SlideShare una empresa de Scribd logo

T 06 ácidos nucleicos 17 18

Fsanperg
Fsanperg

1. Definición 2. Composición química de los ácidos nucleicos Nucleotidos o Bases nitrogenadas • Bases pirimidínicas • Bases púricas o Pentosa o Ácido fosfórico Nucleósido Dinucleotidos Nucleótidos no nucleicos Adenosín trifosfato (ATP) Adenosín monofosfato cíclico (AMP-c) Nucleótidos que intervienen en los procesos de óxido-reducción 4. Ácido desoxirribonucleico (ADN) 4.1. Estructura primaria 4.2. Estructura secundaria 4.3. Estructura terciaria 4.4. Estructura cuaternaria 5. Funciones del ADN 6. Desnaturalización del ADN 7. Ácido ribonucleico (ARN) 7.1. Estructura 7.2. Tipos y FunciónAnaya 96 (88) ARN mensajeros (ARNm) ARN de transferencia (ARNt) ARN ribosómicos (ARNr) ARN heterogéneo nuclear (ARNhn) 8. Preguntas PAU Canarias

1 de 17
Descargar para leer sin conexión
ÁCIDOS
NUCLEICOS
ÍNDICE
1. Definición
2. Composición química de los ácidos nucleicos
Nucleotidos
o Bases nitrogenadas
§ Bases pirimidínicas
§ Bases púricas
o Pentosa
o Ácido fosfórico
Nucleósido
Dinucleotidos
Polinucleotidos
3. Nucleótidos no nucleicos
Adenosín trifosfato (ATP)
Adenosín monofosfato cíclico (AMP-c)
Nucleótidos que intervienen en los procesos de óxido-reducción
4. Ácido desoxirribonucleico (ADN)
4.1. Estructura primaria
4.2. Estructura secundaria
4.3. Estructura terciaria
4.4. Estructura cuaternaria
5. Funciones del ADN
6. Desnaturalización del ADN
7. Ácido ribonucleico (ARN)
7.1. Estructura
7.2. Tipos y FunciónAnaya 96 (88)
ARN mensajeros (ARNm)
ARN de transferencia (ARNt)
ARN ribosómicos (ARNr)
ARN heterogéneo nuclear (ARNhn)
8. Preguntas PAU Canarias
IES	
  BAÑADEROS	
  CIPRIANO	
  ACOSTA	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  2º	
  Bach.	
  BIOLOGÍA	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  TEMA	
  6	
  ÁCIDOS	
  NUCLEICOS	
   3
TEMA 6. ÁCIDOS NUCLEICOS
1.Definición
Los ácidos nucleicos son macromoléculas constituidas por la unión mediante enlaces químicos de unidades
menores llamadas nucleótidos. Los ácidos nucleicos son compuestos de elevado peso molecular que están
presentes en el núcleo de las células (también en determinados orgánulos como mitocondrias y cloroplastos). Son
las moléculas encargadas de almacenar, transmitir y expresar la información genética. Existen dos tipos
ADN (ácido desoxirribonucleico) y ARN (ácido ribonucleico), presentes ambos en toda clase de células
animales, vegetales o bacterianas.
2.Composición química de los ácidos nucleicos
Los ácidos nucleicos son macromoléculas poliméricas formadas por
subunidades llamadas nucleótidos.
Nucleotidos Están formados por la unión de una base nitrogenada, una
pentosa y una molécula de ácido fosfórico (H3 PO4)
o Bases nitrogenadas. Compuestos cíclicos formados por carbono
y nitrógeno. Existen dos tipos:
§ Bases pirimidínicas, derivadas de la pirimidina. Son citosina
(C), que se encuentra tanto en el ADN como en el ARN; timina (T),
que se presenta sólo en el ADN; y uracilo (U), componente del ARN.
§ Bases púricas, derivadas de la purina. Las más importantes son adenina (A) y guanina (G).
Las dos en ambos tipos de ácidos nucleicos.
o Pentosa, ribosa en el ARN y desoxirribosa en el
ADN. Ambas son aldopentosas, la única diferencia entre
ambas está en que en el carbono 2 de la desoxirribosa hay un
hidrógeno (-H) en lugar del grupo alcohol (-OH)
o Ácido fosfórico (H3 PO4) se encuentran en forma de ión fosfato.
A.00. ¿Qué diferencia existe entre la ribosa y la desoxirribosa?
Nucleósido. Es la unión de una pentosa (Ribosa o desoxirribosa) con una base nitrogenada.
El enlace se forma entre el carbono anomérico del azúcar y uno de los nitrógenos de la base nitrogenada. En la
unión se forma una molécula de agua. Este enlace recibe el nombre de
enlace N-glucosídico. Si la pentosa es una ribosa, tenemos un
ribonucleósido. Estos tienen como bases nitrogenadas la adenina,
guanina, citosina y uracilo. Si la pentosa es un desoxirribosa, tenemos
un desoxirribonucleósido. Estos tienen como bases nitrogenadas la
adenina, citosina, guanina y timina. Se nombra añadiendo la
terminación -osina, si derivan de una base púrica, adenosina,
guanosina o -idina, si ésta es pirimidínica, citidina, timidina,
uridina. Si la pentosa es la desoxirribosa se antepone el prefijo
desoxi-; por ejemplo, desoxiaguanosina, desoxicitidina, etc.
Los nucleótidos se forma por la unión de un nucleósido con el ácido fosfórico, esta se produce mediante la
esterificación del azúcar por el ácido fosfórico. Es una unión fosfoéster entre un OH del ácido fosfórico y el OH
situado en el carbono 5 del azúcar, con formación de una molécula de agua. Según el azúcar sea la ribosa o la
desoxirribosa, tendremos ribonucleótidos o desoxirribonucleótidos.
Los nucleótidos se nombran
como el nucleósido del que proceden
eliminando la a final y añadiendo la
terminación monofosfato, por
ejemplo, adenosin monofosfato
(AMP). Llevan el prefijo desoxi-, en
el caso de estar formadas por la
pentosa desoxirribosa. (dAMP)
Al grupo fosfato de los nucleótidos monofosfato puede unirse un segundo fosfato, y a éste un tercero,
para formar los nucleótidos mono-, di- y trifosfatos (AMP, ADP y ATP),
Dinucleotidos. La unión de dos nucleótidos mediante enlaces fosfodiester (entre el OH del ácido
fosforico de un nucleótido y el OH del carbono 3' del siguiente formándose una molécula de agua) da lugar
a un dinucleótido, si se une varios forman un polinucleótido. Los ácidos nucleicos son precisamente
largas cadenas polinucleótidicas.
Polinucleotidos. En la cadena de
polinucleótidos, el nucleótido de uno de los
extremos tendrá libre el OH del azúcar en posición
3, éste será el extremo 3' de la cadena. El ácido
fosfórico del nucleótido que se encuentre en el
extremo opuesto también estará libre, éste será el
extremo 5'. Esto marca un sentido en la cadena de
polinucleótidos. Toda cadena podrá considerarse bien
en sentido 3' → 5' o en sentido 5' → 3' y así habrá
que indicarlo.
IES	
  BAÑADEROS	
  CIPRIANO	
  ACOSTA	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  2º	
  Bach.	
  BIOLOGÍA	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  	
  TEMA	
  6	
  ÁCIDOS	
  NUCLEICOS	
   5
3. Nucleótidos no nucleicos
No forman parte de los ácidos nucleicos, se encuentran libres en las células e intervienen en el
metabolismo y en su regulación de enzimas, aportando energía química en las reacciones celulares, como coenzimas
o como intermediarios activos en la síntesis de biomoléculas. Entre estos tenemos:
Adenosín trifosfato (ATP) actúa como coenzima en diversas reacciones metabólicas implicadas
en la transferencia de fosfato y energía siendo el intermediario energético celular por excelencia. Al
hidrolizarse a ADP+P, libera la energía que es
utilizada por la célula para realizar diversas funciones,
como movimiento, síntesis de moléculas, producción de calor,
transmisión nerviosa, transporte activo, etc. Por tanto en los
seres vivos actúan como un almacén de energía.
Adenosín monofosfato cíclico (AMP-c) actúa en las células como intermediario de
muchas hormonas.
Nucleótidos que intervienen en los procesos de óxido-reducción. Estas
moléculas captan electrones de moléculas a las que oxidan y los ceden a otras moléculas a las que a su vez
reducen.
Nucleótidos transportadores de electrones:
o NAD+
/NADH. Nicotin adenin dinucleótido
oxidado y reducido, respectivamente.
(Catabolismo)
o NADP+
/NADPH. Nicotin adenin
dinucleótido fosfato, oxidado y reducido.
(Anabolismo)
o FAD/FADH2. (Flavin adenin dinucleótido),
oxidado y reducido.
4. Ácido desoxirribonucleico (ADN)
El ADN es un polímero lineal formado por desoxirribonucleotidos de
adenina, guanina, citosina y timina.
El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se
empezó a conocer su estructura. Se encuentra en el núcleo de las células
eucariotas asociado a proteínas (histonas y otras) formando la cromatina,
sustancia que constituye los cromosomas y a partir de la cual se transcribe la
información genética. También hay ADN en ciertos orgánulos celulares (por
ejemplo: plastos y mitocondrias).
El estudio de su estructura se puede hacer a varios niveles, presentan
estructuras primaria y secundaria, aunque asociado o no a proteínas
nucleares adoptan estructuras super-enrolladas que equivalen a una estructura
terciaria.
4.1. Estructura primaria
Es la secuencia de nucleótidos de una cadena o hebra. Para indicar la secuencia de una cadena de
ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y
3' de la cadena nucleotídica. Así, por ejemplo:
5' ACGTTTAACGACAAGTATTAAGACAAGTATTAA 3'
4.2. Estructura secundaria
De acuerdo con el modelo propuesto por Watson y Crick, la estructura secundaria del ADN consiste en:
▪ Una doble hélice formada por dos cadenas helicoidales de polinucleótidos, enrolladas la una
alrededor de la otra a lo largo de un eje imaginario común.
▪ El enrollamiento es dextrógiro (sentido de las agujas del reloj).
▪ Las cadenas son antiparalelas, se disponen en sentido opuestos. Una va en sentido 3' → 5' y
la otra en sentido 5' → 3'.
▪ Situación: Las bases nitrogenadas se sitúan en el interior de la doble hélice mientras que
el azúcar (la pentosa) y el ácido fosfórico forman el esqueleto externo; los planos de las bases
quedan perpendiculares al eje de la hélice.
▪ Las dos cadenas están unidas por puentes de hidrógenos formados entre los pares
adenina-timina (A=T) dos puentes y guanina-citosina (G≡C) tres puentes. Esta correspondencia
entre las bases explica el hecho de que las dos cadenas de la doble hélice posean secuencias
complementarias.
Esta estructura secundaria hace posible explicar el papel del ADN como molécula que posee el mensaje
genético, capaz de duplicarse o replicarse para transmitir este mensaje a las dos células hijas y transcribir,
por otra parte, este mensaje para formar moléculas de ARN responsables de la síntesis de proteínas. Estas dos
importantes funciones se basan, como veremos más adelante, en la complementariedad de sus bases.

Recomendados

Estructura y propiedades de aminoácidos y proteínas - Fabián Rodríguez
Estructura y propiedades de aminoácidos y proteínas - Fabián RodríguezEstructura y propiedades de aminoácidos y proteínas - Fabián Rodríguez
Estructura y propiedades de aminoácidos y proteínas - Fabián RodríguezFabián Rodríguez
 
Purinas y pirimidinas
Purinas y pirimidinasPurinas y pirimidinas
Purinas y pirimidinasmarce iero
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicosu.una
 
Empaquetamiento y transcripción
Empaquetamiento y transcripción Empaquetamiento y transcripción
Empaquetamiento y transcripción Elsa Qr
 
Clase 5a-carbohidratos (2)
Clase 5a-carbohidratos (2)Clase 5a-carbohidratos (2)
Clase 5a-carbohidratos (2)karenina25
 

Más contenido relacionado

La actualidad más candente

La actualidad más candente (20)

Transcripción de procariotas
Transcripción de procariotasTranscripción de procariotas
Transcripción de procariotas
 
Bases nitrogenada, conceptos generales de biologia molecular
Bases nitrogenada, conceptos generales de biologia molecularBases nitrogenada, conceptos generales de biologia molecular
Bases nitrogenada, conceptos generales de biologia molecular
 
Aminas
AminasAminas
Aminas
 
Práctica 6. Identificación de proteínas.
Práctica 6. Identificación de proteínas.Práctica 6. Identificación de proteínas.
Práctica 6. Identificación de proteínas.
 
Bases nitrogenadas
Bases nitrogenadasBases nitrogenadas
Bases nitrogenadas
 
Carbohidratos
CarbohidratosCarbohidratos
Carbohidratos
 
Cuestionario de lípidos
Cuestionario de lípidosCuestionario de lípidos
Cuestionario de lípidos
 
Replicación del adn
Replicación del adnReplicación del adn
Replicación del adn
 
Identificación de proteínas.
Identificación  de proteínas.Identificación  de proteínas.
Identificación de proteínas.
 
química de los carbohidratos
química de los carbohidratosquímica de los carbohidratos
química de los carbohidratos
 
Tema 2. LOS GLÚCIDOS
Tema 2. LOS GLÚCIDOSTema 2. LOS GLÚCIDOS
Tema 2. LOS GLÚCIDOS
 
Gluconeogénesis
GluconeogénesisGluconeogénesis
Gluconeogénesis
 
Aminoacidos y proteínas
Aminoacidos y proteínasAminoacidos y proteínas
Aminoacidos y proteínas
 
Azucares reductores y no reductores
Azucares reductores y no reductoresAzucares reductores y no reductores
Azucares reductores y no reductores
 
Alquenos nomenclatura e_isomeria
Alquenos nomenclatura e_isomeriaAlquenos nomenclatura e_isomeria
Alquenos nomenclatura e_isomeria
 
Carbohidratos
CarbohidratosCarbohidratos
Carbohidratos
 
D glucosa y l-glucosa
D glucosa y l-glucosaD glucosa y l-glucosa
D glucosa y l-glucosa
 
Inhibidores del ciclo de krebs
Inhibidores del ciclo de krebsInhibidores del ciclo de krebs
Inhibidores del ciclo de krebs
 
Práctica 3. Identificación de carbohidratos.
Práctica 3. Identificación de carbohidratos.Práctica 3. Identificación de carbohidratos.
Práctica 3. Identificación de carbohidratos.
 
Glucidos II: disacáridos y polisacáridos
Glucidos II: disacáridos y polisacáridosGlucidos II: disacáridos y polisacáridos
Glucidos II: disacáridos y polisacáridos
 

Similar a T 06 ácidos nucleicos 17 18

T-06-Ac-Nucleicos_2012.ppt
T-06-Ac-Nucleicos_2012.pptT-06-Ac-Nucleicos_2012.ppt
T-06-Ac-Nucleicos_2012.pptcarlimarflores21
 
Nucleótidos y Ácidos nucléicos
Nucleótidos y Ácidos nucléicosNucleótidos y Ácidos nucléicos
Nucleótidos y Ácidos nucléicosferpe1234
 
Química de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptxQuímica de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptxmanuelfelipeecheverr
 
Química de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptxQuímica de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptxmanuelfelipeecheverr
 
EXPOSICION Ácidos nucleicooooooooos.pptx
EXPOSICION Ácidos nucleicooooooooos.pptxEXPOSICION Ácidos nucleicooooooooos.pptx
EXPOSICION Ácidos nucleicooooooooos.pptxDEINERFUSTAMANTECHAV1
 
Bioquimica de los alimentos Acidos nucleicos.pdf
Bioquimica de los alimentos Acidos nucleicos.pdfBioquimica de los alimentos Acidos nucleicos.pdf
Bioquimica de los alimentos Acidos nucleicos.pdfYimmy HZ
 
Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)
Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)
Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)Matias Quintana
 
AcidosNucleicos_veronica.pdf
AcidosNucleicos_veronica.pdfAcidosNucleicos_veronica.pdf
AcidosNucleicos_veronica.pdfJessMendoza71
 
Acidos nucleicos y sus caracteristicas fisicas y quimicas
Acidos nucleicos y sus caracteristicas fisicas y quimicasAcidos nucleicos y sus caracteristicas fisicas y quimicas
Acidos nucleicos y sus caracteristicas fisicas y quimicasminvestigacion
 
Trabajo computacion
Trabajo computacion Trabajo computacion
Trabajo computacion Karen Osores
 
Trabajo computacion
Trabajo computacionTrabajo computacion
Trabajo computacionKaren Osores
 
11 Química de los ácidos nucleicos.pptx
11 Química de los ácidos nucleicos.pptx11 Química de los ácidos nucleicos.pptx
11 Química de los ácidos nucleicos.pptxDianaMencia
 
T 06 ac nucleicos
T 06 ac nucleicosT 06 ac nucleicos
T 06 ac nucleicosFsanperg
 
Los acidos nucleicos
Los acidos nucleicosLos acidos nucleicos
Los acidos nucleicosKary Cordova
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicosN Flores
 

Similar a T 06 ácidos nucleicos 17 18 (20)

T-06-Ac-Nucleicos_2012.ppt
T-06-Ac-Nucleicos_2012.pptT-06-Ac-Nucleicos_2012.ppt
T-06-Ac-Nucleicos_2012.ppt
 
Ácidos nucleicos
Ácidos nucleicosÁcidos nucleicos
Ácidos nucleicos
 
Nucleótidos y Ácidos nucléicos
Nucleótidos y Ácidos nucléicosNucleótidos y Ácidos nucléicos
Nucleótidos y Ácidos nucléicos
 
Química de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptxQuímica de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptx
 
Química de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptxQuímica de los ácidos nucleicos.pptx
Química de los ácidos nucleicos.pptx
 
EXPOSICION Ácidos nucleicooooooooos.pptx
EXPOSICION Ácidos nucleicooooooooos.pptxEXPOSICION Ácidos nucleicooooooooos.pptx
EXPOSICION Ácidos nucleicooooooooos.pptx
 
Bioquimica de los alimentos Acidos nucleicos.pdf
Bioquimica de los alimentos Acidos nucleicos.pdfBioquimica de los alimentos Acidos nucleicos.pdf
Bioquimica de los alimentos Acidos nucleicos.pdf
 
Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)
Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)
Organización de los sistemas vivos IV: Ácidos Nucleicos (BC04 - PDV 2013)
 
AcidosNucleicos_veronica.pdf
AcidosNucleicos_veronica.pdfAcidosNucleicos_veronica.pdf
AcidosNucleicos_veronica.pdf
 
Acidos nucleicos y sus caracteristicas fisicas y quimicas
Acidos nucleicos y sus caracteristicas fisicas y quimicasAcidos nucleicos y sus caracteristicas fisicas y quimicas
Acidos nucleicos y sus caracteristicas fisicas y quimicas
 
Acidos nucleicos 09
Acidos nucleicos 09Acidos nucleicos 09
Acidos nucleicos 09
 
áCidos nucléicos
áCidos nucléicosáCidos nucléicos
áCidos nucléicos
 
Trabajo computacion
Trabajo computacion Trabajo computacion
Trabajo computacion
 
Trabajo computacion
Trabajo computacionTrabajo computacion
Trabajo computacion
 
Acidos Nucleicos
Acidos NucleicosAcidos Nucleicos
Acidos Nucleicos
 
quimica diapositiva.pptx
quimica diapositiva.pptxquimica diapositiva.pptx
quimica diapositiva.pptx
 
11 Química de los ácidos nucleicos.pptx
11 Química de los ácidos nucleicos.pptx11 Química de los ácidos nucleicos.pptx
11 Química de los ácidos nucleicos.pptx
 
T 06 ac nucleicos
T 06 ac nucleicosT 06 ac nucleicos
T 06 ac nucleicos
 
Los acidos nucleicos
Los acidos nucleicosLos acidos nucleicos
Los acidos nucleicos
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 

Más de Fsanperg

T 11 metabolismo celular, enzimas vitaminas
T 11 metabolismo celular, enzimas vitaminasT 11 metabolismo celular, enzimas vitaminas
T 11 metabolismo celular, enzimas vitaminasFsanperg
 
T 16 microbiologia
T 16 microbiologiaT 16 microbiologia
T 16 microbiologiaFsanperg
 
T 15 las leyes de la herencia
T 15 las leyes de la herenciaT 15 las leyes de la herencia
T 15 las leyes de la herenciaFsanperg
 
T 14 del adn a las proteinas 2017
T 14 del adn a las proteinas 2017T 14 del adn a las proteinas 2017
T 14 del adn a las proteinas 2017Fsanperg
 
T 13 reproduccion celular 2017
T 13 reproduccion celular 2017T 13 reproduccion celular 2017
T 13 reproduccion celular 2017Fsanperg
 
T 09 endomembranas
T 09 endomembranasT 09 endomembranas
T 09 endomembranasFsanperg
 
T 08 membrana plasmatica
T 08 membrana plasmaticaT 08 membrana plasmatica
T 08 membrana plasmaticaFsanperg
 
T 05 proteinas
T 05 proteinasT 05 proteinas
T 05 proteinasFsanperg
 
T 04 lipidos 2017 18
T 04 lipidos 2017 18T 04 lipidos 2017 18
T 04 lipidos 2017 18Fsanperg
 
T 03 glucidos 2017 18
T 03 glucidos 2017 18T 03 glucidos 2017 18
T 03 glucidos 2017 18Fsanperg
 
T 02 agua y sales minerales 2017 18
T 02 agua y sales minerales 2017 18T 02 agua y sales minerales 2017 18
T 02 agua y sales minerales 2017 18Fsanperg
 
T 12 metabolismo 2017
T 12 metabolismo 2017T 12 metabolismo 2017
T 12 metabolismo 2017Fsanperg
 
T 17 sistema inmunitario 09 10
T 17 sistema inmunitario 09 10T 17 sistema inmunitario 09 10
T 17 sistema inmunitario 09 10Fsanperg
 
T 01 introduccion biologia 2017 18
T 01 introduccion biologia 2017 18T 01 introduccion biologia 2017 18
T 01 introduccion biologia 2017 18Fsanperg
 
Dinámica de la Tierra 17 18 4º ESO
Dinámica de la Tierra 17 18 4º ESODinámica de la Tierra 17 18 4º ESO
Dinámica de la Tierra 17 18 4º ESOFsanperg
 
01 El Pasado de la Tierra 2017 18 4º ESO
01 El Pasado de la Tierra 2017 18 4º ESO01 El Pasado de la Tierra 2017 18 4º ESO
01 El Pasado de la Tierra 2017 18 4º ESOFsanperg
 
07 Modelado del relieve 17 18 3º ESO
07 Modelado del relieve 17 18 3º ESO07 Modelado del relieve 17 18 3º ESO
07 Modelado del relieve 17 18 3º ESOFsanperg
 
06 Aparato locomotor 17 18 3º ESO
06 Aparato locomotor 17 18 3º ESO06 Aparato locomotor 17 18 3º ESO
06 Aparato locomotor 17 18 3º ESOFsanperg
 

Más de Fsanperg (20)

T 11 metabolismo celular, enzimas vitaminas
T 11 metabolismo celular, enzimas vitaminasT 11 metabolismo celular, enzimas vitaminas
T 11 metabolismo celular, enzimas vitaminas
 
T 16 microbiologia
T 16 microbiologiaT 16 microbiologia
T 16 microbiologia
 
T 15 las leyes de la herencia
T 15 las leyes de la herenciaT 15 las leyes de la herencia
T 15 las leyes de la herencia
 
T 14 del adn a las proteinas 2017
T 14 del adn a las proteinas 2017T 14 del adn a las proteinas 2017
T 14 del adn a las proteinas 2017
 
T 13 reproduccion celular 2017
T 13 reproduccion celular 2017T 13 reproduccion celular 2017
T 13 reproduccion celular 2017
 
T 10 hialop
T 10 hialopT 10 hialop
T 10 hialop
 
T 09 endomembranas
T 09 endomembranasT 09 endomembranas
T 09 endomembranas
 
T 08 membrana plasmatica
T 08 membrana plasmaticaT 08 membrana plasmatica
T 08 membrana plasmatica
 
T 07 nucleo
T 07  nucleoT 07  nucleo
T 07 nucleo
 
T 05 proteinas
T 05 proteinasT 05 proteinas
T 05 proteinas
 
T 04 lipidos 2017 18
T 04 lipidos 2017 18T 04 lipidos 2017 18
T 04 lipidos 2017 18
 
T 03 glucidos 2017 18
T 03 glucidos 2017 18T 03 glucidos 2017 18
T 03 glucidos 2017 18
 
T 02 agua y sales minerales 2017 18
T 02 agua y sales minerales 2017 18T 02 agua y sales minerales 2017 18
T 02 agua y sales minerales 2017 18
 
T 12 metabolismo 2017
T 12 metabolismo 2017T 12 metabolismo 2017
T 12 metabolismo 2017
 
T 17 sistema inmunitario 09 10
T 17 sistema inmunitario 09 10T 17 sistema inmunitario 09 10
T 17 sistema inmunitario 09 10
 
T 01 introduccion biologia 2017 18
T 01 introduccion biologia 2017 18T 01 introduccion biologia 2017 18
T 01 introduccion biologia 2017 18
 
Dinámica de la Tierra 17 18 4º ESO
Dinámica de la Tierra 17 18 4º ESODinámica de la Tierra 17 18 4º ESO
Dinámica de la Tierra 17 18 4º ESO
 
01 El Pasado de la Tierra 2017 18 4º ESO
01 El Pasado de la Tierra 2017 18 4º ESO01 El Pasado de la Tierra 2017 18 4º ESO
01 El Pasado de la Tierra 2017 18 4º ESO
 
07 Modelado del relieve 17 18 3º ESO
07 Modelado del relieve 17 18 3º ESO07 Modelado del relieve 17 18 3º ESO
07 Modelado del relieve 17 18 3º ESO
 
06 Aparato locomotor 17 18 3º ESO
06 Aparato locomotor 17 18 3º ESO06 Aparato locomotor 17 18 3º ESO
06 Aparato locomotor 17 18 3º ESO
 

Último

5ta Sesión Ordinaria CTE_febrero 2024_Andrés López Palafox.pptx
5ta Sesión Ordinaria CTE_febrero  2024_Andrés López Palafox.pptx5ta Sesión Ordinaria CTE_febrero  2024_Andrés López Palafox.pptx
5ta Sesión Ordinaria CTE_febrero 2024_Andrés López Palafox.pptxVíctor Hugo Ramírez
 
PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435
PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435
PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435LICMURO
 
Información a las familias aula matinal.pdf
Información a las familias aula matinal.pdfInformación a las familias aula matinal.pdf
Información a las familias aula matinal.pdfAlfaresbilingual
 
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQUNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQJAVIERMAURICIOCORREA1
 
Biología Marina, Elaborado por Sujey Lara
Biología Marina, Elaborado por Sujey LaraBiología Marina, Elaborado por Sujey Lara
Biología Marina, Elaborado por Sujey Larassuserb2b6fc1
 
T13 2BIO - O ANABOLISMO presentación.pdf
T13 2BIO  - O ANABOLISMO presentación.pdfT13 2BIO  - O ANABOLISMO presentación.pdf
T13 2BIO - O ANABOLISMO presentación.pdfIESLOSADA1
 
LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...
LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...
LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...JAVIER SOLIS NOYOLA
 
ACTA OFICIAL DE POSESIÓN DE CARGO 2024.docx
ACTA OFICIAL DE POSESIÓN DE CARGO 2024.docxACTA OFICIAL DE POSESIÓN DE CARGO 2024.docx
ACTA OFICIAL DE POSESIÓN DE CARGO 2024.docxCarlos Muñoz
 
Reinos Y Clasificación Diapositivas.pptx
Reinos Y Clasificación Diapositivas.pptxReinos Y Clasificación Diapositivas.pptx
Reinos Y Clasificación Diapositivas.pptxkarolbustamante2911
 
La Gamificacion como Estrategia de Aprendizaje Ccesa007.pdf
La Gamificacion como Estrategia de Aprendizaje Ccesa007.pdfLa Gamificacion como Estrategia de Aprendizaje Ccesa007.pdf
La Gamificacion como Estrategia de Aprendizaje Ccesa007.pdfDemetrio Ccesa Rayme
 
Hitos históricos de la transformación del PODER GLOBAL II.pptx
Hitos históricos de la transformación del PODER GLOBAL II.pptxHitos históricos de la transformación del PODER GLOBAL II.pptx
Hitos históricos de la transformación del PODER GLOBAL II.pptxsubfabian
 
Letra A a - Máximo Aprende.doc .Actividades para niños de primer grado
Letra A a  -  Máximo Aprende.doc  .Actividades para niños de  primer gradoLetra A a  -  Máximo Aprende.doc  .Actividades para niños de  primer grado
Letra A a - Máximo Aprende.doc .Actividades para niños de primer gradoADELINA GALÁN C.
 
Sesión: ¡Bendito el que viene en el nombre del Señor!
Sesión: ¡Bendito el que viene en el nombre del Señor!Sesión: ¡Bendito el que viene en el nombre del Señor!
Sesión: ¡Bendito el que viene en el nombre del Señor!https://gramadal.wordpress.com/
 
ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.
ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.
ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.SabinaBermeo
 
OKUDA, arte para niños de educación infantil
OKUDA, arte  para niños de educación infantilOKUDA, arte  para niños de educación infantil
OKUDA, arte para niños de educación infantilM Victoria Azcona
 
Maikell Victor - Química 2024 - Volume 1
Maikell Victor - Química 2024 - Volume 1Maikell Victor - Química 2024 - Volume 1
Maikell Victor - Química 2024 - Volume 1DevinsideSolutions
 
RM N° 587-2023-minedu norma para elñ año escolar 2024pdf
RM N° 587-2023-minedu norma para elñ año escolar 2024pdfRM N° 587-2023-minedu norma para elñ año escolar 2024pdf
RM N° 587-2023-minedu norma para elñ año escolar 2024pdfmiguelracso
 

Último (20)

5ta Sesión Ordinaria CTE_febrero 2024_Andrés López Palafox.pptx
5ta Sesión Ordinaria CTE_febrero  2024_Andrés López Palafox.pptx5ta Sesión Ordinaria CTE_febrero  2024_Andrés López Palafox.pptx
5ta Sesión Ordinaria CTE_febrero 2024_Andrés López Palafox.pptx
 
PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435
PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435
PRESENTACION DE CURSO DE ALINEACION EN EL ESTANDAR EC0435
 
Información a las familias aula matinal.pdf
Información a las familias aula matinal.pdfInformación a las familias aula matinal.pdf
Información a las familias aula matinal.pdf
 
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQUNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
 
Biología Marina, Elaborado por Sujey Lara
Biología Marina, Elaborado por Sujey LaraBiología Marina, Elaborado por Sujey Lara
Biología Marina, Elaborado por Sujey Lara
 
T13 2BIO - O ANABOLISMO presentación.pdf
T13 2BIO  - O ANABOLISMO presentación.pdfT13 2BIO  - O ANABOLISMO presentación.pdf
T13 2BIO - O ANABOLISMO presentación.pdf
 
LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...
LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...
LOS NÚMEROS Y EL ECLIPSE SEGURO. Cuento literario escrito y diseñado por JAVI...
 
ACTA OFICIAL DE POSESIÓN DE CARGO 2024.docx
ACTA OFICIAL DE POSESIÓN DE CARGO 2024.docxACTA OFICIAL DE POSESIÓN DE CARGO 2024.docx
ACTA OFICIAL DE POSESIÓN DE CARGO 2024.docx
 
BT 4.3 Division Celular online 2024.pptx
BT 4.3 Division Celular online 2024.pptxBT 4.3 Division Celular online 2024.pptx
BT 4.3 Division Celular online 2024.pptx
 
Reinos Y Clasificación Diapositivas.pptx
Reinos Y Clasificación Diapositivas.pptxReinos Y Clasificación Diapositivas.pptx
Reinos Y Clasificación Diapositivas.pptx
 
La Gamificacion como Estrategia de Aprendizaje Ccesa007.pdf
La Gamificacion como Estrategia de Aprendizaje Ccesa007.pdfLa Gamificacion como Estrategia de Aprendizaje Ccesa007.pdf
La Gamificacion como Estrategia de Aprendizaje Ccesa007.pdf
 
Hitos históricos de la transformación del PODER GLOBAL II.pptx
Hitos históricos de la transformación del PODER GLOBAL II.pptxHitos históricos de la transformación del PODER GLOBAL II.pptx
Hitos históricos de la transformación del PODER GLOBAL II.pptx
 
Letra A a - Máximo Aprende.doc .Actividades para niños de primer grado
Letra A a  -  Máximo Aprende.doc  .Actividades para niños de  primer gradoLetra A a  -  Máximo Aprende.doc  .Actividades para niños de  primer grado
Letra A a - Máximo Aprende.doc .Actividades para niños de primer grado
 
Sesión: ¡Bendito el que viene en el nombre del Señor!
Sesión: ¡Bendito el que viene en el nombre del Señor!Sesión: ¡Bendito el que viene en el nombre del Señor!
Sesión: ¡Bendito el que viene en el nombre del Señor!
 
ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.
ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.
ANÁLISIS PICTÓRICO- EL ALTO RENACIMIENTO.
 
OKUDA, arte para niños de educación infantil
OKUDA, arte  para niños de educación infantilOKUDA, arte  para niños de educación infantil
OKUDA, arte para niños de educación infantil
 
DIANTE DE TI, BOA MÃE! _
DIANTE DE TI, BOA MÃE!                  _DIANTE DE TI, BOA MÃE!                  _
DIANTE DE TI, BOA MÃE! _
 
Maikell Victor - Química 2024 - Volume 1
Maikell Victor - Química 2024 - Volume 1Maikell Victor - Química 2024 - Volume 1
Maikell Victor - Química 2024 - Volume 1
 
Bendito el que viene en el nombre del Señor
Bendito el que viene en el nombre del SeñorBendito el que viene en el nombre del Señor
Bendito el que viene en el nombre del Señor
 
RM N° 587-2023-minedu norma para elñ año escolar 2024pdf
RM N° 587-2023-minedu norma para elñ año escolar 2024pdfRM N° 587-2023-minedu norma para elñ año escolar 2024pdf
RM N° 587-2023-minedu norma para elñ año escolar 2024pdf
 

T 06 ácidos nucleicos 17 18

  • 2. ÍNDICE 1. Definición 2. Composición química de los ácidos nucleicos Nucleotidos o Bases nitrogenadas § Bases pirimidínicas § Bases púricas o Pentosa o Ácido fosfórico Nucleósido Dinucleotidos Polinucleotidos 3. Nucleótidos no nucleicos Adenosín trifosfato (ATP) Adenosín monofosfato cíclico (AMP-c) Nucleótidos que intervienen en los procesos de óxido-reducción 4. Ácido desoxirribonucleico (ADN) 4.1. Estructura primaria 4.2. Estructura secundaria 4.3. Estructura terciaria 4.4. Estructura cuaternaria 5. Funciones del ADN 6. Desnaturalización del ADN 7. Ácido ribonucleico (ARN) 7.1. Estructura 7.2. Tipos y FunciónAnaya 96 (88) ARN mensajeros (ARNm) ARN de transferencia (ARNt) ARN ribosómicos (ARNr) ARN heterogéneo nuclear (ARNhn) 8. Preguntas PAU Canarias
  • 3. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   3 TEMA 6. ÁCIDOS NUCLEICOS 1.Definición Los ácidos nucleicos son macromoléculas constituidas por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos. Los ácidos nucleicos son compuestos de elevado peso molecular que están presentes en el núcleo de las células (también en determinados orgánulos como mitocondrias y cloroplastos). Son las moléculas encargadas de almacenar, transmitir y expresar la información genética. Existen dos tipos ADN (ácido desoxirribonucleico) y ARN (ácido ribonucleico), presentes ambos en toda clase de células animales, vegetales o bacterianas. 2.Composición química de los ácidos nucleicos Los ácidos nucleicos son macromoléculas poliméricas formadas por subunidades llamadas nucleótidos. Nucleotidos Están formados por la unión de una base nitrogenada, una pentosa y una molécula de ácido fosfórico (H3 PO4) o Bases nitrogenadas. Compuestos cíclicos formados por carbono y nitrógeno. Existen dos tipos: § Bases pirimidínicas, derivadas de la pirimidina. Son citosina (C), que se encuentra tanto en el ADN como en el ARN; timina (T), que se presenta sólo en el ADN; y uracilo (U), componente del ARN. § Bases púricas, derivadas de la purina. Las más importantes son adenina (A) y guanina (G). Las dos en ambos tipos de ácidos nucleicos. o Pentosa, ribosa en el ARN y desoxirribosa en el ADN. Ambas son aldopentosas, la única diferencia entre ambas está en que en el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del grupo alcohol (-OH) o Ácido fosfórico (H3 PO4) se encuentran en forma de ión fosfato. A.00. ¿Qué diferencia existe entre la ribosa y la desoxirribosa?
  • 4. Nucleósido. Es la unión de una pentosa (Ribosa o desoxirribosa) con una base nitrogenada. El enlace se forma entre el carbono anomérico del azúcar y uno de los nitrógenos de la base nitrogenada. En la unión se forma una molécula de agua. Este enlace recibe el nombre de enlace N-glucosídico. Si la pentosa es una ribosa, tenemos un ribonucleósido. Estos tienen como bases nitrogenadas la adenina, guanina, citosina y uracilo. Si la pentosa es un desoxirribosa, tenemos un desoxirribonucleósido. Estos tienen como bases nitrogenadas la adenina, citosina, guanina y timina. Se nombra añadiendo la terminación -osina, si derivan de una base púrica, adenosina, guanosina o -idina, si ésta es pirimidínica, citidina, timidina, uridina. Si la pentosa es la desoxirribosa se antepone el prefijo desoxi-; por ejemplo, desoxiaguanosina, desoxicitidina, etc. Los nucleótidos se forma por la unión de un nucleósido con el ácido fosfórico, esta se produce mediante la esterificación del azúcar por el ácido fosfórico. Es una unión fosfoéster entre un OH del ácido fosfórico y el OH situado en el carbono 5 del azúcar, con formación de una molécula de agua. Según el azúcar sea la ribosa o la desoxirribosa, tendremos ribonucleótidos o desoxirribonucleótidos. Los nucleótidos se nombran como el nucleósido del que proceden eliminando la a final y añadiendo la terminación monofosfato, por ejemplo, adenosin monofosfato (AMP). Llevan el prefijo desoxi-, en el caso de estar formadas por la pentosa desoxirribosa. (dAMP) Al grupo fosfato de los nucleótidos monofosfato puede unirse un segundo fosfato, y a éste un tercero, para formar los nucleótidos mono-, di- y trifosfatos (AMP, ADP y ATP), Dinucleotidos. La unión de dos nucleótidos mediante enlaces fosfodiester (entre el OH del ácido fosforico de un nucleótido y el OH del carbono 3' del siguiente formándose una molécula de agua) da lugar a un dinucleótido, si se une varios forman un polinucleótido. Los ácidos nucleicos son precisamente largas cadenas polinucleótidicas. Polinucleotidos. En la cadena de polinucleótidos, el nucleótido de uno de los extremos tendrá libre el OH del azúcar en posición 3, éste será el extremo 3' de la cadena. El ácido fosfórico del nucleótido que se encuentre en el extremo opuesto también estará libre, éste será el extremo 5'. Esto marca un sentido en la cadena de polinucleótidos. Toda cadena podrá considerarse bien en sentido 3' → 5' o en sentido 5' → 3' y así habrá que indicarlo.
  • 5. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   5 3. Nucleótidos no nucleicos No forman parte de los ácidos nucleicos, se encuentran libres en las células e intervienen en el metabolismo y en su regulación de enzimas, aportando energía química en las reacciones celulares, como coenzimas o como intermediarios activos en la síntesis de biomoléculas. Entre estos tenemos: Adenosín trifosfato (ATP) actúa como coenzima en diversas reacciones metabólicas implicadas en la transferencia de fosfato y energía siendo el intermediario energético celular por excelencia. Al hidrolizarse a ADP+P, libera la energía que es utilizada por la célula para realizar diversas funciones, como movimiento, síntesis de moléculas, producción de calor, transmisión nerviosa, transporte activo, etc. Por tanto en los seres vivos actúan como un almacén de energía. Adenosín monofosfato cíclico (AMP-c) actúa en las células como intermediario de muchas hormonas. Nucleótidos que intervienen en los procesos de óxido-reducción. Estas moléculas captan electrones de moléculas a las que oxidan y los ceden a otras moléculas a las que a su vez reducen. Nucleótidos transportadores de electrones: o NAD+ /NADH. Nicotin adenin dinucleótido oxidado y reducido, respectivamente. (Catabolismo) o NADP+ /NADPH. Nicotin adenin dinucleótido fosfato, oxidado y reducido. (Anabolismo) o FAD/FADH2. (Flavin adenin dinucleótido), oxidado y reducido. 4. Ácido desoxirribonucleico (ADN) El ADN es un polímero lineal formado por desoxirribonucleotidos de adenina, guanina, citosina y timina. El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se empezó a conocer su estructura. Se encuentra en el núcleo de las células eucariotas asociado a proteínas (histonas y otras) formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la información genética. También hay ADN en ciertos orgánulos celulares (por ejemplo: plastos y mitocondrias). El estudio de su estructura se puede hacer a varios niveles, presentan estructuras primaria y secundaria, aunque asociado o no a proteínas nucleares adoptan estructuras super-enrolladas que equivalen a una estructura terciaria.
  • 6. 4.1. Estructura primaria Es la secuencia de nucleótidos de una cadena o hebra. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica. Así, por ejemplo: 5' ACGTTTAACGACAAGTATTAAGACAAGTATTAA 3' 4.2. Estructura secundaria De acuerdo con el modelo propuesto por Watson y Crick, la estructura secundaria del ADN consiste en: ▪ Una doble hélice formada por dos cadenas helicoidales de polinucleótidos, enrolladas la una alrededor de la otra a lo largo de un eje imaginario común. ▪ El enrollamiento es dextrógiro (sentido de las agujas del reloj). ▪ Las cadenas son antiparalelas, se disponen en sentido opuestos. Una va en sentido 3' → 5' y la otra en sentido 5' → 3'. ▪ Situación: Las bases nitrogenadas se sitúan en el interior de la doble hélice mientras que el azúcar (la pentosa) y el ácido fosfórico forman el esqueleto externo; los planos de las bases quedan perpendiculares al eje de la hélice. ▪ Las dos cadenas están unidas por puentes de hidrógenos formados entre los pares adenina-timina (A=T) dos puentes y guanina-citosina (G≡C) tres puentes. Esta correspondencia entre las bases explica el hecho de que las dos cadenas de la doble hélice posean secuencias complementarias. Esta estructura secundaria hace posible explicar el papel del ADN como molécula que posee el mensaje genético, capaz de duplicarse o replicarse para transmitir este mensaje a las dos células hijas y transcribir, por otra parte, este mensaje para formar moléculas de ARN responsables de la síntesis de proteínas. Estas dos importantes funciones se basan, como veremos más adelante, en la complementariedad de sus bases.
  • 7. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   7 4.3. Estructura terciaria Es la disposición que adopta la doble hélice de ADN al asociarse con proteínas. En las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas formando la cromatina. En la cromatina, la doble hélice de ADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando los nucleosomas. 4.4. Estructura cuaternaria Es el enrollamiento que sufre el conjunto de nucleosomas, al cual se le llama solenoide. (Los   solenoides  se  enrollan  formando  la  cromatina  del  núcleo  interfásico  de  la  célula  eucariota.  Cuando  la  célula  entra   en  división,  el  ADN  se  compacta  más,  formando  los  cromosomas). 5. Funciones del ADN El ADN contiene la información celular heredable, es decir, información genética que se transmite en la reproducción. El modelo de la doble hélice permite comprender cómo puede desempeñar esta función atendiendo a las características que requiere esta misión: 1º capacidad de replicación, 2º capacidad de contener información y 3º posibilidad de mutación. Capacidad de replicación. La replicación o duplicación de la molécula original para formar dos moléculas hijas idénticas se explica mediante la complementariedad de las bases, si las dos cadenas se separan, cada cadena puede servir de molde para la síntesis de una nueva cadena complementaria. De esa manera, la información genética en la secuencia de bases puede transmitirse fielmente. Capacidad de contener información. La información está contenida en la secuencia de bases. Una determinada secuencia de nucleótidos del ADN puede traducirse en una secuencia determinada de aminoácidos de acuerdo con la hipótesis “un gen-una enzima”. Mediante el proceso de transcripción se transfiere la información (secuencia de bases de ADN) a otra molécula, el ARNm (mensajero), que traslada sus órdenes al citoplasma donde los ribosomas traducen esta información fabricando una determinada cadena polipeptídica. Posibilidad de mutación. La mutación (cambio en la información genética) que hace posible el hecho evolutivo se explica como un cambio en la secuencia de las bases, esto implica la sustitución de un aminoácido por otro en la proteína que, a su vez, puede significar un cambio en la función de ésta. Las mutaciones pueden producirse por “errores” en el proceso de replicación. Aunque este fenómeno se produce con mucha frecuencia, la mayoría de las mutaciones son inviables, es decir, el resultado es incompatible para la vida. Por ello, las células poseen mecanismo de reparación de errores sustituyendo el fragmento equivocado y colocando las bases complementarias correctas en la cadena inicial.
  • 8. 6.Desnaturalización del ADN Si una disolución de ADN se calienta suficientemente ambas cadenas se separan, pues se rompen los enlaces de hidrógeno que unen las bases, y el ADN se desnaturaliza. La temperatura de desnaturalización depende de la proporción de bases. A mayor proporción de C≡G, mayor temperatura de desnaturalización, pues la citosina y la guanina establecen tres puentes de hidrógeno, mientras que la adenina y la timina sólo dos y, por lo tanto, a mayor proporción de C≡G, más puentes de hidrógeno unirán ambas cadenas. La desnaturalización se produce también variando el pH o a concentraciones salinas elevadas. Si se restablecen las condiciones, el ADN se renaturaliza y ambas cadenas se unen de nuevo. 7.Ácido ribonucleico (ARN) 7.1. Estructura Los ácidos ribonucléicos (ARN) están formados por ribonucléotidos (su pentosa es la ribosa), sus bases nitrogenadas son adenina, guanina, citosina y uracilo, compuesto este último que sustituye a la timina del ADN. Estos ribonucléotidos se unen entre sí mediante enlaces fosfodiéster en sentido 5’ → 3’, al igual que el ADN. A diferencia del ADN, el ARN es casi siempre monocatenario (excepto en los reovirus donde es bicatenario). 7.2. Tipos y Función Sse distinguen varios tipos de ARN: ARNm (mensajero), ARNr (ribosómico), ARNt (transferente) y el ARNhn (heterogéneo nuclear). ARN mensajeros (ARNm). Forman cadenas cortas y lineales que poseen únicamente estructura primaria y que pueden llegar a estar formadas hasta por 5.000 nucleótidos. Sintetizado como copia complementaria de un segmento de ADN, lleva la información desde el ADN (núcleo) a los ribosomas (citoplasma) para la síntesis de proteínas. ARN de transferencia (ARNt). Están formados por moléculas relativamente pequeñas que contienen entre 70 y 90 nucleótidos y constituyen una única hebra o cadena. Esta cadena presenta zonas con doble hélice, que dan lugar a la estructura secundaria en “hoja de trébol”. Los distintos ARNt dispersos en el hialoplasma se encargan de recoger los diferentes aminoácidos y de transportarlos hasta los ribosomas.
  • 9. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   9 En el ARNt podemos distinguir un brazo aceptor de aminoácidos abierto y un bucle anticodón formado por un triplete de bases nitrogenadas y que es complementario del correspondiente triplete codón del ARNm ARN ribosómicos (ARNr). son los más abundantes (90 - 95 % de los ARN). Al igual que el ARNt presenta zonas con estructura de doble hélice. Se encuentra en los ribosomas asociado a proteínas, formando parte de subunidades que los integran. Los ribosomas son los orgánulos encargados de la biosíntesis de proteínas; concretamente, “traducen” la secuencia de bases del ARNm en la secuencia correspondiente de aminoácidos. ARN heterogéneo nuclear (ARNhn), se localizan en el núcleo. Presentan gran variedad de tamaños, de ahí su nombre. Es el precursor de los ARNm, en los que se transforman tras un proceso de maduración que implica la eliminación de secuencias de nucleótidos no codificantes. ARN ADN Composición química Pentosa Ribosa Desoxirribosa Base Adenina, guanina, citosina y uracilo. Todas ellas en distinta proporción. Adenina, guanina, citosina y timina. La proporción de adenina es idéntica a la timina, lo mismo ocurre con guanina y citosina (En el ADN de doble cadena). Estructura Cadena Los ARN son monocatenarios, están constituidos por una sola cadena polinucleótidica (excepto en algún virus) El ADN es bicatenario, está constituido por una doble cadena polinucleótidica (excepto en algunos virus) Configuración Salvo el ARNt (con estructura en hoja de trébol), no presentan una estructura espacial determinada. Estructura en doble hélice, con las dos cadenas unidas mediante el emparejamiento de las bases A=T y G≡C. Función En el proceso de transcripción se traslada información (secuencia de bases) del ADN a otras moléculas: el ARNm (mensajero), actúa como intermediario para llevar la información contenida en el ADN al citoplasma. La traducción de la secuencia de bases del ARNm se realiza en los ribosomas (constituidos por ARNr y proteínas) del citoplasma. Los ARNt específicos transportan los aminoácidos colocándolos en el orden exacto para formar la proteína. Almacena la información sobre qué aminoácidos y en qué orden deben unirse para producir todas las proteínas celulares está codificada en la secuencia de bases del ADN. Un “gen” se define como un fragmento de ADN que contiene la información para la síntesis de una cadena polipeptídica.
  • 10. 8.Preguntas PAU Canarias 01. Junio 2000 El ADN es la molécula encargada de almacenar y transmitir la información genética. Su estructura es un reflejo de esta función, ya que permite que la molécula se duplique antes de la división celular, de manera que la información genética llega a las dos células hijas. a) Explica, sin entrar en fórmulas químicas, cuáles son las características estructurales básicas de la molécula de ADN. 1 punto. b) ¿Qué hay en esta estructura que haga posible la duplicación de la molécula? 0,8 puntos. c) ¿En qué se diferencian las estructuras de las moléculas de ADN y ARN? 1,2 puntos. 02. Sept 2000 Las vitaminas son compuestos orgánicos relativamente sencillos y que son imprescindibles para la vida. a) ¿Por qué es esencial incluirlas en la dieta de los seres humanos, mientras que otros organismos pueden vivir sin ellas? 0,5 puntos. b) ¿Conoces algún ejemplo de vitamina? ¿Es liposoluble o hidrosoluble? ¿Qué efectos tiene su carencia? 1 punto. c) Algunas vitaminas son de naturaleza proteica. Explica en qué lugar de la célula se realiza su síntesis, qué orgánulos participan y cuáles son los sustratos (precursores) que se usan en dicha síntesis. 1,5 puntos. 03. Sept 2000 Las enzimas son compuestos orgánicos esenciales en las células vivas. Se ha dicho de ellas que son las artífices de que pueda existir vida sobre la Tierra, ya que hacen posible que en las células vivas ocurran reacciones químicas de una manera compatible con la vida. a) ¿Cuál es la naturaleza química de las enzimas? 0,6 puntos. b) Explica brevemente cuál es la función de las enzimas. 1,2 puntos. c) Describe con ayuda de un gráfico cuál es la relación entre la energía de activación y la acción de las enzimas. 1,2 puntos. 04. Junio 01 Las características básicas de la replicación del ADN son las siguientes: es bidireccional, es semiconservativa, se inicia en orígenes de replicación y avanza sólo en sentido 5’->3’. a) Explica con tus palabras el significado de cada una de estas características. 1 punto. b) También decimos de la replicación que es un proceso que presenta una gran “fidelidad”. Explica su significado y su importancia en la supervivencia de la especie. 0,7 Puntos. c) En ocasiones, durante la replicación se producen mutaciones en el ADN. ¿Qué entiendes por mutaciones? ¿Qué relación hay entre las mutaciones y la evolución de las especies? 0,7 puntos. e) El ADN es una doble cadena de nucleótidos antiparalela. A partir de las fórmulas de la adenina, la desoxirribosa y el ácido fosfórico, formula el desoxirribonucleótido de adenina o desoxiadenosin monofosfato (AMP). 0,6 puntos. 05. Junio 02 La replicación del ADN es un proceso importante para las células a. ¿Cuál es la finalidad de la replicación? ¿En qué fase del ciclo celular se produce? ¿Por qué es tan importante que la replicación se produzca de forma fiel? 1 punto. b. Usando los símbolos adjuntos, dibuja una molécula de ADN en la que una cadena tenga la secuencia 5’- ATCG-3’. 1 punto. c. Dibuja ahora una molécula de ARN con secuencia complementaria a la del apartado b). 1 punto. 3´- 06. Junio 02 El par A TP → ADP Y el par NÁDH → NAD' tienen un papel central en el metabolismo, actuando como aceptores o donadores en diversas reacciones y vías metabólicas. a. ¿Qué es lo que aceptan o donan cada uno de estos pares? ¿Cuál de los dos miembros del pares el donador y cuál es el aceptor? 0,7 puntos b. El ATP es un nucleótido. ¿De qué se compone un nucleótido? ¿Y un nucleósido? ¿En qué macromoléculas podemos encontrar los nucleótidos? 1 punto. c. En condiciones aerobias la mayor parte del A TP se produce en la fosforilación oxídativa. ¿En qué lugar de la célula ocurre? Describe de qué manera se produce A TP a partir de NADH mediante este proceso. ¿Cuál es el aceptar final de los electrones en la cadena respiratoria? 1,3 puntos. d. Una mutación que cambie solamente una base por otra en el ADN, ¿podría bloquear la fosforilación oxidativa en las células que contienen esa mutación? Razona la respuesta. 1 punto 07. Sept 02 El agua es, sin duda, el componente más abundante de los seres vivos y en ella se disuelven el resto de los componentes de la materia viva. a) Nombra el tipo de interacción que realizan las moléculas de agua entre sí en disolución y explica en qué consisten. ¿Qué se entiende por sustancias hidrófobas e hidrófilas? 1 punto. b) El ácido fosfatídico (fonnado por glicerol, dos ácidos grasas y una molécula de ácido fosfórico) es el más sencillo de los glicerofosfolípidos, ya que contiene sólo una molécula de ac. fosfórico en la posición 3 del glicerol. Une una molécula de A dos de B y una de C para fonnar el ácido fosfatídico. 1 punto. c) Los glicerofosfolípidos son un componente fundamental de cierto tipo de estructuras biológicas. Nombra esta estructura, haz un dibujo (poniendo nombre a las diferentes partes) y di en qué consisten sus propiedades fundamentales: fluidez y asimetría. 1 punto. d) Otro componente de las células, el ADN, tiene la particularidad de que se organiza de diferente manera en las células en división y en las que no lo están. Nombra y describe brevemente estos dos modelos de organización. 1 punto.
  • 11. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   11 08. Junio 03 El cuadro adjunto contiene un azúcar, un lípido y un dipétido. a) Indentifica cada molécula numerada. b) Dibuja las moléculas resultantes de la hidrólisis del compuesto nº 2. 09. Sept 03 La publicidad de cierto producto lácteo dice “Si está preocupado por el colesterol y los triglicéridos, le interesa saber que existen dos tipos de grasas: las saturadas y las insaturadas, siendo éstas últimas más saludables por lo que el producto está enriquecido con ácidos grasos Omega-3 para el control de los niveles....”. a) ¿A qué tipo de biomoléculas (ac. nucleicos, lípidos, glúcidos o proteínas) hace referencia el anuncio? b) ¿Cómo son químicamente los ácidos grasos? c) ¿Qué significa que son moléculas anfipáticas? d) ¿Qué significa que pueden ser saturadas o insaturadas? 10. Sept 03 Completa la tabla adjunta para indicar qué elementos químicos forman parte de los compuestos que se muestran. 11. Junio 04 Un fragmento de un ácido nucleico bicatenario de una célula está constituido por un 20% de G y un 20% de C. a. ¿Las letras G y C qué simbolizan? b. ¿Cuál es el nombre de cada una? c. ¿A quién le corresponde el 60% restante? d. ¿A qué tipo de ácido nucleico corresponde el fragmento? e. ¿Cuál es su principal función? 12. Sept 04 En la célula se encuentran los nucleótidos que tienen una notable importancia biológica a.- ¿Cuál es la composición química de un nucleótido? b.- Indica cuál es la principal función del: ATP, NADH, ADN. c.- Indica los tipos y función de los ARN 13. Jun 05 Los ácidos nucleicos son uno de los componentes más importantes de la célula ya que son los encargados de transmitir la información genética. a.- Representa la estructura básica de un nucleótido. b.- Empleando los esquemas adjuntos, dibuje el fragmento de ADN nuclear con secuencia “ T A C “ en una cadena.. c.- ¿Cuales son las diferencias estructurales entre ADN y ARN?. 14 Sept 05 Los ácidos nucleicos son uno de los componentes más importantes de las células. a.- Construye una cadena de ácido nucleico con la secuencia 5’-G-C-U-A-3’ Utiliza las piezas adjuntas tantas veces como sean necesario. b.- Indica razonadamente a qué tipo de ácido nucleico pertenece el fragmento. c.- ¿Cuál es la principal función? 15. Jun 06 Un fragmento de un ácido nucleico bicatenario de una célula está constituido por un 30% de Adenina. a.- ¿Cuáles son los porcentajes de Guanina, Citosina, Uracilo y Timina? b.- ¿A qué tipo de ácido nucleico corresponde el fragmento? c.- ¿Por qué tipo de pentosa (azúcar) está formado? d.- ¿En qué lugar de la célula se localiza?
  • 12. 16. Sept 06 Los ácidos nucleicos son los componentes estructurales de la información genética. a.- ¿Cuáles son los componentes de un nucleósido y un nucleótido?. b.- Copia y completa la tabla adjunta. c.- A nivel de función, ¿Cuál es la diferencia entre la ADN polimerasa y la ARN polimerasa? 17. Junio 07 En 1956, M.B. Hoagland descubre la existencia de un tipo de ácido nucleico. La figura adjunta esquematiza dicha macromolécula. a.- La molécula presenta ciertas zonas bicatenarias. Indica entre qué nucleótidos se puede establecer la complementariedad de bases en este tipo de ácido nucleico. b.- ¿Cuál es su principal función? c.- Indica algún orgánulo celular que contenga este tipo de ácido nucleico 18. Sept 07 En la célula se encuentran los nucleótidos que tienen una notable importancia biológica a.- ¿Cuál es la composición química de un nucleótido? b.- ¿Cómo se llama el enlace que une a dos o más nucleótidos? c.- Indica cuál es la principal función del: ATP, NADH, ADN, ARN. d.- ¿Cuáles son las diferencias estructurales entre el ADN y el ARN? 19. Junio 08 Los ácidos nucleicos son macromoléculas de gran importancia biológica en todos los seres vivos. a.- Construye un biopolímero con la secuencia 5´-G-C-U-A-3´. Utiliza lo que corresponda, tantas veces como sea necesario, las piezas adjuntas que representan a los componentes: pentosa, bases nitrogenadas y grupo fosfato. b.- Indica a qué tipo de ácido nucleico pertenece la secuencia de nucleótidos. c.- ¿Cuál es la principal función de este ácido nucleico? 20. Sept 08 La medicina forense utiliza una técnica, huella genética, que permite distinguir entre individuos de la misma especie usando sólo muestras de su ADN. a.- ¿Cuál es la principal función del ADN? b.- ¿Cuáles son los tipos de nucleótidos que pueden formar parte de la estructura del ADN? c.- ¿Qué orgánulos contienen moléculas de ADN en una célula eucariota animal? d.- El ADN que contiene una célula procariota, ¿presenta cadena simple o doble? 21. Junio 09.-  Los ácidos  nucleicos  son uno de los componentes más importantes de la célula ya que son los encargados de transmitir la información genética garantizando la perpetuación de la vida. a.-­‐  ¿Cuál es la composición de un nucleótido? b.-­‐  A nivel de los componentes de un nucleótido ¿cuál es la diferencia entre los nucleótidos que forman el ADN y los que constituyen el ARN? c.-­‐  ¿El ATP es un nucleótido? d.-­‐  ¿Qué tipo de ácidos nucleicos contienen las células procariotas? 22. Junio 09.-  Chargaff (1950) demostró que las proporciones  de  las  bases  nitrogenadas  eran diferentes en los distintos organismos, aunque seguían algunas reglas. Estas reglas se cumplen en los organismos cuyo material hereditario es ADN de doble hélice. De un fragmento mono catenario de ADN humano aislado, se analizaron las proporciones de las bases nitrogenadas y se encontró: a.-­‐  Determina las proporciones de bases de la cadena complementaria de ADN. b.-­‐  ¿Cómo se denomina al proceso mediante el cual se pasa la información del ADN al ARN? c.-­‐  A partir de este ADN monocatenario ¿Qué proporción de bases tendría el ARN sintetizado? d.-­‐  ¿Dónde tiene lugar el proceso mediante el cual se pasa la información del ADN a ARN? 23. Sept. 09. La supervivencia y el mantenimiento de las especies requiere que su historia evolutiva pase de generación en generación utilizando el material  genético  propio de la especie a.-­‐  ¿Qué molécula almacena la información genética y se transmite a la siguiente generación? b.-­‐  ¿Cuál es la unidad estructural de dicha molécula? c.-­‐  Cita dos moléculas que tengan las mismas subunidades estructurales que el material genético d.-­‐  ¿Qué función desempeñan cada una de las dos moléculas citadas en el apartado c? ADN ARN Composición química Azúcar Bases nitrogenadas Estructura Monocatenario Bicatenario Función
  • 13. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   13 24. Junio 10. Esp. La gran diversidad funcional del ADN  y del ARN  depende en gran medida de la combinación lineal de unos pocos nucleótidos diferentes. a.  ¿Cuál es la composición de los nucleótidos? b.  ¿Cómo se llama el enlace entre nucleótidos en el ADN? c.  Nombre un nucleótido cuya función sea la de coenzima. d.  Nombre e indique las funciones de los tres tipos de ARN. 25. Junio 10. Gen. La estructura y propiedades de los ácidos  nucleícos  dependen en gran medida de las de las bases constituyentes. a.  Nombre los componentes químicos del Nucleótido GTP. b.  ¿Qué tipo de enlace en el ATP contiene alta energía? c.  ¿Cómo se denomina al azúcar que forma parte de los nucleótidos de ADN y al que forma parte de los del ARN? d.  ¿Qué mantiene unidas a las dos cadenas de nucleótidos que forman el ADN? 26. Sept 10. Genr Los polímeros de ADN y ARN son de importancia vital en la célula. Copia y completa la tabla adjunta en la hoja de examen. 27. Junio 11. En el interior celular se pueden encontrar diferentes ácidos nucleicos . La figura adjunta esquematiza un tipo de esta macromolécula. a. Se pueden observar ciertas zonas bicatenarias. Indica entre qué nucleótidos se pueden establecer la complementariedad de bases en este tipo de ácido nucleico. b. ¿Cuál es la principal función de este tipo de ácido nucleico? c. Cita dos moléculas que contengan las mismas subunidades estructurales, nucleosídicas, que los ácidos nucleicos. d. ¿Qué función desempeñan cada una de las dos moléculas citadas en el apartado c? 28. Sept 11. Un fragmento de un ácido nucleico monocatenario de una célula está constituido por un 30% de Uracilo . a. ¿Cuál es la composición química de un nucleótido? b. Nombra otros nucleótidos que pueden ser componentes de este fragmento de ácido nucleico. c. ¿Cuál es la principal función de este tipo de ácido nucleico? d. ¿En qué lugar de la célula se localiza para realizar su función? 29. Junio 12. La E. coli es la bacteria más común en nuestro organismo. En una muestra, tras la separación y purificación, se ha obtenido el fragmento de oligonucleótidos adjunto donde cada letra simboliza un tipo de base nitrogenada. a. ¿A qué tipo de macromolécula corresponderá el fragmento adjunto? b. Indica cuál es la principal función de la macromolécula. c. La macromolécula en cuestión para desempeñar su función, ¿dónde se encuentra dentro de una célula de nuestro organismo? d. Cita dos nucleótidos que actúen como Coenzima. 30. Sept 12. La estructura y propiedades de los ácidos nucleicos dependen en gran medida de las unidades nitrogenadas constituyentes. a. ¿Cuál es la composición de las unidades que constituyen el ADN? b. A nivel estructural, ¿qué diferencias hay entre los tipos de ácidos nucleicos? c. ¿Cuáles son las principales funciones de los ARN? d. ¿En qué lugar de la célula se localiza cada tipo ARN? 31. Junio 13. La detección de ADN de caballo en ciertos productos etiquetados como cárnicos de vacuno, como se desprende de los resultados analíticos encargados por la Organización de Consumidores y Usuarios (OCU), suponen un engaño al consumidor. a. Si un fragmento de este ADN equino contiene 30% de Adenina, ¿qué cantidad existirá de las restantes bases nitrogenadas? b. ¿Qué orgánulos contienen ADN en una célula animal? c. ¿Cuál es la principal función del ADN? d. ¿Cuáles son las diferencias estructurales entre ADN y ARN? 32. Junio 13. La manzana es una de las frutas más completas. Con más de mil variedades, su contenido medio es ~ 85% de agua, además de carbohidratos , grasas , proteínas, fibra, vitaminas y minerales. a. Identifica el lípido y los dos glúcidos del recuadro adjunto. b. Identifica qué molécula es un constituyente del ARN. c. Cita dos vitaminas: una hidrosoluble y otra liposoluble. d. Cita un glúcido con función de reserva en una célula animal y otro en una célula vegetal.
  • 14. 31. Julio 13. Un equipo científico de la Universidad del Noroeste (Illinois, USA) han desarrollado una crema con nanopartículas de ácidos nucleicos para tratamientos genéticos cutáneos, una vez se aplica directamente sobre la piel, penetra en todas sus capas y puede actuar selectivamente sobre genes que causan enfermedades. Sí un fragmento de un ácido nucleico bicatenario de una célula está constituido por un 20% de Adenina. a.- ¿Qué porcentaje hay de Guanina, Citosina, Uracilo y Timina en este fragmento? b.- ¿A qué tipo de ácido nucleico correspondería el fragmento? c.- ¿Por qué tipo de glúcido (pentosa) está constituido este ácido nucleico formado? d.- ¿En qué lugar de la célula humana se podría localizar este fragmento de ácido nucleico? 33. Junio 14. Un apartado destacado de la Web del Instituto Canario de Hemodonación y Hemoterapia es el significado de las siglas de las analíticas, concretamente, para la serología se tiene la información adjunta. a. Composición química de cada tipo de ácidos nucleicos. b. Función de cada tipo de ácidos nucleicos. c. Localización en el interior de una célula eucariota animal. 34. Julio 14. Un equipo de investigadores norteamericanos y europeos han logrado por primera vez crear un cromosoma eucariótico artificial. La revista Science, donde se publica el estudio, no ha dudado en calificar el hallazgo como “el monte Everest de la Biología sintética”. a.- ¿En qué se diferencia un nucleósido de un nucleótido? b.- Indica cuál es la principal función del: ATP, NADH, ADN. c.- Construye una cadena de ácido nucleico con la secuencia 5’-G-C-U-A-3’. Utiliza las piezas adjuntas tantas veces como sean necesarios. d.- Indica a qué tipo de ácido nucleico pertenece el fragmento y porque no puede pertenecer a otro. 35. Junio 15. Gracias a los grandes avances recientes de la genómica, se ha podido demostrar por encima de toda duda que nuestro genoma contiene 145 genes de origen microbiano. ¡Y son importantes! (Fuente: El País). a. ¿Qué nucleótidos podemos encontrar en la molécula de ADN? b. ¿Dónde podemos localizar ADN en una célula animal? c. ¿Dónde podemos localizar ADN en una célula vegetal? d. ¿Cuál es la principal función de este ácido nucleico? 36. Julio 15. Los virus de ARN son los que "pueden generar más rápidamente una pandemia en el mundo", los que mutan con mayor facilidad y se vuelven más virulentos, y los que ya han causado enfermedades infecciosas como el sida y la gripe. (Fuente: Agencia EFE) a. ¿Cuál es la composición química de las subunidades que constituyen el ARN? b. Indica los tipos de ARN y su función en una célula eucariota. c. Indica dónde se pueden localizar ARN en una célula vegetal. 37. Junio 16. Un fragmento de un ácido nucleico monocatenario de una célula está constituido por un 30% de Uracilo. a. ¿Cuál es la composición química de un nucleótido? b. ¿Qué otros nucleótidos pueden ser componentes de este fragmento de ácido nucleico? c. ¿Cuál es la principal función de este tipo de ácido nucleico? d. ¿En qué lugar de una animal se localizaría este tipo de ácido nucleico para realizar su función? 38. Julio 16. Pagan más de 5 millones de dólares por la carta sobre el descubrimiento del ADN . F. Crick la envió carta de a su hijo Michael, que entonces tenía 12 años. a. ¿Cuál es la principal función del ADN? b. ¿Diferencias de los componentes químicos presentes entre los nucleótidos del ADN y el ARN? c. ¿Qué orgánulos contienen moléculas de ADN en una célula animal? d. El ADN que posee una célula eucariota, ¿Es de cadena simple o doble? 38. Junio 17. La biomedicina lleva años buscando las claves de enfermedades en el ADN de sus pacientes. Sin embargo, algunos científicos han decidido cambiar de perspectiva. ¿Por qué no estudiar también a los que, a pesar de poseer una herencia genética desfavorable, están sanos, para saber qué les protege? El Proyecto Resiliencia busca entre la población a esos héroes inesperados (Fuente: Publico.es)
  • 15. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   15 a.- Copia y completa la tabla adjunta. b.- A nivel de función, ¿Cuál es la diferencia entre la ADN polimerasa y la ARN polimerasa? ACTIVIDADES A. 01. Una vez aislado un fragmento monocatenario de ADN humano, se analizaron las proporciones de las bases nitrogenadas y se encontró: A: 27% G: 35% C: 25% T: 13% a. Determina las proporciones de bases de la cadena complementaria. b. Comenta las propiedades de las dobles hélices en función de las proporciones de bases. c. Calcula las proporciones de bases del ARN que transcribiría del fragmento inicial. A. 02. El material genético de los virus puede ser ADN (de cadena sencilla o doble) o ARN (de cadena sencilla o doble). En la tabla siguiente se indica la composición de bases de cuatro virus: Determine en cada caso si el virus contiene ADN o ARN y si el ácido nucleico es de cadena sencilla o de cadena doble. A. 03. El esquema anexo representa el efecto del pH sobre la actividad de dos enzimas A y B. a. Describe el comportamiento de las dos enzimas. ¿Se comportan la misma manera? Razona la respuesta. b. El enzima A cataliza la transformación de X en Y, y la enzima B la transformación de X en Z. ¿Cuál de los dos productos se formará en mayor cantidad a un pH de 5? ¿Y a un pH de 7,5? Razona la respuesta. c. ¿Qué relación tienen con la energía de activación? d. Además del pH, ¿qué otros factores pueden modificar la actividad enzimática? Utiliza ejemplos y razona sobre sus efectos. A. 04. El esquema anexo representa el efecto de la temperatura sobre la actividad de dos enzimas A y B. a. ¿Se comportan las dos enzimas de la misma manera? Razona la respuesta. b. El enzima A cataliza la reacción de X → Y y la enzima B la transformación de X → Z . ¿Cuál de los dos productos se formará en mayor cantidad a 40º C? ¿Y a 70º C? Razona la respuesta. c. ¿Qué es una enzima y cuales son sus funciones biológicas? ¿Por qué tipos de unidades básicas están formadas? ¿Qué relación tienen con la energía de activación? d. Además de la temperatura, ¿qué otros factores pueden modificar la actividad enzimática? Utiliza ejemplos y razona sobre sus efectos. A. 05. Copia la tabla adjunta para indicar qué elementos forman parten de los compuestos que se nombran:
  • 16. A. 06. Completa: indicando cuáles de los siguientes elementos químicos están presentes en los compuestos mencionados: H, C, O, P, N A. 07. Completa: indicando cuáles de los siguientes elementos químicos están presentes en los compuestos mencionados: H, C, O, P, N A. 08.. El siguiente esquema generaliza el transcurso de una de las reacciones que ocurren en el metabolismo celular: Triglicéridos Ácidos grasos + glicerina a. ¿Qué tipo de lípidos son los triglicéridos? ¿Qué funciones biológicas tienen este tipo de lípidos? b. ¿Qué "transformación" sufren los triglicéridos para convertirse en ácidos grasos + glicerina? ¿Se captaría agua en el transcurso de la reacción representada en el esquema? Explícalo brevemente. c. ¿Quiénes son los sustratos y los productos de la reacción indicada? ¿Se trataría de una reacción anabólica o catabólica? Razona la respuesta. A. 09. El agua es, sin duda, el componente más abundante de los seres vivos y en ella se disuelven el resto de los componentes de la materia viva. a) Nombra el tipo de interacción que realizan las moléculas de agua entre sí en disolución y explica en qué consisten. ¿Qué se entiende por sustancias hidrófobas e hidrófilas? 1 punto b) El ácido fosfatídico (formado por glicerol, dos ácidos grasos y una molécula de ácido fosfórico) es el más sencillo de los glicerofosfolípidos, ya que contiene sólo una molécula de ac. fosfórico en la posición 3 del glicerol. Une una molécula de A, dos de B y una de C para formar el ácido fosfatídico. 1 punto.. c) Los glicerofosfolípidos son un componente fundamental de cierto tipo de estructuras biológicas. Nombra esta estructura, haz un dibujo (poniendo nombre a las diferentes artes) y di en qué consisten sus propiedades fundamentales: fluidez y asimetría. 1 punto. d) Otro componente de las células, el ADN, tiene la particularidad de que se organiza de diferente manera en las células en división y en las que no lo están. Nombra y describe brevemente estos dos modelos de organización. 1 punto A. 10. El siguiente cuadro contiene los datos obtenidos en un experimento en el que utilizaron distintas moléculas de origen biológico. Copia en tu hoja de examen el cuadro y señala lo que crees que indican los números en los recuadros.
  • 17. IES  BAÑADEROS  CIPRIANO  ACOSTA                                                                                                                        2º  Bach.  BIOLOGÍA                                                                                                                              TEMA  6  ÁCIDOS  NUCLEICOS   17 A. 11. Copia en tu hoja de examen la siguiente tabla y completa los términos correspondientes a las biomoléculas que se mencionan.