élulas. 1. Se extrae un  óvulo  inmaduro de una oveja  y se elimina su núcleo. 2. Se sustituye el n úcleo del  óvulo por el de una célula  somática de otra oveja  mediante fusión celular. 4. La oveja que nace es  id éntica a la oveja donadora  del núcleo. ( Dolly 1996) 3. Se implanta el embri ón  obtenido en una tercera  oveja («madre de alquiler»)  que lleva el embarazo. ,[object Object],[object Object],[object Object],[object Object],[object Object],Consiste en obtener  varias copias de un gen.  Produce  organismos genéticamente iguales.
BIOTECNOLOGÍA ACTUAL •  Organismos transgénicos Son  animales o plantas  con  genes  procedentes de  otro organismo , que  adquieren características  que no tenía la especie original (resistencia a plagas, mayor producción de leche, crecimiento más rápido, etcétera). Aplicaciones agrícolas y ganaderas II Proceso de obtención de una planta transgénica resistente a insectos. 1. Se corta el ADN y  se selecciona el fragmento  que porta el gen para la  s íntesis de una sustancia  insecticida. 2. Se introduce el ADN de  la bacteria en la c élula  vegetal. 3. Se inserta el material  gen ético de la bacteria en  el ADN de la planta. 4. Se cultivan las plantas  en el laboratorio. 5. Se obtienen plantas  resistentes al insecto.
BIOTECNOLOGÍA ACTUAL La salud humana es la gran beneficiada de la biotecnología actual. Hay grandes esperanzas sobre las aportaciones de la  ingeniería genética . Aplicaciones Biosanitarias Correcci ón genética en el ser humano. 1. Se realiza un cultivo  celular con el  óvulo fecundado. 4. Se extrae el n úcleo de la  célula corregida y se introduce  en un óvulo sin núcleo. 2. Se introduce en el cultivo un  vector con el gen sano. 3. Se obtiene un cultivo  transformado. Condiciones de la terapia génica •   Que la enfermedad esté causada por una anomalía génica. •   Que se haya localizado el gen defectuoso. •   Que se pueda clonar el gen «normal» no defectuoso. •   Que la introducción de este gen sea técnicamente posible. •   Que el gen no provoque reacciones adversas. Aplicaciones de la Biotecnología en la medicina •   Diagnóstico de enfermedades causadas por genes defectuosos. •   Obtención de sustancias (hormonas, enzimas, proteínas…) como la insulina. •   Prevención de enfermedades genéticas (la corrección genética en el ser humano).
REPRODUCCIÓN ASISTIDA ¿En qué consiste? Son las técnicas aplicadas para solucionar los problemas de esterilidad en la pareja cuando lleven más de 12 meses intentando tener descendencia. Causas de la esterilidad HOMBRES : fatiga, estrés, exceso de alcohol y drogas, causas orgánicas (criptorquidea, aplasia germinal…), malformaciones o infecciones. MUJERES : Edad, desnutrición, anemia, malformaciones de útero y ovarios, alteraciones endocrinas, infecciones…
TÉCNICAS DE REPRODUCCIÓN ASISTIDA INSEMINACIÓN ARTIFICIAL . Es la introducción del semen previamente tratado en el útero. La tasa de embarazo es de 20-25 % por intento. ,[object Object],[object Object],[object Object],[object Object],[object Object]
Fertilización in vitro FIV Consiste en la unión del óvulo y espermatozoide en el laboratorio y la posterior implantación del embrión generado. ,[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Microinyección espermática Embrión de pocas células Diagnóstico preimplantacional Consiste en la realización de un estudio genético de los embriones previo a la implantación para seleccionar aquellos libres de ciertas patologías que son imposibles de curar al nacer. Es necesario informar a las autoridades sanitarias.
ANIMACIÓN 3D FIV
MICROINYECCIÓN ESPERMÁTICA INTRACITOPLÁSMICA
Células madre Son células que tiene la capacidad de multiplicarse y diferenciarse en células especializadas  (células de los diferentes tejidos) ,[object Object],[object Object],[object Object],Totipotentes : originan un individuo adulto (cualquier tipo celular) En embriones de menos de 5 días. Pluripotentes : originan solo algunos tipos celulares. En embriones de 5-14 días.
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
 
Video:  células madre

Más contenido relacionado

La actualidad más candente

Metabolismo y enzimas
Metabolismo y enzimasMetabolismo y enzimas
Metabolismo y enzimas
Miriam Valle
 
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓNTema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
josemanuel7160
 
18. transporte de electrones y fosforilacion oxidativa
18. transporte de electrones y fosforilacion oxidativa18. transporte de electrones y fosforilacion oxidativa
18. transporte de electrones y fosforilacion oxidativa
Neils Jean Pol Loayza Delgado
 
Glucogenogenesis
GlucogenogenesisGlucogenogenesis
Glucogenogenesis
Jesús Mendivil
 
Metabolismo de Carbohidratos
Metabolismo de CarbohidratosMetabolismo de Carbohidratos
Metabolismo de Carbohidratos
Kath Ruiz Halkett
 
Rutas Metabolicas
Rutas MetabolicasRutas Metabolicas
Rutas Metabolicas
Andres Tavizon
 
Vías de las pentosas fosfato
Vías de las pentosas fosfatoVías de las pentosas fosfato
Vías de las pentosas fosfato
Bárbara Soto Dávila
 
Curso Bioquímica 20-Ácidos grasos
Curso Bioquímica 20-Ácidos grasosCurso Bioquímica 20-Ácidos grasos
Curso Bioquímica 20-Ácidos grasos
Antonio E. Serrano
 
Ciclo de krebs
Ciclo de krebsCiclo de krebs
Ciclo de krebs
Wbiliado Olàn Reyes
 
Oxidacion-de-acidos-grasos
 Oxidacion-de-acidos-grasos Oxidacion-de-acidos-grasos
Oxidacion-de-acidos-grasos
Bryan Monjarrez Herrera
 
Clase pentosas
Clase pentosasClase pentosas
Clase pentosas
Roma29
 
Historia de la Biotecnología y sus aplicaciones
Historia de la Biotecnología y sus aplicacionesHistoria de la Biotecnología y sus aplicaciones
Historia de la Biotecnología y sus aplicaciones
josecito91
 
Teorias evolucionistas
Teorias evolucionistasTeorias evolucionistas
Teorias evolucionistas
Denisse Ttito Raymundo
 
Glucolisis
GlucolisisGlucolisis
Oxidacion de carbohidratos
Oxidacion de carbohidratosOxidacion de carbohidratos
Oxidacion de carbohidratos
PUCE SEDE IBARRA
 
Curso Bioquímica 14-Glicólisis
Curso Bioquímica 14-GlicólisisCurso Bioquímica 14-Glicólisis
Curso Bioquímica 14-Glicólisis
Antonio E. Serrano
 
Carbo1
Carbo1Carbo1
Carbo1
julygc
 
Derivados de ls monosacaridos
Derivados de ls monosacaridosDerivados de ls monosacaridos
Derivados de ls monosacaridos
cabezaderemolacha
 
Regulacion enzimatica
Regulacion enzimaticaRegulacion enzimatica
Regulacion enzimatica
DucHesiitha CamacHoo
 
sintesis acidosgrasos
sintesis acidosgrasossintesis acidosgrasos
sintesis acidosgrasos
freddynetas
 

La actualidad más candente (20)

Metabolismo y enzimas
Metabolismo y enzimasMetabolismo y enzimas
Metabolismo y enzimas
 
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓNTema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
Tema 12. GENÉTICA MOLECULAR. REPLICACIÓN , TRANSCRIPCIÓN Y TRADUCCIÓN
 
18. transporte de electrones y fosforilacion oxidativa
18. transporte de electrones y fosforilacion oxidativa18. transporte de electrones y fosforilacion oxidativa
18. transporte de electrones y fosforilacion oxidativa
 
Glucogenogenesis
GlucogenogenesisGlucogenogenesis
Glucogenogenesis
 
Metabolismo de Carbohidratos
Metabolismo de CarbohidratosMetabolismo de Carbohidratos
Metabolismo de Carbohidratos
 
Rutas Metabolicas
Rutas MetabolicasRutas Metabolicas
Rutas Metabolicas
 
Vías de las pentosas fosfato
Vías de las pentosas fosfatoVías de las pentosas fosfato
Vías de las pentosas fosfato
 
Curso Bioquímica 20-Ácidos grasos
Curso Bioquímica 20-Ácidos grasosCurso Bioquímica 20-Ácidos grasos
Curso Bioquímica 20-Ácidos grasos
 
Ciclo de krebs
Ciclo de krebsCiclo de krebs
Ciclo de krebs
 
Oxidacion-de-acidos-grasos
 Oxidacion-de-acidos-grasos Oxidacion-de-acidos-grasos
Oxidacion-de-acidos-grasos
 
Clase pentosas
Clase pentosasClase pentosas
Clase pentosas
 
Historia de la Biotecnología y sus aplicaciones
Historia de la Biotecnología y sus aplicacionesHistoria de la Biotecnología y sus aplicaciones
Historia de la Biotecnología y sus aplicaciones
 
Teorias evolucionistas
Teorias evolucionistasTeorias evolucionistas
Teorias evolucionistas
 
Glucolisis
GlucolisisGlucolisis
Glucolisis
 
Oxidacion de carbohidratos
Oxidacion de carbohidratosOxidacion de carbohidratos
Oxidacion de carbohidratos
 
Curso Bioquímica 14-Glicólisis
Curso Bioquímica 14-GlicólisisCurso Bioquímica 14-Glicólisis
Curso Bioquímica 14-Glicólisis
 
Carbo1
Carbo1Carbo1
Carbo1
 
Derivados de ls monosacaridos
Derivados de ls monosacaridosDerivados de ls monosacaridos
Derivados de ls monosacaridos
 
Regulacion enzimatica
Regulacion enzimaticaRegulacion enzimatica
Regulacion enzimatica
 
sintesis acidosgrasos
sintesis acidosgrasossintesis acidosgrasos
sintesis acidosgrasos
 

Similar a Biología molecular ing. genética biotecnología reprod asistida

Ingeniería genética
Ingeniería genéticaIngeniería genética
Ingeniería genética
merchealari
 
Tema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genéticaTema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genética
Eduardo Gómez
 
Genes y manipulación genética
Genes y manipulación genéticaGenes y manipulación genética
Genes y manipulación genética
trinidadsotonavarro
 
Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1
CLAUDIACRISTAL
 
La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10
Alberto Hernandez
 
Genética
GenéticaGenética
Genética
Cristinabarcala
 
Presentación acidos nucleicos
Presentación acidos nucleicosPresentación acidos nucleicos
Presentación acidos nucleicos
Kathe Fernandez
 
B A S E S M O L E C U L A R E S D E L A I N G E N I E RÍ A G E NÉ T I C ...
B A S E S  M O L E C U L A R E S  D E  L A  I N G E N I E RÍ A  G E NÉ T I C ...B A S E S  M O L E C U L A R E S  D E  L A  I N G E N I E RÍ A  G E NÉ T I C ...
B A S E S M O L E C U L A R E S D E L A I N G E N I E RÍ A G E NÉ T I C ...
jaival
 
Unidad 4 Revolución genética
Unidad 4   Revolución genéticaUnidad 4   Revolución genética
Unidad 4 Revolución genética
Elena
 
4. la revolución genética (parte iii)
4. la revolución genética (parte iii)4. la revolución genética (parte iii)
4. la revolución genética (parte iii)
FRANCISCO JAVIER RUBIO RODRIGUEZ
 
Del DNA a la ingeniería genética
Del DNA a la ingeniería genéticaDel DNA a la ingeniería genética
Del DNA a la ingeniería genética
INSTITUTO TECNOLÓGICO DE SONORA
 
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
juliomsanjuan
 
Tecnología del ADN Recombinante
Tecnología del ADN RecombinanteTecnología del ADN Recombinante
Tecnología del ADN Recombinante
Cristela
 
Tecnología del ADN Recombinante 2
Tecnología del ADN Recombinante 2Tecnología del ADN Recombinante 2
Tecnología del ADN Recombinante 2
Cristela
 
INFORME - EXTRACCION DEL ADN DEL PLATANO.pdf
INFORME - EXTRACCION DEL ADN DEL PLATANO.pdfINFORME - EXTRACCION DEL ADN DEL PLATANO.pdf
INFORME - EXTRACCION DEL ADN DEL PLATANO.pdf
CarmenPaye
 
Secuenciación del ADN - Lectura del adn de los organismos
Secuenciación del ADN - Lectura del adn de los organismosSecuenciación del ADN - Lectura del adn de los organismos
Secuenciación del ADN - Lectura del adn de los organismos
Enzo Olivera Laureano
 
Genes y biotecnología eso
Genes y biotecnología esoGenes y biotecnología eso
Genes y biotecnología eso
Diego Gonzalez Cabrera
 
BiotecnologíA
BiotecnologíABiotecnologíA
BiotecnologíA
sallealmeria
 
Clase 01 Biotecnologia - Ingeniería Genética
Clase 01 Biotecnologia - Ingeniería Genética Clase 01 Biotecnologia - Ingeniería Genética
Clase 01 Biotecnologia - Ingeniería Genética
Edgar Fernando Salcedo Ramirez
 
Proyecto genoma humano
Proyecto genoma humanoProyecto genoma humano
Proyecto genoma humano
Elvis Jara
 

Similar a Biología molecular ing. genética biotecnología reprod asistida (20)

Ingeniería genética
Ingeniería genéticaIngeniería genética
Ingeniería genética
 
Tema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genéticaTema 16: El ADN y la ingeniería genética
Tema 16: El ADN y la ingeniería genética
 
Genes y manipulación genética
Genes y manipulación genéticaGenes y manipulación genética
Genes y manipulación genética
 
Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1Equipo 3 genomahumano_3º1
Equipo 3 genomahumano_3º1
 
La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10
 
Genética
GenéticaGenética
Genética
 
Presentación acidos nucleicos
Presentación acidos nucleicosPresentación acidos nucleicos
Presentación acidos nucleicos
 
B A S E S M O L E C U L A R E S D E L A I N G E N I E RÍ A G E NÉ T I C ...
B A S E S  M O L E C U L A R E S  D E  L A  I N G E N I E RÍ A  G E NÉ T I C ...B A S E S  M O L E C U L A R E S  D E  L A  I N G E N I E RÍ A  G E NÉ T I C ...
B A S E S M O L E C U L A R E S D E L A I N G E N I E RÍ A G E NÉ T I C ...
 
Unidad 4 Revolución genética
Unidad 4   Revolución genéticaUnidad 4   Revolución genética
Unidad 4 Revolución genética
 
4. la revolución genética (parte iii)
4. la revolución genética (parte iii)4. la revolución genética (parte iii)
4. la revolución genética (parte iii)
 
Del DNA a la ingeniería genética
Del DNA a la ingeniería genéticaDel DNA a la ingeniería genética
Del DNA a la ingeniería genética
 
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
Genetica molecular 1º parte (adn, replicación, transcripción y traducción)
 
Tecnología del ADN Recombinante
Tecnología del ADN RecombinanteTecnología del ADN Recombinante
Tecnología del ADN Recombinante
 
Tecnología del ADN Recombinante 2
Tecnología del ADN Recombinante 2Tecnología del ADN Recombinante 2
Tecnología del ADN Recombinante 2
 
INFORME - EXTRACCION DEL ADN DEL PLATANO.pdf
INFORME - EXTRACCION DEL ADN DEL PLATANO.pdfINFORME - EXTRACCION DEL ADN DEL PLATANO.pdf
INFORME - EXTRACCION DEL ADN DEL PLATANO.pdf
 
Secuenciación del ADN - Lectura del adn de los organismos
Secuenciación del ADN - Lectura del adn de los organismosSecuenciación del ADN - Lectura del adn de los organismos
Secuenciación del ADN - Lectura del adn de los organismos
 
Genes y biotecnología eso
Genes y biotecnología esoGenes y biotecnología eso
Genes y biotecnología eso
 
BiotecnologíA
BiotecnologíABiotecnologíA
BiotecnologíA
 
Clase 01 Biotecnologia - Ingeniería Genética
Clase 01 Biotecnologia - Ingeniería Genética Clase 01 Biotecnologia - Ingeniería Genética
Clase 01 Biotecnologia - Ingeniería Genética
 
Proyecto genoma humano
Proyecto genoma humanoProyecto genoma humano
Proyecto genoma humano
 

Más de OSCAR MALO

Aparato digestivo
Aparato digestivoAparato digestivo
Aparato digestivo
OSCAR MALO
 
Aparatos circulatorio y excretor
Aparatos circulatorio y excretorAparatos circulatorio y excretor
Aparatos circulatorio y excretor
OSCAR MALO
 
Las plantas
Las plantasLas plantas
Las plantas
OSCAR MALO
 
Aparato respiratorio
Aparato respiratorioAparato respiratorio
Aparato respiratorio
OSCAR MALO
 
Vertebrados 1ºeso
Vertebrados 1ºesoVertebrados 1ºeso
Vertebrados 1ºeso
OSCAR MALO
 
Animales invertebrados 1º eso
Animales invertebrados 1º esoAnimales invertebrados 1º eso
Animales invertebrados 1º eso
OSCAR MALO
 
Tutorial edmodo 2013 manual para profesor
Tutorial edmodo 2013 manual para profesorTutorial edmodo 2013 manual para profesor
Tutorial edmodo 2013 manual para profesor
OSCAR MALO
 
Aves y mamíferos
Aves y mamíferosAves y mamíferos
Aves y mamíferos
OSCAR MALO
 
Anfibios y reptiles
Anfibios y reptilesAnfibios y reptiles
Anfibios y reptiles
OSCAR MALO
 
Tejidos animales
Tejidos animalesTejidos animales
Tejidos animales
OSCAR MALO
 
Tejidos vegetales
Tejidos vegetalesTejidos vegetales
Tejidos vegetales
OSCAR MALO
 
Funciones básicas de las células
Funciones básicas de las célulasFunciones básicas de las células
Funciones básicas de las células
OSCAR MALO
 
La herencia biológica 4º eso
La herencia biológica 4º esoLa herencia biológica 4º eso
La herencia biológica 4º eso
OSCAR MALO
 
La salud y la enfermedad
La salud y la enfermedadLa salud y la enfermedad
La salud y la enfermedad
OSCAR MALO
 
Modelado kárstico 4ºeso
Modelado kárstico 4ºesoModelado kárstico 4ºeso
Modelado kárstico 4ºeso
OSCAR MALO
 
Evolución humana ppt
Evolución humana pptEvolución humana ppt
Evolución humana ppt
OSCAR MALO
 
Paau Nueva Normativa
Paau Nueva NormativaPaau Nueva Normativa
Paau Nueva Normativa
OSCAR MALO
 

Más de OSCAR MALO (17)

Aparato digestivo
Aparato digestivoAparato digestivo
Aparato digestivo
 
Aparatos circulatorio y excretor
Aparatos circulatorio y excretorAparatos circulatorio y excretor
Aparatos circulatorio y excretor
 
Las plantas
Las plantasLas plantas
Las plantas
 
Aparato respiratorio
Aparato respiratorioAparato respiratorio
Aparato respiratorio
 
Vertebrados 1ºeso
Vertebrados 1ºesoVertebrados 1ºeso
Vertebrados 1ºeso
 
Animales invertebrados 1º eso
Animales invertebrados 1º esoAnimales invertebrados 1º eso
Animales invertebrados 1º eso
 
Tutorial edmodo 2013 manual para profesor
Tutorial edmodo 2013 manual para profesorTutorial edmodo 2013 manual para profesor
Tutorial edmodo 2013 manual para profesor
 
Aves y mamíferos
Aves y mamíferosAves y mamíferos
Aves y mamíferos
 
Anfibios y reptiles
Anfibios y reptilesAnfibios y reptiles
Anfibios y reptiles
 
Tejidos animales
Tejidos animalesTejidos animales
Tejidos animales
 
Tejidos vegetales
Tejidos vegetalesTejidos vegetales
Tejidos vegetales
 
Funciones básicas de las células
Funciones básicas de las célulasFunciones básicas de las células
Funciones básicas de las células
 
La herencia biológica 4º eso
La herencia biológica 4º esoLa herencia biológica 4º eso
La herencia biológica 4º eso
 
La salud y la enfermedad
La salud y la enfermedadLa salud y la enfermedad
La salud y la enfermedad
 
Modelado kárstico 4ºeso
Modelado kárstico 4ºesoModelado kárstico 4ºeso
Modelado kárstico 4ºeso
 
Evolución humana ppt
Evolución humana pptEvolución humana ppt
Evolución humana ppt
 
Paau Nueva Normativa
Paau Nueva NormativaPaau Nueva Normativa
Paau Nueva Normativa
 

Último

REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
carla526481
 
Presentación simple corporativa degradado en violeta blanco.pdf
Presentación simple corporativa degradado en violeta blanco.pdfPresentación simple corporativa degradado en violeta blanco.pdf
Presentación simple corporativa degradado en violeta blanco.pdf
eleandroth
 
1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf
1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf
1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf
MiNeyi1
 
explorando los secretos de la fotosíntesis
explorando los secretos de la fotosíntesisexplorando los secretos de la fotosíntesis
explorando los secretos de la fotosíntesis
CristianRodrguez692429
 
Presentación de proyecto en acuarela moderna verde.pdf
Presentación de proyecto en acuarela moderna verde.pdfPresentación de proyecto en acuarela moderna verde.pdf
Presentación de proyecto en acuarela moderna verde.pdf
LuanaJaime1
 
TRABAJO FINAL CADENA, DE SUMINISTROS.pdf
TRABAJO FINAL CADENA, DE SUMINISTROS.pdfTRABAJO FINAL CADENA, DE SUMINISTROS.pdf
TRABAJO FINAL CADENA, DE SUMINISTROS.pdf
RojasEstradaEsther
 
Compartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdf
Compartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdfCompartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdf
Compartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdf
JimmyDeveloperWebAnd
 
CORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZA
CORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZACORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZA
CORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZA
Sandra Mariela Ballón Aguedo
 
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Shirley Vásquez Esparza
 
proyectoszona21para el logro de real.pptx
proyectoszona21para el logro de real.pptxproyectoszona21para el logro de real.pptx
proyectoszona21para el logro de real.pptx
ChristianGmez48
 
Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...
Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...
Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...
Juan Martín Martín
 
La orientación educativa en el proceso de enseñanza-aprendizaje.pptx
La orientación educativa en el proceso de enseñanza-aprendizaje.pptxLa orientación educativa en el proceso de enseñanza-aprendizaje.pptx
La orientación educativa en el proceso de enseñanza-aprendizaje.pptx
PaolaAlejandraCarmon1
 
CINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍA
CINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍACINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍA
CINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍA
Fernández Gorka
 
CALCULO DE AMORTIZACION DE UN PRESTAMO.pdf
CALCULO DE AMORTIZACION DE UN PRESTAMO.pdfCALCULO DE AMORTIZACION DE UN PRESTAMO.pdf
CALCULO DE AMORTIZACION DE UN PRESTAMO.pdf
cesareduvr95
 
Programación de la XI semana cultural del CEIP Alfares
Programación de la XI semana cultural del CEIP AlfaresProgramación de la XI semana cultural del CEIP Alfares
Programación de la XI semana cultural del CEIP Alfares
Alfaresbilingual
 
ANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACION
ANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACIONANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACION
ANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACION
carla466417
 
DIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdfDIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdf
Alfaresbilingual
 
Ejercicios-de-Calculo-de-Goteo-Enfermeria1-1.ppt
Ejercicios-de-Calculo-de-Goteo-Enfermeria1-1.pptEjercicios-de-Calculo-de-Goteo-Enfermeria1-1.ppt
Ejercicios-de-Calculo-de-Goteo-Enfermeria1-1.ppt
eliseo membreño
 
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdfEvaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
EfranMartnez8
 
MANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdf
MANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdfMANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdf
MANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdf
IvanAguilarGalvan1
 

Último (20)

REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
 
Presentación simple corporativa degradado en violeta blanco.pdf
Presentación simple corporativa degradado en violeta blanco.pdfPresentación simple corporativa degradado en violeta blanco.pdf
Presentación simple corporativa degradado en violeta blanco.pdf
 
1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf
1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf
1.- manual-para-la-creacion-33-dias-de-manifestacion-ulises-sampe.pdf
 
explorando los secretos de la fotosíntesis
explorando los secretos de la fotosíntesisexplorando los secretos de la fotosíntesis
explorando los secretos de la fotosíntesis
 
Presentación de proyecto en acuarela moderna verde.pdf
Presentación de proyecto en acuarela moderna verde.pdfPresentación de proyecto en acuarela moderna verde.pdf
Presentación de proyecto en acuarela moderna verde.pdf
 
TRABAJO FINAL CADENA, DE SUMINISTROS.pdf
TRABAJO FINAL CADENA, DE SUMINISTROS.pdfTRABAJO FINAL CADENA, DE SUMINISTROS.pdf
TRABAJO FINAL CADENA, DE SUMINISTROS.pdf
 
Compartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdf
Compartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdfCompartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdf
Compartir p4s.co Pitch Hackathon Template Plantilla final.pptx-2.pdf
 
CORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZA
CORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZACORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZA
CORREOS SEGUNDO 2024 HONORIO DELGADO ESPINOZA
 
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
 
proyectoszona21para el logro de real.pptx
proyectoszona21para el logro de real.pptxproyectoszona21para el logro de real.pptx
proyectoszona21para el logro de real.pptx
 
Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...
Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...
Soluciones Examen de Selectividad. Geografía junio 2024 (Convocatoria Ordinar...
 
La orientación educativa en el proceso de enseñanza-aprendizaje.pptx
La orientación educativa en el proceso de enseñanza-aprendizaje.pptxLa orientación educativa en el proceso de enseñanza-aprendizaje.pptx
La orientación educativa en el proceso de enseñanza-aprendizaje.pptx
 
CINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍA
CINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍACINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍA
CINE COMO RECURSO DIDÁCTICO para utilizar en TUTORÍA
 
CALCULO DE AMORTIZACION DE UN PRESTAMO.pdf
CALCULO DE AMORTIZACION DE UN PRESTAMO.pdfCALCULO DE AMORTIZACION DE UN PRESTAMO.pdf
CALCULO DE AMORTIZACION DE UN PRESTAMO.pdf
 
Programación de la XI semana cultural del CEIP Alfares
Programación de la XI semana cultural del CEIP AlfaresProgramación de la XI semana cultural del CEIP Alfares
Programación de la XI semana cultural del CEIP Alfares
 
ANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACION
ANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACIONANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACION
ANALISIS CRITICO DEL PENSAMIENTO COLONIAL Y DESCOLONIZACION
 
DIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdfDIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdf
 
Ejercicios-de-Calculo-de-Goteo-Enfermeria1-1.ppt
Ejercicios-de-Calculo-de-Goteo-Enfermeria1-1.pptEjercicios-de-Calculo-de-Goteo-Enfermeria1-1.ppt
Ejercicios-de-Calculo-de-Goteo-Enfermeria1-1.ppt
 
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdfEvaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
 
MANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdf
MANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdfMANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdf
MANUAL PARA LA ADMINISTRACION DE SIST. DE AGUA POTABLE 2021.pdf
 

Biología molecular ing. genética biotecnología reprod asistida

  • 1. BIOLOGÍA MOLECULAR Se encarga del estudio de la vida a nivel molecular. Especialmente explica cómo son los mecanismos de expresión de la información genética contenida en el ADN. ESTRUCTURA DEL ADN:
  • 2.  
  • 3. RELACIÓN ENTRE LOS GENES Y LAS PROTEÍNAS Este es uno de los descubrimientos más importantes del siglo XX y de toda la Historia de la Ciencia y de la Humanidad: DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR Este dogma ya no tiene validez ya que ciertos virus como el del SIDA tienen ARN de material genético que usan para fabricar ADN que se inserte en el cromosoma de la célula a la que infectan. Transcriptasa inversa ADN ARN Proteínas ADN ARN Proteínas
  • 4. Esto significa que el ADN es capaz de sacar copias idénticas de sí mismo Esto significa que el ADN es capaz de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) Esto significa que el mensaje de los genes, en forma de ARN, sirve para formar proteínas Replicación Transcripción Traducción Estos son los nombres de estos procesos. Veamos cómo son… ADN ARN Proteínas
  • 5. Replicación ADN El ADN es capaz de sacar copias idénticas de sí mismo Esto ocurre antes de que la célula se divida. Esto es lógico, puesto que las células hijas deben llevar toda la información genética.
  • 6. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando va a copiarse el ADN ocurre esto: ATTCGCGGCATTAATCCG ATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGC TATGGATCATGGCGCCTAAATTTGTACCTAG 1º se abre la doble cadena: 2º se van añadiendo nuevas letras, de forma complementaria : ATTCGCGGCATTAATCCG ATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGC TATGGATCATGGCGCCTAAATTTGTACCTAG C T C C A A ATACCTAGT T T GTACCTAG La doble cadena se terminará abriendo del todo
  • 7. 3º Continúa el proceso de añadir “letras” hasta formarse dos doble cadenas hijas, idénticas a la original: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG En rojo se muestran las nuevas “letras” que se han ido uniendo de la manera “correcta” o complementaria (A con T y C con G). De este modo, cada una de las cadenas originales ha servido de MOLDE para crear otra por lo que se dice que la REPLICACIÓN DEL ADN ES SEMICONSERVATIVA A veces se producen errores en este proceso, dando lugar a genes alterados, distintos al original. Son las MUTACIONES .
  • 8. Estos son algunos de los dibujos de la replicación o duplicación del ADN que pueden encontrarse en Internet:
  • 11. Transcripción ADN ARN Los genes del ADN son capaces de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) GGCGCCUAAAUUUG Las cadenas de ARN son más cortas que las de ADN y están formadas por una cadena simple (no doble como ocurría con el ADN) La letra U (Uracilo) sustituye a la T en el ARN
  • 12. 1º se abre una parte de la doble cadena de ADN: 2º se copia la información del gen añadiendo letras, de forma complementaria, para formar ARN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando se transcribe el ADN a ARN ocurre esto: ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA TAAGCGCCGTAATTAGGCTATGGATCAT TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG La doble cadena de ADN NO se terminará abriendo del todo. Sólo se transcribe a ARN la información de algunos genes. ADN ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA GGCGCCUAAAUUUG TAAGCGCCGTAATTAGGCTATGGATCAT TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG C G U A La letra U (Uracilo) sustituye a la T en el ARN ARN Gen trascrito a ARN Gen que va a transcribirse Transcripción
  • 13. Transcripción GGCGCCUAAAUUUG Finalmente, el ARN sale fuera del núcleo. Gracias a los ribosomas, en el citoplasma, la información que lleva el ARN es “leída” por los ribosomas para formar proteínas en el proceso llamado TRADUCCIÓN o SÍNTESIS DE PROTEÍNAS ARN ribosomas Este ARN también se llama ARN mensajero , porque lleva un mensaje para fabricar proteínas. Núcleo celular Citoplasma Clic aquí para ver un vídeo de la Transcripción
  • 14. Ocurre en el citoplasma celular, fuera del núcleo. La información del ARN mensajero es “leída” por los ribosomas para fabricar proteínas. Cada grupo de tres bases (o “letras”) del ARN mensajero determina la unión, a la cadena proteica, de uno de los 20 aminoácidos que existen ( CÓDIGO GENÉTICO ) Clic aquí para ver un vídeo de la traducción o síntesis de proteínas Traducción
  • 15. TRADUCCIÓN O SÍNTESIS DE PROTEÍNAS
  • 16.
  • 17.
  • 18. ANEUPLOIDÍAS HUMANAS MÁS FRECUENTES ALTERACIÓN SÍNDROME CUADRO CLÍNICO Trisomía del 21 (1,5/10000 nacidos) Down Retraso mental Rasgos faciales mongoloides Alteraciones oculares, cardiacas, braquicefalia Trisomía del 18 (1/6667 nacidos) Edwards Deficiencia mental profunda Malformaciones renales y cardiacas Trisomía del 13 (1/4600 nacidos) Patau Deficiencia mental profunda Malformaciones cardiacas, genitales, cerebrales y renales. XO (0,3/1000 nacidos) Turner Genitales infantiles Esterilidad Estatura baja XXX (1/1000 nacidos) Triple X Retraso mental. Alteraciones neuropsíquicas XXY (1,4/10000 nacidos) Klinefelter Genitales pequeños Retraso mental moderado XYY (1/2000 nacidos) Duplo Y Trastornos de conducta (agresividad) Estatura elevada
  • 19. AMNIOCENTESIS Prueba diagnóstica para detectar mutaciones cromosómicas estructurales y numéricas en el embrión
  • 20.  
  • 22. INGENIERÍA GENÉTICA : Son las técnicas que permiten manipular el ADN , modificando el genoma de los seres vivos. ADN RECOMBINANTE : Es ADN que tiene distinta procedencia. Por ejemplo es introducir ADN de un humano (gen de la insulina) en una bacteria para que produzca esta hormona para su uso por los diabéticos. Para ellos es necesario dos cosas: 1 . Cortar el ADN e introducir en el genoma la secuencia de ADN que quiero. Esto se hace gracias a las ENDONUCLEASAS DE RESTRICCIÓN ( reconocen y cortan secuencias específicas de ADN) De esta manera podemos introducir en ese hueco el nuevo ADN.
  • 23. 2 . Amplificación del ADN : es necesario para poder trabajar con el ADN fabricar muchas copias de la secuencia de ADN que queremos introducir. Esto se consigue gracias a la PCR (reacción en cadena de la polimerasa)
  • 24.
  • 25.
  • 26. BIOTECNOLOGÍA La biotecnología es un campo de aplicación de la biología que utiliza organismos vivos en beneficio humano. Hay dos tipos de biotecnología: Biotecnología tradicional Biotecnología actual Basada en el uso de microorganismos. Basada en los logros obtenidos por la ingeniería genética . Aplicaciones: 1. Alimentación. 2. Farmacia e industria química. 3. Medio ambiente. Aplicaciones: 1. Agricultura y ganadería 2. Aplicaciones biosanitarias.
  • 27. Desde tiempos remotos, y sin conocer su fundamento, el ser humano ha utilizado procesos biotecnológicos para fabricar productos de uso común. Se basa en aprovecharnos del proceso de FERMENTACIÓN que realizan las levaduras y algunas bacterias BIOTECNOLOGÍA TRADICIONAL 1. Alimentación Bebidas alcohólicas: Lácteos: Pan: Es un producto biotecnológico en el que participa la levadura Saccharomyces cerevisiae . A partir de la leche y gracias a la acción de algunas bacterias, se fabrican productos lácteos como el queso y el yogur. Se producen por la fermentación realizada por Saccharomyces cerevisiae. Esta levadura utiliza los glúcidos de diversos productos (mosto, malta, etcétera).
  • 28. BIOTECNOLOGÍA TRADICIONAL Además de algunos alimentos, hay otros muchos productos obtenidos por biotecnología: 2. Farmacia e industria química Productos químicos industriales Antibióticos : Vacunas: Las vacunas son microorganismos (atenuados o muertos) o parte de ellos sin virulencia. Los antibióticos son producidos por ciertos microorganismos como los mohos (Penicilium) Algunos microorganismos producen sustancias que se utilizan en la industria.
  • 29. BIOTECNOLOGÍA TRADICIONAL La utilización de microorganismos también se realiza en actividades relacionadas con la conservación del medio ambiente: 3. Medio ambiente Degradación de hidrocarburos : Reciclaje de agua: Residuos : La descomposición de la materia orgánica de las basuras se realiza mediante microorganismos y se transforma la materia orgánica en COMPOST (abono) En las plantas de tratamiento de aguas se utiliza la acción bacteriana que se alimentan de la materia orgánica del agua reduciendo significativamente la contaminación de las aguas residuales . Algunas bacterias son capaces de degradar hidrocarburos, y son muy útiles en la lucha contra vertidos de petróleo.
  • 30.
  • 31. BIOTECNOLOGÍA ACTUAL • Organismos transgénicos Son animales o plantas con genes procedentes de otro organismo , que adquieren características que no tenía la especie original (resistencia a plagas, mayor producción de leche, crecimiento más rápido, etcétera). Aplicaciones agrícolas y ganaderas II Proceso de obtención de una planta transgénica resistente a insectos. 1. Se corta el ADN y se selecciona el fragmento que porta el gen para la s íntesis de una sustancia insecticida. 2. Se introduce el ADN de la bacteria en la c élula vegetal. 3. Se inserta el material gen ético de la bacteria en el ADN de la planta. 4. Se cultivan las plantas en el laboratorio. 5. Se obtienen plantas resistentes al insecto.
  • 32. BIOTECNOLOGÍA ACTUAL La salud humana es la gran beneficiada de la biotecnología actual. Hay grandes esperanzas sobre las aportaciones de la ingeniería genética . Aplicaciones Biosanitarias Correcci ón genética en el ser humano. 1. Se realiza un cultivo celular con el óvulo fecundado. 4. Se extrae el n úcleo de la célula corregida y se introduce en un óvulo sin núcleo. 2. Se introduce en el cultivo un vector con el gen sano. 3. Se obtiene un cultivo transformado. Condiciones de la terapia génica • Que la enfermedad esté causada por una anomalía génica. • Que se haya localizado el gen defectuoso. • Que se pueda clonar el gen «normal» no defectuoso. • Que la introducción de este gen sea técnicamente posible. • Que el gen no provoque reacciones adversas. Aplicaciones de la Biotecnología en la medicina • Diagnóstico de enfermedades causadas por genes defectuosos. • Obtención de sustancias (hormonas, enzimas, proteínas…) como la insulina. • Prevención de enfermedades genéticas (la corrección genética en el ser humano).
  • 33. REPRODUCCIÓN ASISTIDA ¿En qué consiste? Son las técnicas aplicadas para solucionar los problemas de esterilidad en la pareja cuando lleven más de 12 meses intentando tener descendencia. Causas de la esterilidad HOMBRES : fatiga, estrés, exceso de alcohol y drogas, causas orgánicas (criptorquidea, aplasia germinal…), malformaciones o infecciones. MUJERES : Edad, desnutrición, anemia, malformaciones de útero y ovarios, alteraciones endocrinas, infecciones…
  • 34.
  • 35.
  • 36.
  • 39.
  • 40.
  • 41.