SlideShare una empresa de Scribd logo
TEMA 1 - 2ª Parte
BLOQUE 2 LA
ORGANIZACIÓN CÉLULAR
ÁCIDOS NUCLÉICOS
TIPOS
• DNA (ácido
desoxirribonucleico)
– Azúcar: Desoxirribosa
– Bases:
• Citosina
• Timina
• Adenina
• Guanina
Doble cadena
• RNA (ácido
ribonucléico)
– Azúcar: ribosa
– Bases:
• Citosina
• Uracilo
• Adenina
• Guanina
Cadena simple
ÁCIDOS NUCLÉICOS
ESTRUCTURA Y FUNCION DEL ADN
La secuencia de los nucleótidos.
Es la secuencia de nucleótidos de una cadena o
hebra. La estructura del ADN viene determinada
por el orden de los nucleótidos en la hebra o
cadena de la molécula.
Para indicar la secuencia de una cadena de ADN
es suficiente con los nombres de las bases o su
inicial (A, T, C, G) en su orden correcto y los
extremos 5' y 3' de la cadena nucleotídica.
Así, por ejemplo:
5‘- ACGTTTAACGACAAGGACAAGTATTAA - 3'
Función:
• Información codificada : 5‘- ACGTTTAACGACAAGGACAAGTATTAA - 3‘
• Capacidad de duplicarse
• Sirve para elaborar las proteínas celulares.
Replicación del ADN
Proceso
semiconservativo. Las
dos hebras se separan
y cada una sirve de
molde para la síntesis
de una nueva hebra.
VIDEOVIDEO
ADN
POLIMERASA
3´
3´
SÍNTESIS DE PROTEINAS
2 Pasos:
1º Transcripción ADN  ARNm
2º Traducción ARNm  Proteinas
.
.
Transcripción
Síntesis de ARNm. ARN polimerasa
coloca los nucleotidos. (recordad U en
vez de T).
VIDEOVIDEO
TRADUCCIÓN
Síntesis de una proteína en los ribosomas.
Información de ARNm codificada en forma de tripletes
(codones), cada tres bases determinan un aminoácido.
Los aa son
transportados por
los ARNt Los ARNt tienen un
anticodón
complementario del
codón del ARNm
Los aa van uniendose
por enlaces peptídicos
 proteina
animacion1
animacion 2
VIDEO
ANIMACIÓN EJERCICIOANIMACIÓN EJERCICIO
ADN: 5– GGTACGTAGCTA –3
1º Hebra ADN complementaria
2º ARN m
3º Proteína
ANIMACIÓN EJERCICIO
Ejercicio 13
Lugol: color amarillento que
en presencia de almidón pasa a
violeta.
Felhing: color azul pasa a rojo
en presencia de azucar
reductor  CARBONILO INTACTO
PUEDE REACCIONAR. Monosacáridos y
Disacáridos excepto Glucosa+Fructosa
VIDEO
Monosacárido
Disacárido Glucosa+ glucosa
Disacárido Glucosa+ fructosa
2 monosacáridos Glucosa y fructosa
Polisacárido
Monosacárido
Disacárido Glucosa+ lactosa
Gráfica actividad de
una enzima a
diferentes
concentraciones de
sustrato.
2 muestras de ácidos nucleicos y
se observaron las siguientes
proporciones de bases
ADN
ARN
28% 22% 22%
14% 35%
17
TAMAÑO DE LAS CÉLULAS
Biología y Geología 4º ESO:
La célula 18
• Sólo son visibles al
microscopio.
• Se mide en
micrometros (μm) o
micra: milésima parte
del milímetro.
Biología y Geología 4º ESO: La célula 19
TEORÍA CELULAR
La teoría celular quiere decir:
a)Todos los seres vivos están
formados por células, aunque sólo sea
por una.
Para que un ser se considere que está
vivo, debe de estar formado por células.
En el caso de microorganismos, se trataría
de una única célula, aún así capaz de
realizar las tres funciones vitales.
b)La célula es la unidad más pequeña y
sencilla capaz de realizar las tres
funiones vitales.
c)Toda ceĺula procede, por división, de
una célula anterior.
TIPOS DE ORGANIZACIÓN CELULAR
21
• Hay dos tipos Eucarióticas y Procarióticas.
• Procarióticas:
– El material genético (ADN) está disperso por el
citoplasma y no está rodeado por membrana que
lo separe del citoplasma, no tienen núcleo.
– Son más sencillas.
– Carecen de orgánulos celulares membranosos.
– En bacterias.
• Eucarióticas:
– El material genético esta en el interior del
núcleo.
– Son más complejas.
– En el resto de seres vivos: protozoos, algas,
hongos, animales y plantas.
22
2 GRANDES TIPOS DE ORGANIZACIÓN CELULAR.
CÉLULAS PROCARIOTAS CÉLULAS EUCARIOTAS
Menor tamaño (0,3-3 μm) Mayor tamaño (5-20 μm)
Menor complejidad. Mayor complejidad.
Material genético disperso por el
citoplasma.
Material genético encerrado en
una estructura especializada
(núcleo).
No posee orgánulos. Posee orgánulos que realizan
funciones específicas.
Sólo las bacterias poseen células
procariotas.
Protistas, hongos, plantas y
animales, sus células son
eucariotas.
CÉLULA
EUCARIÓTICA
MEMBRANA
PLASMÁTICA
CITOPLASMA
NÚCLEO
Citosol o Hialoplasma
Orgánulos celulares
• Membranosos:
Aparato de Golgi.
 Retículo Endoplasmático Liso y Rugoso
Mitocondrias.
Lisosomas.(sólo en cél animales)
Cloroplastos (sólo en cél
vegetales)
Vacuolas.
•No Membranosos:
Ribosomas
Cilios y Flagelos.
Centriolos. (sólo en células animales)
Citoesqueleto
Rodea a toda la célula y es una fina capa que regula
el intercambio de sustancias con el exterior. En
células vegetales, está rodeada externamente por
una pared celular que le dá consistencia y rigidez
Sustancia gelatinosa donde se encuentran
los orgánulos
Red de filamentos protéicos responsable de la
forma, organización interna y movimientos de la
célula
24
25
• MITOCONDRIAS:
José Fernando Pastor
Biología y Geología 4º ESO:
La célula 26
– Forma diversa, en general cilíndricas, rodeadas por un doble
membrana. La interna forma repliegues hacia el interior
denominados crestas mitocondriales. El espacio interior se
denomina matriz mitocondrial, que contiene diversas sustancias.
– Función: proporciona energía a la célula mediante un proceso
denominado respiración celular.
– Se encuentran tanto en células animales como en vegetales.
Orgánulos citoplásmicos
• En el citoplasma tienen lugar la
mayor parte de las reacciones
metabólicas de la célula. El citosol es
el medio acuoso del citoplasma que
engloba numerosas estructuras
especializadas llamadas organelos.
Las mitocondrias
• Llevan a cabo las reacciones químicas que
liberan energía que se usa en las
actividades celulares.
• Las mitocondrias tienen una doble
membrana. La externa no se pliega,
mientras que la interna se pliega para
formar proyecciones llamadas crestas.
• En las crestas ocurren reacciones químicas
que liberan energía de los alimentos.
• A las mitocondrias se les llama “la central
de energía” de las células.
• Las células que trabajan continuamente
como las del músculo cardíaco, poseen más
mitocondrias.
El retículo endoplasmático (RE)
• Es un sistema de membranas que recorre el
citoplasma.
• Se extiende a través del citoplasma desde la
membrana nuclear hasta la membrana
celular. Las membranas del RE forman vías
para el movimiento de materiales por la
célula.
• Algunas de las membranas del RE tienen
aspecto rugoso debido a la presencia de
ribosomas, RE rugoso.
• El RE liso es el que no tiene ribosomas en
su membranas. Algunos tipos de lípidos se
forman en las membranas de este retículo
endoplasmático.
Los ribosomas
• Son los organelos donde se producen las
proteínas.
• Las proteínas que se forman en el RE
rugoso son transportadas a través de la
• También existen ribosomas libres en el
citoplasma. Las proteínas que se forman en
estos ribosomas van directamente al
citoplasma.
El aparato de Golgi
• Debe su nombre a Camillo Golgi Premio
Nobel de Medicina en 1906.
• Es un organelo que se encarga de la
distribución y el envío de los productos
químicos de la célula, prepara los materiales
para que sean liberados por la célula hacia
el espacio intercelular, mediante el proceso
de secreción.
• El aparato de Golgi tiene aspecto de una pila
de sacos vacíos formado por membranas.
• Modifica proteínas y lípidos que han sido
formados en el retículo endoplasmático y
los prepara para expulsarlos fuera de la
célula.
Las proteínas y lípidos que se sintetizan en
el RE llegan al aparato de Golgi, el cual
concentra las células de las proteínas o
lípidos y elimina el agua. Este producto, se
empaqueta dentro de una membrana
derivada del aparato de Golgi y se mueve
hacia la membrana celular donde se libera.
Las vacuolas
• Son estructuras llenas de fluido que
contienen varias sustancias.
• Generalmente, en las células animales, las
vacuolas son pequeñas; las células
vegetales es frecuente que presenten una
única o unas pocas vacuolas de gran
tamaño.
• Las vacuolas sirven para almacenar
sustancias durante algún tiempo.
• En los organismos unicelulares las vacuolas
tienen diversas funciones especializadas.
Unas sirven para digerir alimentos y otras
funcionan como bombas retirando el
exceso de agua o materiales de desecho
(vacuolas contráctiles).
Los peroxisomas
• Los peroxisomas son organelos
citoplásmicos muy comunes en forma de
vesículas que contienen enzimas que
cumplen funciones de desintoxificación
celular.
• Inicialmente recibieron el nombre de
microcuerpos y están presentes en todas
las células eucarioticas.
Los lisosomas
• Los lisosomas son pequeñas vesículas
formadas por el retículo endoplasmático
rugoso que contienen enzimas digestivas.
• Las enzimas digestivas facilitan el
rompimiento de moléculas grandes como
los almidones, lípidos y proteínas.
• Los lisosomas tienen como función digerir las partículas extrañas que entran a la células
como las bacterias.
• Otra función de los lisosomas es destruir las partes gastadas de las células donde los
productos de esa destrucción pueden volver a ser usados por la célula.
Biología y Geología 4º ESO:
32 José Fernando
ORGÁNULOS NO MEMBRANOSOS
• RIBOSOMAS:
– Pequeños orgánulos cuya función son la de fabricar las
proteínas. Compuestos de ARN y proteínas.
• CILIOS Y FLAGELOS:
– Proyecciones hacia el exterior de la membrana, cuya
estructura está mantenida por fibras protéicas del
citoesqueleto.
– Responsables del movimiento de las células.
– Los cilios son más cortos y numerosos, mientras que los
flagelos son generalmente únicos y muy largos.
• CENTRIOLOS:
– Son dos estructuras cilíndricas, dispuestas
perpendicularmente.
– Intervienen en el reparto de cromosomas durante la
división celular.
– Sólo se encuentran en células animales.
Los microfilamentos
• Son fibras muy finas formadas de
proteínas.
• Ubicadas dentro de la célula, con
frecuencia debajo de la membrana.
• Una de las funciones principales de los
microfilamentos es producir el flujo
citoplasmático permitiendo el
movimietno da las sustancias dentro de
la célula.
• Este flujo permite a organismos
unicelulares moverse de un lado a otro.
Los microtúbulos
• Son estructuras tubulares compuestas
de proteínas.
• Los microtúbulos están relacionados
con la habilidad de la célula para
moverse de un sitio a otro.
• Muchos organismos unicelulares se
mueven por medio de unas
estructuras en forma de pelos
llamadas cilios.
• Otros organismos se mueven por
unas estructuras en forma de cola
llamadas flagelos.
Cilios Flagelos
• Los microtúbulos se extienden
desde la célula hasta el interior de
los cilios y flagelos.
ESTRUCTURAS DE SOPORTE Y
LOCOMOCIÓN
La pared celular
• Toda célula vegetal contiene una
estructura fuera de la membrana celular
llamada pared celular.
• La pared celular es la que da forma y
rigidez a la célula vegetal.
• Se compone mayormente de celulosa,
que es un carbohidrato complejo.
• La pared celular puede contener pectina,
que da fortaleza a la célula vegetal.
• Permite el paso del aire, del agua y de
materiales disueltos.
• Las membranas celulares de células
vecinas, pueden estar en contacto unas
con otras a través de las aberturas en la
pared celular.
• Los hongos y los procariotas (bacterias)
también tienen pared celular.
• Las paredes de las células procarióticas
son diferentes a las del resto de células.
Orgánulos en células vegetales
• Hay ciertos organelos que solo
se encuentran en células
vegetales o aparecen
conspicuos.
• En una célula vegetal, una
vacuola puede ocupar casi
todo el espacio y empujar el
citoplasma hacia la membrana
de la célula.
• Estas vacuolas almacenan
sustancias como azúcares,
minerales y proteínas.
Los plastidios
• Son organelos de células vegetales.
• Los plastidios pueden producir productos
químicos o almacenar alimentos y
pigmentos.
 Cloroplastos
 Es el plastidio más común de las plantas verdes.
 Es donde ocurren los procesos de la elaboración
de alimentos de las células vegetales.
 Formados por estructuras parecidas a monedas
delimitadas por una membrana llamadas
tilacoides, las mismas que se organizan en
apilamientos llamados granas y rodeadas por
una sustancia gelatinosa llamada estroma.
 La clorofila es el pigmento verde que
está concentrado en las granas.
 La clorofila atrapa la energía solar que la
célula vegetal usa para elaborar su
alimento.
 Los leucoplastos
 Son plastidios de almacenamiento.
 Pueden contener proteínas, lípidos o
almidónes.
 Los cromoplastos
 Son plastidios que contienen pigmentos
rojos, amarillos o anaranjados.
 Los cloroplastos y leucoplastos en
ocasiones se transforman en cromoplastos.
 Los cromoplastos son los responsables del
color de las hojas durante el otoño.
• CLOROPLASTOS:
Biología y Geología: La célula 37
– Formados por una doble membrana.
– Contiene una serie de discos apilados denominados tilacóides, en
cuya membrana contiene la clorofila (de color verde).
– Función: Realizan la fotosíntesis, esto es la fabricación de materia
orgánica a partir de moléculas inorgánicas, utilizando la energía
solar.
– Sólo en células vegetales y algas.
CO2 + H2O + Energía luminosa Materia orgánica(glucosa) + O2
ORGÁNULOS. RESUMEN
Membrana celular eucariota:
funciones
• Membrana citoplasmática
– Es la interfase entre la célula y su medio ambiente.
– Esta constituida por fosfolípidos, colesterol y proteínas
– Mosaico - fluido
– Posee funciones variadas
• Transporte
• Generar energía
• Delimitar la forma de la célula
• Comunicación celular
CROMOSOMAS
40
• Son estructuras sólo visibles cuando la célula
se divide.
• Formados por el ADN del núcleo que se
condensa al máximo.
• Según el periodo de la división, los
cromosomas pueden estar constituidos por un
solo filamento de cromatina, denominado
cromátida, o por dos filamentos, que son dos
copias exactas la una de la otra, por lo que la
información genética está duplicada y
denominan cromátidas hermanas, unidad por
un punto llamado centrómero.
cromátida
Cromátidas hermanas
(Genéticamente
idénticas)
41
LOS CROMOSOMAS
Un cromosoma está formado por:
1.dos CROMÁTIDAS unidas por un punto denominado
CENTRÓMERO o CONSTRICCIÓN PRIMARIA.
Cada cromática es identica a la otra (tienen el mismo ADN)
por lo que se llaman cromátidas HERMANAS.
2.cada cromátida suele presentar 2 BRAZOS, de tamaño
irregular.
3.el extremo final de cada cromátida se denomina
TELÓMERO.
4.puede haber CONSTRICCIONES SECUNDARIAS que
hagan aparecer fragmentos SATÉLITES.
Los CROMOSOMAS son estructuras
de forma filamentosa que aparecen
durante la división celular. Reparten
la información genética contenida en
el ADN de la célula madre hacia las
células hijasz
Los cromosomas están formados por
una larguísima cadena de ADN (lo que
antes hemos llamado cromatina) muy
enrollada, a la que se unen diferentes
proteínas que mantienen su estructura.
LOS CROMOSOMAS (2)
NÚMERO DE CROMOSOMAS:
Cada especie tiene un número de cromosomas característico.
a)organismos HAPLOIDES:
Poseen un solo juego de cromosomas en sus células. Se
representan por la letra n, que indica que el número de tipos
diferentes de cromosomas presentes en cada célula. Algunos
organismos pasan por fases haploides en su ciclo vital, como los
hongos, o pueden ser hapolides durante toda su vida, como las
levaduras.
b)organismos DIPLOIDES:
Poseen un número par de cromosomas en sus células
somáticas (no reproductoras).
Estos cromosomas se denominan cromosomas homólogos
y cada uno procede del gameto de un progenitor. Se representan por
la letra 2n.
La gran mayoría de organismos superiores (plantas y animales) son
diploides.
c)organismos POLIPLOIDES:
Poseen un gran número de cromosomas homólogos
en sus células .
Se representan por la letra n precedida de un número que indica el
número de copias (3n, 4n, 16n, etc).
Muchas plantas y algunos insectos son poliploides.
LOS CROMOSOMAS (3)
TIPOS DE CROMOSOMAS:
Dependiendo de la posición del centrómero podemos distinguir:
a)Metacéntrico: el centrómero está en el centro y los brazos son iguales.
b)Submetacéntrico: el centrómero está desplazado, los brazos son desiguales.
a)Acrocéntricos: el centrómero se acerca mucho a los telómeros.
a)Telocéntricos: el centrómero se localiza en el extremo del cromosoma y solo
se puede observar un brazo.
EL CARIOTIPOEl CARIOTIPO es el conjunto de
los cromosomas de una especie.
En el cariotipo se distinguen dos
tipos de cromosomas:
a) HETEROCROMOSOMAS o
CROMOSMAS SEXUALES:
Intervienen en la determinación
del sexo.
En la especie humana hay dos: X e
Y. En las mujeres se encuentran
dos copias del X. En los hombres
hay una copia del X y otra del Y.
AUTOSOMAS:
Constituyen el resto de los
cromosomas y son iguales en
ambos sexos.
Las células somáticas (no
reproductoras) del ser humano
poseen 46 cromosomas
distribuidos en 23 parejas
homólogas.
EL CICLO CELULAR
El ciclo celular en eucariotas se divide en las siguientes
fases:
a) INTERFASE (G): es la fase que ocupa el 95% del
tiempo de vida de la célula, cuando no se está
dividiendo.
A su vez se divide en:
1)G1: es la fase en la que la célula recién formada
crece de tamaño y desarrolla todos sus orgánulos.
2)S: en esta fase la célula sintetiza una copia de su
ADN en previsión de una nueva división.
3)G2: en esta fase la célula se dispone a dividirse, por
lo que tiene que duplicar todo su citoplasma.
b) MITOSIS (M): es la fase en la que la célula se divide,
dando lugar a dos células hijas, que retoman la fase
G...
El CICLO CELULAR es la secuencia de modificaciones que sufre una célula
desde su formación hasta que se divide originando dos células hijas.
La duración del ciclo celular depende del tipo de célula y puede variar de unas
pocas horas a algunos días.
LA DIVISIÓN CELULAR o MITOSIS
En la fase de división o FASE M, a partir de una célula madre se originan
dos células hijas con idéntico número de cromosomas que la progenitora.
En las células eucariotas, esta división presenta dos fases:
a)división del núcleo, denominada generalmente MITOSIS.
b)división del resto de la célula, del citoplasma, denominada CITOCINESIS.
La mitosis es un proceso contínuo, pero para poder estudiarlo mejor se ha
dividido en 4 fases: PROFASE, METAFASE, ANAFASE y TELOFASE.
En la profase:
El ADN se condensa, se pueden ver claramente los cromosomas.
El nucleolo desaparece.
Aparecen unas fibras de proteínas entre los polos de la célula, llamadas
huso acromático. En ambos extremos del huso están los centriolos, que
controlan todo el proceso.
La membrana nuclear desaparece y los cromosomas quedan libres en el
citoplasma.
MITOSIS (1): PROFASE
MITOSIS (2): METAFASE
En la metafase:
Los cromosomas se unen por el centrómero al huso acromático.
Esta unión se produce en el llamado PLANO ECUATORIAL de la célula.
Esto es FUNDAMENTAL: si los cromosomas se unieran en otro punto de la
célula el reparto de información genética entre las células hijas no seria
equitativo.
Las cromátidas hermanas de capa cromosoma están orientadas hacia los
polos opuestos de la célula.
MITOSIS (3): ANAFASE
En la anafase:
Los cromosomas se rompen por el centrómero. Las cromátidas se
separan.
Las fibras del uso acromático empiezan a acortarse, controladas por los
centriolos.
Las cromátidas hermanas se desplazan hacia cada uno de los polos de la
célula. A partir de este momento se convierten en cromátidas
independientes.
En la telofase:
Una vez terminada la migración de las cromátidas, desaparece el huso
acromático.
Se reconstruye una nueva membrana nuclear alrededor de cada grupo de
cromátidas. Esto dará lugar a los núcleos de las células hijas.
Las cromátidas se descondensan progresivamente, volviendo a
convertirse en simple cromatina.
Reaparece el nucleolo en cada nuevo núcleo.
MITOSIS (4): TELOFASE
CITOCINESISSi la mitosis ha transcurrido sin problemas, cada célula recibirá una copia del
material genético de la célula madre. Por tanto, serán genéticamente idénticas.
Pero, una vez concluida la división del núcleo, tiene que dividirse sel resto de la
célula, el
citoplasma, y hay que repartir los orgánulos entre ambas células hijas.
Este proceso de CITOCINESIS es diferente si se trata de células vegetales o
animales.
En células ANIMALES se produce el
reparto de los orgánulos y
posteriormente la
célula sufre una estrangulación a nivel
del plano ecuatorial.
En células VEGETALES se tiene que
formar una pared celular nueva que
separe a las nuevas células hijas. Esta
pared celular se denomina
fragmoplasto.
MEIOSISLa MEIOSIS es un tipo de división reduccional, ya que a partir de una célula
madre diploide (2n) se forman cuatro células hijas haploides (n), es decir,
con la mitad del contenido de ADN que la célula progenitora.
En todos los vertebrados, esta división reduccional tiene lugar en las gónadas, y
las células que se forman son los gametos.
¿Qué ocurriría si los gametos se formaran por simple mitosis y tuvieran la misma
información genética que el resto de las células?
MEIOSIS (2)
La meiosis a veces se compara con 2 mitosis consecutivas: una es
reduccional (origina células con la mitad de cromosomas) y la otra es
ecuacional (la célula se divide como una célula normal).
Ambas divisiones también se dividen en profase, metafase, anafase y telofase.
En la profase 1 aparecen los cromosomas, como el profase normal, pero se
asocian en parejas de homólogos. Cuando están juntos, los cromosomas
intercambian material genético. Este fenómeno natural se conoce como
RECOMBINACIÓN.
MEIOSIS (2)
PROFASE 1 Se divide en varias fases:
leptoteno, durante la cual los cromosomas individuales comienzan a condensar
en filamentos largos dentro del núcleo
Zigoteno Los cromosomas homólogos comienzan a acercarse hasta quedar
recombinados en toda su longitud. Esto se conoce como sinapsis (unión) y el
complejo resultante se conoce como bivalente o tétrada
Paquiteno Una vez que los cromosomas homólogos están perfectamente
apareados formando estructuras que se denominan bivalentes se produce el
fenómeno de entrecruzamiento cromosómico (crossing-over)
Diploteno Los cromosomas continúan condensándose hasta que se pueden
comenzar a observar las dos cromátidas de cada cromosoma. Además en este
momento se pueden observar los lugares del cromosoma donde se ha producido
la recombinación. Estas estructuras en forma de X reciben el nombre quiasmas.
Diacinesis Esta etapa apenas se distingue del diplonema. Podemos observar los
cromosomas algo más condensados y los quiasmas. El final de la diacinesis y por
tanto de la profase I meiótica viene marcado por la rotura de la envoltura nuclear.
MEIOSIS (2)
En las siguientes fases de la meiosis ocurre:
●En la metafase 1 las fibrillas del huso acromático
unen parejas de cromosomas homólogos, aún
unidos por la recombinación, no cromosomas
individuales.
●En la anafase 1 a cada polo celular se dirige un
cromosoma completo, no medio cromosoma.
●En la telofase 1 se forman dos células hijas
haploides
(n) con la mitad de cromosomas que la célula
madre.
●Finalmente, tiene lugar una citocinesis.
Después de completar la mitosis reduccional, las
dos células hijas se preparan para entrar en la
meitosis ecuacional, para obtener finalmente 4
células haploides.
MEIOSIS (3)
La mitosis ecuacional es muy parecida a
una mitosis normal:
●En la profase 2, sin pasar por interfase,
se vuelve a formar un huso acromático y a
condensar los cromosomas, constituidos
por dos cromátidas.
●En la metafase 2 los cromosomas se
disponen en la placa ecuatorial de la
célula.
●En la anafase 2 se separan las
cromátidas hermanas y cada una se dirige
a un extremo de la célula.
●En la telofase 2 y citocinesis se
obtienen en total 4 células hijas haploides
(n) distintas, cada una con la mitad de
cromosomas que la célula madre
MITOSIS vs. MEIOSIS
MITOSIS
Duplicación del ADN
No se
produce
recombinació
n
MEIOSIS
Duplicación del ADN
Se produce recombinación de
cromosomas homólogos
Se separan
cromosomas
homólogos
Se separan
cromátidas
hermanas
Se obtienen 2
células hijas
diploides iguales
entre sí y a la célula
Se separan
cromátidas hermanas
Se obtienen 4 células
hijas haploides
distintas entre sí y de
la célula madre
SIGNIFICADO BIOLÓGICO DE LA
MITOSIS Y LA MEIOSISLa mitosis y la meiosis son dos mecanismos
de división celular con un significado
biológico diferente.
En los organismos pluricelulares, la mitosis
supone el crecimiento del individuo
mediante sucesivas divisiones a partir de una
única célula inicial, además de una forma de
renovación de las células del cuerpo.
En organismos unicelulares, la mitosis es la
forma de reproducción asexual.
Mediante la meiosis se originan gametos
haploides, indispensables para asegurar un
número constante de cromosomas en la
especie.
Además, la meiosis asegura la variabilidad
genética gracias a la recombinación, que
hace que cada gameto lleve información
diferente.
MITOSIS
60
• A partir de una célula se obtienen dos células
genéticamente idénticas, con el mismo número de
cromosomas.
• Por este motivo en los organismos pluricelulares
todas sus células son genéticamente idénticas, por
tanto muy importante en el crecimiento del individuo
y recambio celular.
• Este proceso consta de varias etapas: Profase,
Metafase, Anafase y Telofase.
• Al final del proceso se reparte el citoplasma entre
las células hijas, (Citocinesis).
PROFASE
Comienza a desaparecer el núcleo, los centríolos se
duplican y se van a polos opuestos de la célula.
La cromatina comienza a condensarse para formar
los cromosomas.
Cada cromosoma consta de dos cromátidas
genéticamente idénticas (cromátidas hermanas)
61
METAFASE
62
• Los cromosomas se condensan al
máximo
y se disponen en la zona ecuatorial.
ANAFASE
63
• Las cromátidas hermanas (que son
genéticamente idénticas) se separan
y van a polos opuestos de la célula.
TELOFASE
64
• Los cromosomas comienzan a descondensarse.
• Comienza a formarse los núcleos de las dos células.
• Al final los cromosomas se han descondensado del
todo, formando la cromatina.
• Al final la célula se divide en dos, repartiéndose el
citoplasma (Citocinesis).
65
MEIOSIS
66
• Proceso de división en el que a partir de una
célula se obtienen cuatro con la mitad de
cromosomas y que no son genéticamente
idénticas.
• Es necesario para la formación de gametos o
células reproductoras, que tienen la mitad
de cromosomas que el resto de células del
organismo.
• Cuando se produce la fecundación cada
gameto aporta la mitad de cromosomas a la
nueva célula (célula huevo o cigoto).
• Consta de dos grandes etapas (Meoisis I y
Meoisis II). Cada una de ellas divida en
pequeñas etapas.
MEIOSIS I
67
• Al final se obtienen dos células, genéticamente
diferentes y se reduce el nº de cromosomas a la
mitad.
• Etapas:
– Profase I.- Los cromosomas formados cada uno de
ellos por dos cromátidas hermanas se asocian en
parejas (de homólogos) y se producen intercambios
de fragmentos entre los homólogos (Recombinación).
– Metafase I.- Las parejas de homólogos se disponen en
el ecuador.
– Anafase I.- Separación (al azar) de cromosomas
homólogos que van a polos opuestos.
– Telofase I.- Se obtienen dos células, pero con la mitad
de cromosomas que habían al principio.
68
MEIOSIS II
69
• Ocurre lo mismo que en una mitosis.
• A partir de cada célula obtenida en la meiosis I
se obtienen dos. Por tanto al final del proceso
obtenemos cuatro células.
• No se reduce el nº de cromosomas.
• Etapas:
– Profase II.- condensación de los cromosomas.
– Metafase II.- Los cromosomas se disponen en el
ecuador de la célula.
– Anafase II.- Separación (al azar) de cromátidas
hermanas.
– Telofase II.- Descondensación de los cromosomas.
Código genético
TRADUCCIÓN DE UNA CADENA DE
mRNA
Problema tipo de código genético
ADN recombinante
INICIO ESQUEMA RECURSOS INTERNET
Características de la ingeniería genética
SALIRANTERIOR
Herramientas necesarias
para la manipulación de genes
• Vector de transferencia
Plásmidos de
Escherrichia coli
• Enzimas de restricción
• ADN ligasas
Síntesis de ADN de forma artificial
INICIO ESQUEMA RECURSOS INTERNET
Etapas de un proyecto de ingeniería genética
SALIRANTERIOR
1. Localización y aislamiento
del gen que se desea transferir
2. Selección del vector
3. Unión del ADN elegido
al ADN del vector.
4. Inserción del vector con
el gen transferido en la
célula hospedadora.
5. Multiplicación del
organismo transgénico.
Terapia génica
INICIO ESQUEMA RECURSOS INTERNET
Aplicaciones de la ingeniería genética
SALIRANTERIOR
Obtención de fármacos
Mejora en la producción
agrícola y animal.
• Insulina
• Proteínas de
coagulación del
suero sanguíneo.
• Vacunas
Carpas y salmones portadores del
gen de la hormona del
crecimiento
Maíz resistente al frío
Tratamiento de
enfermedades humanas:
• Diabetes
• Hemofilia
• Parkinson
INICIO ESQUEMA RECURSOS INTERNET
Los alimentos transgénicos
SALIRANTERIOR
Transgen
Organismo
transgénico
APLICACIONES DE LA INGENIERÍA
GENÉTICA EN LA AGRICULTURA
TRADUCCIÓN
ESTRUCTURA DEL tRNA
Posee una secuencia de tres bases llamado anticodón
complementario a un o varios codones
El aminoácido se unirá al tRNA que tenga el anticodón
correspondiente
INICIO ESQUEMA RECURSOS INTERNET
La clonación
SALIRANTERIOR
Clonación reproductiva
Tiene como objetivo conseguir
individuos nuevos idénticos entre sí
y al original.
transferencia
nuclear
Clonación terapeútica
Tiene como objetivo tratar
enfermedades y regenerar tejidos.
INICIO ESQUEMA RECURSOS INTERNET
Implicaciones de los avances en biotecnología
SALIRANTERIOR
Implicaciones
ecológicas
Implicaciones
sanitarias
Implicaciones
sociales
Implicaciones
éticas
Implicaciones
legales
Extinción de
especies naturales
Aparición de nuevos virus
o bacterias que provoquen
enfermedades desconocidas
Vulneración del
derecho a la intimidad
La manipulación de material
genético de nuestra especie
La posibilidad de patentar plantas
y animales transgénicos, así como
secuencias del genoma humano

Más contenido relacionado

La actualidad más candente

Fisiología célular
Fisiología célularFisiología célular
Fisiología célular
mayravianeyl
 
Biología apuntes
Biología apuntesBiología apuntes
Biología apuntes
Lilia Toalongo Rojas
 
¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...
¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...
¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...
Hogar
 
Prueba icfes ciencias 1005 1006
Prueba icfes ciencias 1005 1006Prueba icfes ciencias 1005 1006
Prueba icfes ciencias 1005 1006
practicadocente2011
 
Resumen biología 2014 pdf
Resumen biología 2014 pdfResumen biología 2014 pdf
Resumen biología 2014 pdf
Djenane Hernández
 
Metabolismo celular: citoplasma, lisosomas y peroxisomas
Metabolismo celular: citoplasma, lisosomas y peroxisomasMetabolismo celular: citoplasma, lisosomas y peroxisomas
Metabolismo celular: citoplasma, lisosomas y peroxisomas
YaniraHaydee123
 
BioquimicaLenghineer
BioquimicaLenghineerBioquimicaLenghineer
BioquimicaLenghineer
jclr22
 
Fichas resumen de la materia de biología de bachillerato
Fichas resumen de la materia de biología de bachilleratoFichas resumen de la materia de biología de bachillerato
Fichas resumen de la materia de biología de bachillerato
MCMurray
 
¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...
¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...
¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...
Hogar
 
Microbiologia 2
Microbiologia 2Microbiologia 2
Microbiologia 2
Alejandro Luevano Cedillo
 
La celula
La celulaLa celula
La celula
chumilchiroy
 
Fichas de biologia libro 1
Fichas de biologia libro 1Fichas de biologia libro 1
Fichas de biologia libro 1
MCMurray
 
Fundamentos de bioquímica
Fundamentos de bioquímicaFundamentos de bioquímica
Fundamentos de bioquímica
Vanessa Tuesta
 
E-portafolio de Bioquímica
E-portafolio de Bioquímica E-portafolio de Bioquímica
E-portafolio de Bioquímica
fpardo13
 
Apuntes biología 1º 2011 / IES Fuentesnuevas
Apuntes biología 1º 2011 / IES FuentesnuevasApuntes biología 1º 2011 / IES Fuentesnuevas
Apuntes biología 1º 2011 / IES Fuentesnuevas
Juan Luis Neira González
 
Introduccion A La Bioquimica
Introduccion A La BioquimicaIntroduccion A La Bioquimica
Introduccion A La Bioquimica
Edgar Flores
 
Curso bioquímica
Curso bioquímicaCurso bioquímica
Curso bioquímica
lufeva
 
T1.niveles de organización
T1.niveles de organizaciónT1.niveles de organización
T1.niveles de organización
nuriagonzaleznaranjo
 
Agua,minerales,hidratos decarbono
Agua,minerales,hidratos decarbonoAgua,minerales,hidratos decarbono
Agua,minerales,hidratos decarbono
Nadia Iannotti
 
Biomoléculas orgánicas.
Biomoléculas orgánicas.Biomoléculas orgánicas.
Biomoléculas orgánicas.
Eliana Michel
 

La actualidad más candente (20)

Fisiología célular
Fisiología célularFisiología célular
Fisiología célular
 
Biología apuntes
Biología apuntesBiología apuntes
Biología apuntes
 
¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...
¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...
¿De qué esta hecha la célula? Biomoléculas orgánicas. Una guía para 1º medi...
 
Prueba icfes ciencias 1005 1006
Prueba icfes ciencias 1005 1006Prueba icfes ciencias 1005 1006
Prueba icfes ciencias 1005 1006
 
Resumen biología 2014 pdf
Resumen biología 2014 pdfResumen biología 2014 pdf
Resumen biología 2014 pdf
 
Metabolismo celular: citoplasma, lisosomas y peroxisomas
Metabolismo celular: citoplasma, lisosomas y peroxisomasMetabolismo celular: citoplasma, lisosomas y peroxisomas
Metabolismo celular: citoplasma, lisosomas y peroxisomas
 
BioquimicaLenghineer
BioquimicaLenghineerBioquimicaLenghineer
BioquimicaLenghineer
 
Fichas resumen de la materia de biología de bachillerato
Fichas resumen de la materia de biología de bachilleratoFichas resumen de la materia de biología de bachillerato
Fichas resumen de la materia de biología de bachillerato
 
¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...
¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...
¿De qué está compuesta la célula?. Una guía para mis apreciados alumnos de pr...
 
Microbiologia 2
Microbiologia 2Microbiologia 2
Microbiologia 2
 
La celula
La celulaLa celula
La celula
 
Fichas de biologia libro 1
Fichas de biologia libro 1Fichas de biologia libro 1
Fichas de biologia libro 1
 
Fundamentos de bioquímica
Fundamentos de bioquímicaFundamentos de bioquímica
Fundamentos de bioquímica
 
E-portafolio de Bioquímica
E-portafolio de Bioquímica E-portafolio de Bioquímica
E-portafolio de Bioquímica
 
Apuntes biología 1º 2011 / IES Fuentesnuevas
Apuntes biología 1º 2011 / IES FuentesnuevasApuntes biología 1º 2011 / IES Fuentesnuevas
Apuntes biología 1º 2011 / IES Fuentesnuevas
 
Introduccion A La Bioquimica
Introduccion A La BioquimicaIntroduccion A La Bioquimica
Introduccion A La Bioquimica
 
Curso bioquímica
Curso bioquímicaCurso bioquímica
Curso bioquímica
 
T1.niveles de organización
T1.niveles de organizaciónT1.niveles de organización
T1.niveles de organización
 
Agua,minerales,hidratos decarbono
Agua,minerales,hidratos decarbonoAgua,minerales,hidratos decarbono
Agua,minerales,hidratos decarbono
 
Biomoléculas orgánicas.
Biomoléculas orgánicas.Biomoléculas orgánicas.
Biomoléculas orgánicas.
 

Destacado

Biodiversidad terrestre de Uruguay
Biodiversidad terrestre de UruguayBiodiversidad terrestre de Uruguay
Biodiversidad terrestre de Uruguay
Graciela Slekis Riffel
 
mitosis y meiosis
mitosis y meiosismitosis y meiosis
mitosis y meiosis
Germy Duré
 
Mitosis
MitosisMitosis
Mitosis
Abigail Rm
 
División celular "Proceso Mitótico y Meiótico"
División celular "Proceso Mitótico y Meiótico"División celular "Proceso Mitótico y Meiótico"
División celular "Proceso Mitótico y Meiótico"
ADRIANAGBIOLOGIA
 
Mitosis y Meiosis
Mitosis y MeiosisMitosis y Meiosis
Mitosis y Meiosis
jent46
 
MITOSIS
MITOSISMITOSIS
MITOSIS
munizchesca
 
Mitosis 4º ESO
Mitosis 4º ESOMitosis 4º ESO
Mitosis 4º ESO
plopezfraguas
 

Destacado (7)

Biodiversidad terrestre de Uruguay
Biodiversidad terrestre de UruguayBiodiversidad terrestre de Uruguay
Biodiversidad terrestre de Uruguay
 
mitosis y meiosis
mitosis y meiosismitosis y meiosis
mitosis y meiosis
 
Mitosis
MitosisMitosis
Mitosis
 
División celular "Proceso Mitótico y Meiótico"
División celular "Proceso Mitótico y Meiótico"División celular "Proceso Mitótico y Meiótico"
División celular "Proceso Mitótico y Meiótico"
 
Mitosis y Meiosis
Mitosis y MeiosisMitosis y Meiosis
Mitosis y Meiosis
 
MITOSIS
MITOSISMITOSIS
MITOSIS
 
Mitosis 4º ESO
Mitosis 4º ESOMitosis 4º ESO
Mitosis 4º ESO
 

Similar a Tema 2 lomce

La organización celular de los seres vivos
La organización celular de los seres vivosLa organización celular de los seres vivos
La organización celular de los seres vivos
Arturo Andrés Martínez
 
MIcroscopia, teoria celular, organecos citoplasmaticos. etc.
MIcroscopia, teoria celular, organecos citoplasmaticos. etc.MIcroscopia, teoria celular, organecos citoplasmaticos. etc.
MIcroscopia, teoria celular, organecos citoplasmaticos. etc.
JuanCarlos2464
 
Organelos citopl+ã­smaticos[1]
Organelos citopl+ã­smaticos[1]Organelos citopl+ã­smaticos[1]
Organelos citopl+ã­smaticos[1]
cami_moyano
 
La celula
La celulaLa celula
La celula
Marcos A. Fatela
 
16. estructura celular
16. estructura celular16. estructura celular
16. estructura celular
ZairaMariaJeronimoGr
 
CELULA Y MEMBRANA CELULAR.pdf
CELULA Y MEMBRANA CELULAR.pdfCELULA Y MEMBRANA CELULAR.pdf
CELULA Y MEMBRANA CELULAR.pdf
Walner Lopez Mena
 
Bg tema 02
Bg tema 02Bg tema 02
Bg tema 02
beatrizmoli
 
Celula eucariota y procariota
Celula eucariota y procariotaCelula eucariota y procariota
Celula eucariota y procariota
isra hernandez
 
La Celula
La CelulaLa Celula
La Celula
maria
 
La célula
La célulaLa célula
La célula
jujosansan
 
HISTOLOGIA
HISTOLOGIA HISTOLOGIA
HISTOLOGIA
AracelyPalomino4
 
Anatomia celular
Anatomia celularAnatomia celular
Anatomia celular
arb71211
 
celula PERFECTA.ppt
celula PERFECTA.pptcelula PERFECTA.ppt
celula PERFECTA.ppt
ssuser3fdd53
 
La célula (Prof. Jimena Lens)
La célula (Prof. Jimena Lens)La célula (Prof. Jimena Lens)
La célula (Prof. Jimena Lens)
Marcos A. Fatela
 
NIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULA
NIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULANIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULA
NIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULA
ANDYAshqui1
 
investigacion celular 2023.pptx
investigacion celular 2023.pptxinvestigacion celular 2023.pptx
investigacion celular 2023.pptx
AlberthMaita
 
Copia (2) De Carly
Copia (2) De CarlyCopia (2) De Carly
Copia (2) De Carly
gueste0cfed
 
La celula
La celulaLa celula
CM3-Célula-Procariótica-Eucariótica-Virus.pdf
CM3-Célula-Procariótica-Eucariótica-Virus.pdfCM3-Célula-Procariótica-Eucariótica-Virus.pdf
CM3-Célula-Procariótica-Eucariótica-Virus.pdf
ValeriaPorras16
 
Celula agua electrolitos
Celula agua electrolitosCelula agua electrolitos
Celula agua electrolitos
KleiddyGarciaOrdaz
 

Similar a Tema 2 lomce (20)

La organización celular de los seres vivos
La organización celular de los seres vivosLa organización celular de los seres vivos
La organización celular de los seres vivos
 
MIcroscopia, teoria celular, organecos citoplasmaticos. etc.
MIcroscopia, teoria celular, organecos citoplasmaticos. etc.MIcroscopia, teoria celular, organecos citoplasmaticos. etc.
MIcroscopia, teoria celular, organecos citoplasmaticos. etc.
 
Organelos citopl+ã­smaticos[1]
Organelos citopl+ã­smaticos[1]Organelos citopl+ã­smaticos[1]
Organelos citopl+ã­smaticos[1]
 
La celula
La celulaLa celula
La celula
 
16. estructura celular
16. estructura celular16. estructura celular
16. estructura celular
 
CELULA Y MEMBRANA CELULAR.pdf
CELULA Y MEMBRANA CELULAR.pdfCELULA Y MEMBRANA CELULAR.pdf
CELULA Y MEMBRANA CELULAR.pdf
 
Bg tema 02
Bg tema 02Bg tema 02
Bg tema 02
 
Celula eucariota y procariota
Celula eucariota y procariotaCelula eucariota y procariota
Celula eucariota y procariota
 
La Celula
La CelulaLa Celula
La Celula
 
La célula
La célulaLa célula
La célula
 
HISTOLOGIA
HISTOLOGIA HISTOLOGIA
HISTOLOGIA
 
Anatomia celular
Anatomia celularAnatomia celular
Anatomia celular
 
celula PERFECTA.ppt
celula PERFECTA.pptcelula PERFECTA.ppt
celula PERFECTA.ppt
 
La célula (Prof. Jimena Lens)
La célula (Prof. Jimena Lens)La célula (Prof. Jimena Lens)
La célula (Prof. Jimena Lens)
 
NIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULA
NIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULANIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULA
NIVELES DE ORGANIZACION DE LA MATERIA Y LA CELULA
 
investigacion celular 2023.pptx
investigacion celular 2023.pptxinvestigacion celular 2023.pptx
investigacion celular 2023.pptx
 
Copia (2) De Carly
Copia (2) De CarlyCopia (2) De Carly
Copia (2) De Carly
 
La celula
La celulaLa celula
La celula
 
CM3-Célula-Procariótica-Eucariótica-Virus.pdf
CM3-Célula-Procariótica-Eucariótica-Virus.pdfCM3-Célula-Procariótica-Eucariótica-Virus.pdf
CM3-Célula-Procariótica-Eucariótica-Virus.pdf
 
Celula agua electrolitos
Celula agua electrolitosCelula agua electrolitos
Celula agua electrolitos
 

Más de Rafa Martín

tema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppttema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppt
Rafa Martín
 
Variabilidad.ppt
Variabilidad.pptVariabilidad.ppt
Variabilidad.ppt
Rafa Martín
 
Biodiversidad.ppt
Biodiversidad.pptBiodiversidad.ppt
Biodiversidad.ppt
Rafa Martín
 
Modelos evolutivos.ppt
Modelos evolutivos.pptModelos evolutivos.ppt
Modelos evolutivos.ppt
Rafa Martín
 
poblacion_humana.ppt
poblacion_humana.pptpoblacion_humana.ppt
poblacion_humana.ppt
Rafa Martín
 
Proteccion de datos
Proteccion de datosProteccion de datos
Proteccion de datos
Rafa Martín
 
Biodiversidad y evolución
Biodiversidad y evoluciónBiodiversidad y evolución
Biodiversidad y evolución
Rafa Martín
 
Tema7- 1ª parte
Tema7- 1ª parteTema7- 1ª parte
Tema7- 1ª parte
Rafa Martín
 
Selectividad biología
Selectividad biologíaSelectividad biología
Selectividad biología
Rafa Martín
 
Ejercicios glucidos
Ejercicios glucidosEjercicios glucidos
Ejercicios glucidos
Rafa Martín
 
Tema3 lipidos
Tema3 lipidosTema3 lipidos
Tema3 lipidos
Rafa Martín
 
T 2-biomoléculas
T 2-biomoléculasT 2-biomoléculas
T 2-biomoléculas
Rafa Martín
 
Bioelementos
BioelementosBioelementos
Bioelementos
Rafa Martín
 
Tema7 plantas2
Tema7 plantas2Tema7 plantas2
Tema7 plantas2
Rafa Martín
 
16 mamiferos
16 mamiferos16 mamiferos
16 mamiferos
Rafa Martín
 
14 reptiles
14 reptiles14 reptiles
14 reptiles
Rafa Martín
 
Cordados
CordadosCordados
Cordados
Rafa Martín
 
Moluscos 1231172303300100-1
Moluscos 1231172303300100-1Moluscos 1231172303300100-1
Moluscos 1231172303300100-1
Rafa Martín
 
11 artropodos
11 artropodos11 artropodos
11 artropodos
Rafa Martín
 
13 anfibios
13 anfibios13 anfibios
13 anfibios
Rafa Martín
 

Más de Rafa Martín (20)

tema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppttema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppt
 
Variabilidad.ppt
Variabilidad.pptVariabilidad.ppt
Variabilidad.ppt
 
Biodiversidad.ppt
Biodiversidad.pptBiodiversidad.ppt
Biodiversidad.ppt
 
Modelos evolutivos.ppt
Modelos evolutivos.pptModelos evolutivos.ppt
Modelos evolutivos.ppt
 
poblacion_humana.ppt
poblacion_humana.pptpoblacion_humana.ppt
poblacion_humana.ppt
 
Proteccion de datos
Proteccion de datosProteccion de datos
Proteccion de datos
 
Biodiversidad y evolución
Biodiversidad y evoluciónBiodiversidad y evolución
Biodiversidad y evolución
 
Tema7- 1ª parte
Tema7- 1ª parteTema7- 1ª parte
Tema7- 1ª parte
 
Selectividad biología
Selectividad biologíaSelectividad biología
Selectividad biología
 
Ejercicios glucidos
Ejercicios glucidosEjercicios glucidos
Ejercicios glucidos
 
Tema3 lipidos
Tema3 lipidosTema3 lipidos
Tema3 lipidos
 
T 2-biomoléculas
T 2-biomoléculasT 2-biomoléculas
T 2-biomoléculas
 
Bioelementos
BioelementosBioelementos
Bioelementos
 
Tema7 plantas2
Tema7 plantas2Tema7 plantas2
Tema7 plantas2
 
16 mamiferos
16 mamiferos16 mamiferos
16 mamiferos
 
14 reptiles
14 reptiles14 reptiles
14 reptiles
 
Cordados
CordadosCordados
Cordados
 
Moluscos 1231172303300100-1
Moluscos 1231172303300100-1Moluscos 1231172303300100-1
Moluscos 1231172303300100-1
 
11 artropodos
11 artropodos11 artropodos
11 artropodos
 
13 anfibios
13 anfibios13 anfibios
13 anfibios
 

Último

El Reino vegetal por Daphne Martinez 11 oct.
El Reino vegetal por Daphne Martinez 11 oct.El Reino vegetal por Daphne Martinez 11 oct.
El Reino vegetal por Daphne Martinez 11 oct.
daphnemartinez2004
 
Criterios para el análisis interpretativo
Criterios para el análisis interpretativoCriterios para el análisis interpretativo
Criterios para el análisis interpretativo
andrea75085
 
Los acontecimientos finales de la tierra.pdf
Los acontecimientos finales de la tierra.pdfLos acontecimientos finales de la tierra.pdf
Los acontecimientos finales de la tierra.pdf
Alejandrino Halire Ccahuana
 
Presentación sector la arenita_paijan pptx
Presentación sector la arenita_paijan pptxPresentación sector la arenita_paijan pptx
Presentación sector la arenita_paijan pptx
Aracely Natalia Lopez Talavera
 
PPT: Los acontecimientos finales de la tierra
PPT: Los acontecimientos finales de la tierraPPT: Los acontecimientos finales de la tierra
PPT: Los acontecimientos finales de la tierra
https://gramadal.wordpress.com/
 
Ejercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docxEjercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docx
sebastianjacome1808
 
conectas ideas------------------------------
conectas ideas------------------------------conectas ideas------------------------------
conectas ideas------------------------------
zonia26
 
PRINCIPALES INNOVACIONES CURRICULARES 2024.pdf
PRINCIPALES INNOVACIONES CURRICULARES 2024.pdfPRINCIPALES INNOVACIONES CURRICULARES 2024.pdf
PRINCIPALES INNOVACIONES CURRICULARES 2024.pdf
christianMuoz756105
 
Sesion-de-Proyecto-Eureka para proyectos
Sesion-de-Proyecto-Eureka para proyectosSesion-de-Proyecto-Eureka para proyectos
Sesion-de-Proyecto-Eureka para proyectos
orlandoAragonVelasqu1
 
Instructivo de Habilidades Socioemocionales y Factores de Riesgo Ccesa007.pdf
Instructivo de Habilidades Socioemocionales y Factores de Riesgo  Ccesa007.pdfInstructivo de Habilidades Socioemocionales y Factores de Riesgo  Ccesa007.pdf
Instructivo de Habilidades Socioemocionales y Factores de Riesgo Ccesa007.pdf
Demetrio Ccesa Rayme
 
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Shirley Vásquez Esparza
 
La mujer del flujo de sangre, un pa.pptx
La mujer del flujo de sangre, un pa.pptxLa mujer del flujo de sangre, un pa.pptx
La mujer del flujo de sangre, un pa.pptx
francisconaranjofern1
 
EL increible reino Fungi y sus características
EL increible reino Fungi y sus característicasEL increible reino Fungi y sus características
EL increible reino Fungi y sus características
cjach2502
 
ELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdf
ELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdfELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdf
ELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdf
DaliaAndrade1
 
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLAFRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
JAVIER SOLIS NOYOLA
 
PRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdf
PRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdfPRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdf
PRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdf
Fernanda Salazar
 
CENTRO DE INTERES CIENCIAS NATURALES .pdf
CENTRO DE INTERES  CIENCIAS NATURALES .pdfCENTRO DE INTERES  CIENCIAS NATURALES .pdf
CENTRO DE INTERES CIENCIAS NATURALES .pdf
juliozarza1
 
ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...
ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...
ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...
YovanaSaavedra1
 
Maikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdfMaikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdf
DevinsideSolutions
 
PLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdf
PLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdfPLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdf
PLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdf
Karlos Rivero
 

Último (20)

El Reino vegetal por Daphne Martinez 11 oct.
El Reino vegetal por Daphne Martinez 11 oct.El Reino vegetal por Daphne Martinez 11 oct.
El Reino vegetal por Daphne Martinez 11 oct.
 
Criterios para el análisis interpretativo
Criterios para el análisis interpretativoCriterios para el análisis interpretativo
Criterios para el análisis interpretativo
 
Los acontecimientos finales de la tierra.pdf
Los acontecimientos finales de la tierra.pdfLos acontecimientos finales de la tierra.pdf
Los acontecimientos finales de la tierra.pdf
 
Presentación sector la arenita_paijan pptx
Presentación sector la arenita_paijan pptxPresentación sector la arenita_paijan pptx
Presentación sector la arenita_paijan pptx
 
PPT: Los acontecimientos finales de la tierra
PPT: Los acontecimientos finales de la tierraPPT: Los acontecimientos finales de la tierra
PPT: Los acontecimientos finales de la tierra
 
Ejercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docxEjercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docx
 
conectas ideas------------------------------
conectas ideas------------------------------conectas ideas------------------------------
conectas ideas------------------------------
 
PRINCIPALES INNOVACIONES CURRICULARES 2024.pdf
PRINCIPALES INNOVACIONES CURRICULARES 2024.pdfPRINCIPALES INNOVACIONES CURRICULARES 2024.pdf
PRINCIPALES INNOVACIONES CURRICULARES 2024.pdf
 
Sesion-de-Proyecto-Eureka para proyectos
Sesion-de-Proyecto-Eureka para proyectosSesion-de-Proyecto-Eureka para proyectos
Sesion-de-Proyecto-Eureka para proyectos
 
Instructivo de Habilidades Socioemocionales y Factores de Riesgo Ccesa007.pdf
Instructivo de Habilidades Socioemocionales y Factores de Riesgo  Ccesa007.pdfInstructivo de Habilidades Socioemocionales y Factores de Riesgo  Ccesa007.pdf
Instructivo de Habilidades Socioemocionales y Factores de Riesgo Ccesa007.pdf
 
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
Leyes de los gases según Boyle-Marriote, Charles, Gay- Lussac, Ley general de...
 
La mujer del flujo de sangre, un pa.pptx
La mujer del flujo de sangre, un pa.pptxLa mujer del flujo de sangre, un pa.pptx
La mujer del flujo de sangre, un pa.pptx
 
EL increible reino Fungi y sus características
EL increible reino Fungi y sus característicasEL increible reino Fungi y sus características
EL increible reino Fungi y sus características
 
ELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdf
ELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdfELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdf
ELEMENTOS DE LA COMPRENSION ORAL-ESCUCHA ACTIVA.pdf
 
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLAFRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
 
PRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdf
PRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdfPRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdf
PRESENTO TRABAJO DE APLICACIONES EN INTERNET.pdf
 
CENTRO DE INTERES CIENCIAS NATURALES .pdf
CENTRO DE INTERES  CIENCIAS NATURALES .pdfCENTRO DE INTERES  CIENCIAS NATURALES .pdf
CENTRO DE INTERES CIENCIAS NATURALES .pdf
 
ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...
ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...
ALCANOS I Características de los alcanos · Son hidrocarburos saturados porque...
 
Maikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdfMaikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdf
 
PLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdf
PLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdfPLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdf
PLAN DE MONITOREO Y ACOMPAÑAMIENTO PEDAGÓGICO 2024.pdf
 

Tema 2 lomce

  • 1. TEMA 1 - 2ª Parte BLOQUE 2 LA ORGANIZACIÓN CÉLULAR
  • 2.
  • 3. ÁCIDOS NUCLÉICOS TIPOS • DNA (ácido desoxirribonucleico) – Azúcar: Desoxirribosa – Bases: • Citosina • Timina • Adenina • Guanina Doble cadena • RNA (ácido ribonucléico) – Azúcar: ribosa – Bases: • Citosina • Uracilo • Adenina • Guanina Cadena simple
  • 4. ÁCIDOS NUCLÉICOS ESTRUCTURA Y FUNCION DEL ADN La secuencia de los nucleótidos. Es la secuencia de nucleótidos de una cadena o hebra. La estructura del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica. Así, por ejemplo: 5‘- ACGTTTAACGACAAGGACAAGTATTAA - 3' Función: • Información codificada : 5‘- ACGTTTAACGACAAGGACAAGTATTAA - 3‘ • Capacidad de duplicarse • Sirve para elaborar las proteínas celulares.
  • 5. Replicación del ADN Proceso semiconservativo. Las dos hebras se separan y cada una sirve de molde para la síntesis de una nueva hebra. VIDEOVIDEO ADN POLIMERASA 3´ 3´
  • 6. SÍNTESIS DE PROTEINAS 2 Pasos: 1º Transcripción ADN  ARNm 2º Traducción ARNm  Proteinas . .
  • 7. Transcripción Síntesis de ARNm. ARN polimerasa coloca los nucleotidos. (recordad U en vez de T). VIDEOVIDEO
  • 8. TRADUCCIÓN Síntesis de una proteína en los ribosomas. Información de ARNm codificada en forma de tripletes (codones), cada tres bases determinan un aminoácido. Los aa son transportados por los ARNt Los ARNt tienen un anticodón complementario del codón del ARNm Los aa van uniendose por enlaces peptídicos  proteina animacion1 animacion 2
  • 11. ADN: 5– GGTACGTAGCTA –3 1º Hebra ADN complementaria 2º ARN m 3º Proteína ANIMACIÓN EJERCICIO
  • 12.
  • 13.
  • 14. Ejercicio 13 Lugol: color amarillento que en presencia de almidón pasa a violeta. Felhing: color azul pasa a rojo en presencia de azucar reductor  CARBONILO INTACTO PUEDE REACCIONAR. Monosacáridos y Disacáridos excepto Glucosa+Fructosa VIDEO Monosacárido Disacárido Glucosa+ glucosa Disacárido Glucosa+ fructosa 2 monosacáridos Glucosa y fructosa Polisacárido Monosacárido Disacárido Glucosa+ lactosa
  • 15. Gráfica actividad de una enzima a diferentes concentraciones de sustrato.
  • 16. 2 muestras de ácidos nucleicos y se observaron las siguientes proporciones de bases ADN ARN 28% 22% 22% 14% 35%
  • 17. 17
  • 18. TAMAÑO DE LAS CÉLULAS Biología y Geología 4º ESO: La célula 18 • Sólo son visibles al microscopio. • Se mide en micrometros (μm) o micra: milésima parte del milímetro.
  • 19. Biología y Geología 4º ESO: La célula 19
  • 20. TEORÍA CELULAR La teoría celular quiere decir: a)Todos los seres vivos están formados por células, aunque sólo sea por una. Para que un ser se considere que está vivo, debe de estar formado por células. En el caso de microorganismos, se trataría de una única célula, aún así capaz de realizar las tres funciones vitales. b)La célula es la unidad más pequeña y sencilla capaz de realizar las tres funiones vitales. c)Toda ceĺula procede, por división, de una célula anterior.
  • 21. TIPOS DE ORGANIZACIÓN CELULAR 21 • Hay dos tipos Eucarióticas y Procarióticas. • Procarióticas: – El material genético (ADN) está disperso por el citoplasma y no está rodeado por membrana que lo separe del citoplasma, no tienen núcleo. – Son más sencillas. – Carecen de orgánulos celulares membranosos. – En bacterias. • Eucarióticas: – El material genético esta en el interior del núcleo. – Son más complejas. – En el resto de seres vivos: protozoos, algas, hongos, animales y plantas.
  • 22. 22
  • 23. 2 GRANDES TIPOS DE ORGANIZACIÓN CELULAR. CÉLULAS PROCARIOTAS CÉLULAS EUCARIOTAS Menor tamaño (0,3-3 μm) Mayor tamaño (5-20 μm) Menor complejidad. Mayor complejidad. Material genético disperso por el citoplasma. Material genético encerrado en una estructura especializada (núcleo). No posee orgánulos. Posee orgánulos que realizan funciones específicas. Sólo las bacterias poseen células procariotas. Protistas, hongos, plantas y animales, sus células son eucariotas.
  • 24. CÉLULA EUCARIÓTICA MEMBRANA PLASMÁTICA CITOPLASMA NÚCLEO Citosol o Hialoplasma Orgánulos celulares • Membranosos: Aparato de Golgi.  Retículo Endoplasmático Liso y Rugoso Mitocondrias. Lisosomas.(sólo en cél animales) Cloroplastos (sólo en cél vegetales) Vacuolas. •No Membranosos: Ribosomas Cilios y Flagelos. Centriolos. (sólo en células animales) Citoesqueleto Rodea a toda la célula y es una fina capa que regula el intercambio de sustancias con el exterior. En células vegetales, está rodeada externamente por una pared celular que le dá consistencia y rigidez Sustancia gelatinosa donde se encuentran los orgánulos Red de filamentos protéicos responsable de la forma, organización interna y movimientos de la célula 24
  • 25. 25
  • 26. • MITOCONDRIAS: José Fernando Pastor Biología y Geología 4º ESO: La célula 26 – Forma diversa, en general cilíndricas, rodeadas por un doble membrana. La interna forma repliegues hacia el interior denominados crestas mitocondriales. El espacio interior se denomina matriz mitocondrial, que contiene diversas sustancias. – Función: proporciona energía a la célula mediante un proceso denominado respiración celular. – Se encuentran tanto en células animales como en vegetales.
  • 27. Orgánulos citoplásmicos • En el citoplasma tienen lugar la mayor parte de las reacciones metabólicas de la célula. El citosol es el medio acuoso del citoplasma que engloba numerosas estructuras especializadas llamadas organelos. Las mitocondrias • Llevan a cabo las reacciones químicas que liberan energía que se usa en las actividades celulares. • Las mitocondrias tienen una doble membrana. La externa no se pliega, mientras que la interna se pliega para formar proyecciones llamadas crestas. • En las crestas ocurren reacciones químicas que liberan energía de los alimentos.
  • 28. • A las mitocondrias se les llama “la central de energía” de las células. • Las células que trabajan continuamente como las del músculo cardíaco, poseen más mitocondrias. El retículo endoplasmático (RE) • Es un sistema de membranas que recorre el citoplasma. • Se extiende a través del citoplasma desde la membrana nuclear hasta la membrana celular. Las membranas del RE forman vías para el movimiento de materiales por la célula. • Algunas de las membranas del RE tienen aspecto rugoso debido a la presencia de ribosomas, RE rugoso. • El RE liso es el que no tiene ribosomas en su membranas. Algunos tipos de lípidos se forman en las membranas de este retículo endoplasmático. Los ribosomas • Son los organelos donde se producen las proteínas. • Las proteínas que se forman en el RE rugoso son transportadas a través de la
  • 29. • También existen ribosomas libres en el citoplasma. Las proteínas que se forman en estos ribosomas van directamente al citoplasma. El aparato de Golgi • Debe su nombre a Camillo Golgi Premio Nobel de Medicina en 1906. • Es un organelo que se encarga de la distribución y el envío de los productos químicos de la célula, prepara los materiales para que sean liberados por la célula hacia el espacio intercelular, mediante el proceso de secreción. • El aparato de Golgi tiene aspecto de una pila de sacos vacíos formado por membranas. • Modifica proteínas y lípidos que han sido formados en el retículo endoplasmático y los prepara para expulsarlos fuera de la célula. Las proteínas y lípidos que se sintetizan en el RE llegan al aparato de Golgi, el cual concentra las células de las proteínas o lípidos y elimina el agua. Este producto, se empaqueta dentro de una membrana derivada del aparato de Golgi y se mueve hacia la membrana celular donde se libera.
  • 30. Las vacuolas • Son estructuras llenas de fluido que contienen varias sustancias. • Generalmente, en las células animales, las vacuolas son pequeñas; las células vegetales es frecuente que presenten una única o unas pocas vacuolas de gran tamaño. • Las vacuolas sirven para almacenar sustancias durante algún tiempo. • En los organismos unicelulares las vacuolas tienen diversas funciones especializadas. Unas sirven para digerir alimentos y otras funcionan como bombas retirando el exceso de agua o materiales de desecho (vacuolas contráctiles). Los peroxisomas • Los peroxisomas son organelos citoplásmicos muy comunes en forma de vesículas que contienen enzimas que cumplen funciones de desintoxificación celular. • Inicialmente recibieron el nombre de microcuerpos y están presentes en todas las células eucarioticas. Los lisosomas • Los lisosomas son pequeñas vesículas formadas por el retículo endoplasmático rugoso que contienen enzimas digestivas. • Las enzimas digestivas facilitan el rompimiento de moléculas grandes como los almidones, lípidos y proteínas.
  • 31. • Los lisosomas tienen como función digerir las partículas extrañas que entran a la células como las bacterias. • Otra función de los lisosomas es destruir las partes gastadas de las células donde los productos de esa destrucción pueden volver a ser usados por la célula.
  • 32. Biología y Geología 4º ESO: 32 José Fernando ORGÁNULOS NO MEMBRANOSOS • RIBOSOMAS: – Pequeños orgánulos cuya función son la de fabricar las proteínas. Compuestos de ARN y proteínas. • CILIOS Y FLAGELOS: – Proyecciones hacia el exterior de la membrana, cuya estructura está mantenida por fibras protéicas del citoesqueleto. – Responsables del movimiento de las células. – Los cilios son más cortos y numerosos, mientras que los flagelos son generalmente únicos y muy largos. • CENTRIOLOS: – Son dos estructuras cilíndricas, dispuestas perpendicularmente. – Intervienen en el reparto de cromosomas durante la división celular. – Sólo se encuentran en células animales.
  • 33. Los microfilamentos • Son fibras muy finas formadas de proteínas. • Ubicadas dentro de la célula, con frecuencia debajo de la membrana. • Una de las funciones principales de los microfilamentos es producir el flujo citoplasmático permitiendo el movimietno da las sustancias dentro de la célula. • Este flujo permite a organismos unicelulares moverse de un lado a otro. Los microtúbulos • Son estructuras tubulares compuestas de proteínas. • Los microtúbulos están relacionados con la habilidad de la célula para moverse de un sitio a otro. • Muchos organismos unicelulares se mueven por medio de unas estructuras en forma de pelos llamadas cilios. • Otros organismos se mueven por unas estructuras en forma de cola llamadas flagelos. Cilios Flagelos • Los microtúbulos se extienden desde la célula hasta el interior de los cilios y flagelos. ESTRUCTURAS DE SOPORTE Y LOCOMOCIÓN
  • 34. La pared celular • Toda célula vegetal contiene una estructura fuera de la membrana celular llamada pared celular. • La pared celular es la que da forma y rigidez a la célula vegetal. • Se compone mayormente de celulosa, que es un carbohidrato complejo. • La pared celular puede contener pectina, que da fortaleza a la célula vegetal. • Permite el paso del aire, del agua y de materiales disueltos. • Las membranas celulares de células vecinas, pueden estar en contacto unas con otras a través de las aberturas en la pared celular. • Los hongos y los procariotas (bacterias) también tienen pared celular. • Las paredes de las células procarióticas son diferentes a las del resto de células.
  • 35. Orgánulos en células vegetales • Hay ciertos organelos que solo se encuentran en células vegetales o aparecen conspicuos. • En una célula vegetal, una vacuola puede ocupar casi todo el espacio y empujar el citoplasma hacia la membrana de la célula. • Estas vacuolas almacenan sustancias como azúcares, minerales y proteínas. Los plastidios • Son organelos de células vegetales. • Los plastidios pueden producir productos químicos o almacenar alimentos y pigmentos.  Cloroplastos  Es el plastidio más común de las plantas verdes.  Es donde ocurren los procesos de la elaboración de alimentos de las células vegetales.  Formados por estructuras parecidas a monedas delimitadas por una membrana llamadas tilacoides, las mismas que se organizan en apilamientos llamados granas y rodeadas por una sustancia gelatinosa llamada estroma.
  • 36.  La clorofila es el pigmento verde que está concentrado en las granas.  La clorofila atrapa la energía solar que la célula vegetal usa para elaborar su alimento.  Los leucoplastos  Son plastidios de almacenamiento.  Pueden contener proteínas, lípidos o almidónes.  Los cromoplastos  Son plastidios que contienen pigmentos rojos, amarillos o anaranjados.  Los cloroplastos y leucoplastos en ocasiones se transforman en cromoplastos.  Los cromoplastos son los responsables del color de las hojas durante el otoño.
  • 37. • CLOROPLASTOS: Biología y Geología: La célula 37 – Formados por una doble membrana. – Contiene una serie de discos apilados denominados tilacóides, en cuya membrana contiene la clorofila (de color verde). – Función: Realizan la fotosíntesis, esto es la fabricación de materia orgánica a partir de moléculas inorgánicas, utilizando la energía solar. – Sólo en células vegetales y algas. CO2 + H2O + Energía luminosa Materia orgánica(glucosa) + O2
  • 39. Membrana celular eucariota: funciones • Membrana citoplasmática – Es la interfase entre la célula y su medio ambiente. – Esta constituida por fosfolípidos, colesterol y proteínas – Mosaico - fluido – Posee funciones variadas • Transporte • Generar energía • Delimitar la forma de la célula • Comunicación celular
  • 40. CROMOSOMAS 40 • Son estructuras sólo visibles cuando la célula se divide. • Formados por el ADN del núcleo que se condensa al máximo. • Según el periodo de la división, los cromosomas pueden estar constituidos por un solo filamento de cromatina, denominado cromátida, o por dos filamentos, que son dos copias exactas la una de la otra, por lo que la información genética está duplicada y denominan cromátidas hermanas, unidad por un punto llamado centrómero.
  • 42. LOS CROMOSOMAS Un cromosoma está formado por: 1.dos CROMÁTIDAS unidas por un punto denominado CENTRÓMERO o CONSTRICCIÓN PRIMARIA. Cada cromática es identica a la otra (tienen el mismo ADN) por lo que se llaman cromátidas HERMANAS. 2.cada cromátida suele presentar 2 BRAZOS, de tamaño irregular. 3.el extremo final de cada cromátida se denomina TELÓMERO. 4.puede haber CONSTRICCIONES SECUNDARIAS que hagan aparecer fragmentos SATÉLITES. Los CROMOSOMAS son estructuras de forma filamentosa que aparecen durante la división celular. Reparten la información genética contenida en el ADN de la célula madre hacia las células hijasz Los cromosomas están formados por una larguísima cadena de ADN (lo que antes hemos llamado cromatina) muy enrollada, a la que se unen diferentes proteínas que mantienen su estructura.
  • 43. LOS CROMOSOMAS (2) NÚMERO DE CROMOSOMAS: Cada especie tiene un número de cromosomas característico. a)organismos HAPLOIDES: Poseen un solo juego de cromosomas en sus células. Se representan por la letra n, que indica que el número de tipos diferentes de cromosomas presentes en cada célula. Algunos organismos pasan por fases haploides en su ciclo vital, como los hongos, o pueden ser hapolides durante toda su vida, como las levaduras. b)organismos DIPLOIDES: Poseen un número par de cromosomas en sus células somáticas (no reproductoras). Estos cromosomas se denominan cromosomas homólogos y cada uno procede del gameto de un progenitor. Se representan por la letra 2n. La gran mayoría de organismos superiores (plantas y animales) son diploides. c)organismos POLIPLOIDES: Poseen un gran número de cromosomas homólogos en sus células . Se representan por la letra n precedida de un número que indica el número de copias (3n, 4n, 16n, etc). Muchas plantas y algunos insectos son poliploides.
  • 44. LOS CROMOSOMAS (3) TIPOS DE CROMOSOMAS: Dependiendo de la posición del centrómero podemos distinguir: a)Metacéntrico: el centrómero está en el centro y los brazos son iguales. b)Submetacéntrico: el centrómero está desplazado, los brazos son desiguales. a)Acrocéntricos: el centrómero se acerca mucho a los telómeros. a)Telocéntricos: el centrómero se localiza en el extremo del cromosoma y solo se puede observar un brazo.
  • 45. EL CARIOTIPOEl CARIOTIPO es el conjunto de los cromosomas de una especie. En el cariotipo se distinguen dos tipos de cromosomas: a) HETEROCROMOSOMAS o CROMOSMAS SEXUALES: Intervienen en la determinación del sexo. En la especie humana hay dos: X e Y. En las mujeres se encuentran dos copias del X. En los hombres hay una copia del X y otra del Y. AUTOSOMAS: Constituyen el resto de los cromosomas y son iguales en ambos sexos. Las células somáticas (no reproductoras) del ser humano poseen 46 cromosomas distribuidos en 23 parejas homólogas.
  • 46. EL CICLO CELULAR El ciclo celular en eucariotas se divide en las siguientes fases: a) INTERFASE (G): es la fase que ocupa el 95% del tiempo de vida de la célula, cuando no se está dividiendo. A su vez se divide en: 1)G1: es la fase en la que la célula recién formada crece de tamaño y desarrolla todos sus orgánulos. 2)S: en esta fase la célula sintetiza una copia de su ADN en previsión de una nueva división. 3)G2: en esta fase la célula se dispone a dividirse, por lo que tiene que duplicar todo su citoplasma. b) MITOSIS (M): es la fase en la que la célula se divide, dando lugar a dos células hijas, que retoman la fase G... El CICLO CELULAR es la secuencia de modificaciones que sufre una célula desde su formación hasta que se divide originando dos células hijas. La duración del ciclo celular depende del tipo de célula y puede variar de unas pocas horas a algunos días.
  • 47. LA DIVISIÓN CELULAR o MITOSIS En la fase de división o FASE M, a partir de una célula madre se originan dos células hijas con idéntico número de cromosomas que la progenitora. En las células eucariotas, esta división presenta dos fases: a)división del núcleo, denominada generalmente MITOSIS. b)división del resto de la célula, del citoplasma, denominada CITOCINESIS. La mitosis es un proceso contínuo, pero para poder estudiarlo mejor se ha dividido en 4 fases: PROFASE, METAFASE, ANAFASE y TELOFASE.
  • 48. En la profase: El ADN se condensa, se pueden ver claramente los cromosomas. El nucleolo desaparece. Aparecen unas fibras de proteínas entre los polos de la célula, llamadas huso acromático. En ambos extremos del huso están los centriolos, que controlan todo el proceso. La membrana nuclear desaparece y los cromosomas quedan libres en el citoplasma. MITOSIS (1): PROFASE
  • 49. MITOSIS (2): METAFASE En la metafase: Los cromosomas se unen por el centrómero al huso acromático. Esta unión se produce en el llamado PLANO ECUATORIAL de la célula. Esto es FUNDAMENTAL: si los cromosomas se unieran en otro punto de la célula el reparto de información genética entre las células hijas no seria equitativo. Las cromátidas hermanas de capa cromosoma están orientadas hacia los polos opuestos de la célula.
  • 50. MITOSIS (3): ANAFASE En la anafase: Los cromosomas se rompen por el centrómero. Las cromátidas se separan. Las fibras del uso acromático empiezan a acortarse, controladas por los centriolos. Las cromátidas hermanas se desplazan hacia cada uno de los polos de la célula. A partir de este momento se convierten en cromátidas independientes.
  • 51. En la telofase: Una vez terminada la migración de las cromátidas, desaparece el huso acromático. Se reconstruye una nueva membrana nuclear alrededor de cada grupo de cromátidas. Esto dará lugar a los núcleos de las células hijas. Las cromátidas se descondensan progresivamente, volviendo a convertirse en simple cromatina. Reaparece el nucleolo en cada nuevo núcleo. MITOSIS (4): TELOFASE
  • 52. CITOCINESISSi la mitosis ha transcurrido sin problemas, cada célula recibirá una copia del material genético de la célula madre. Por tanto, serán genéticamente idénticas. Pero, una vez concluida la división del núcleo, tiene que dividirse sel resto de la célula, el citoplasma, y hay que repartir los orgánulos entre ambas células hijas. Este proceso de CITOCINESIS es diferente si se trata de células vegetales o animales. En células ANIMALES se produce el reparto de los orgánulos y posteriormente la célula sufre una estrangulación a nivel del plano ecuatorial. En células VEGETALES se tiene que formar una pared celular nueva que separe a las nuevas células hijas. Esta pared celular se denomina fragmoplasto.
  • 53. MEIOSISLa MEIOSIS es un tipo de división reduccional, ya que a partir de una célula madre diploide (2n) se forman cuatro células hijas haploides (n), es decir, con la mitad del contenido de ADN que la célula progenitora. En todos los vertebrados, esta división reduccional tiene lugar en las gónadas, y las células que se forman son los gametos. ¿Qué ocurriría si los gametos se formaran por simple mitosis y tuvieran la misma información genética que el resto de las células?
  • 54. MEIOSIS (2) La meiosis a veces se compara con 2 mitosis consecutivas: una es reduccional (origina células con la mitad de cromosomas) y la otra es ecuacional (la célula se divide como una célula normal). Ambas divisiones también se dividen en profase, metafase, anafase y telofase. En la profase 1 aparecen los cromosomas, como el profase normal, pero se asocian en parejas de homólogos. Cuando están juntos, los cromosomas intercambian material genético. Este fenómeno natural se conoce como RECOMBINACIÓN.
  • 55. MEIOSIS (2) PROFASE 1 Se divide en varias fases: leptoteno, durante la cual los cromosomas individuales comienzan a condensar en filamentos largos dentro del núcleo Zigoteno Los cromosomas homólogos comienzan a acercarse hasta quedar recombinados en toda su longitud. Esto se conoce como sinapsis (unión) y el complejo resultante se conoce como bivalente o tétrada Paquiteno Una vez que los cromosomas homólogos están perfectamente apareados formando estructuras que se denominan bivalentes se produce el fenómeno de entrecruzamiento cromosómico (crossing-over) Diploteno Los cromosomas continúan condensándose hasta que se pueden comenzar a observar las dos cromátidas de cada cromosoma. Además en este momento se pueden observar los lugares del cromosoma donde se ha producido la recombinación. Estas estructuras en forma de X reciben el nombre quiasmas. Diacinesis Esta etapa apenas se distingue del diplonema. Podemos observar los cromosomas algo más condensados y los quiasmas. El final de la diacinesis y por tanto de la profase I meiótica viene marcado por la rotura de la envoltura nuclear.
  • 56. MEIOSIS (2) En las siguientes fases de la meiosis ocurre: ●En la metafase 1 las fibrillas del huso acromático unen parejas de cromosomas homólogos, aún unidos por la recombinación, no cromosomas individuales. ●En la anafase 1 a cada polo celular se dirige un cromosoma completo, no medio cromosoma. ●En la telofase 1 se forman dos células hijas haploides (n) con la mitad de cromosomas que la célula madre. ●Finalmente, tiene lugar una citocinesis. Después de completar la mitosis reduccional, las dos células hijas se preparan para entrar en la meitosis ecuacional, para obtener finalmente 4 células haploides.
  • 57. MEIOSIS (3) La mitosis ecuacional es muy parecida a una mitosis normal: ●En la profase 2, sin pasar por interfase, se vuelve a formar un huso acromático y a condensar los cromosomas, constituidos por dos cromátidas. ●En la metafase 2 los cromosomas se disponen en la placa ecuatorial de la célula. ●En la anafase 2 se separan las cromátidas hermanas y cada una se dirige a un extremo de la célula. ●En la telofase 2 y citocinesis se obtienen en total 4 células hijas haploides (n) distintas, cada una con la mitad de cromosomas que la célula madre
  • 58. MITOSIS vs. MEIOSIS MITOSIS Duplicación del ADN No se produce recombinació n MEIOSIS Duplicación del ADN Se produce recombinación de cromosomas homólogos Se separan cromosomas homólogos Se separan cromátidas hermanas Se obtienen 2 células hijas diploides iguales entre sí y a la célula Se separan cromátidas hermanas Se obtienen 4 células hijas haploides distintas entre sí y de la célula madre
  • 59. SIGNIFICADO BIOLÓGICO DE LA MITOSIS Y LA MEIOSISLa mitosis y la meiosis son dos mecanismos de división celular con un significado biológico diferente. En los organismos pluricelulares, la mitosis supone el crecimiento del individuo mediante sucesivas divisiones a partir de una única célula inicial, además de una forma de renovación de las células del cuerpo. En organismos unicelulares, la mitosis es la forma de reproducción asexual. Mediante la meiosis se originan gametos haploides, indispensables para asegurar un número constante de cromosomas en la especie. Además, la meiosis asegura la variabilidad genética gracias a la recombinación, que hace que cada gameto lleve información diferente.
  • 60. MITOSIS 60 • A partir de una célula se obtienen dos células genéticamente idénticas, con el mismo número de cromosomas. • Por este motivo en los organismos pluricelulares todas sus células son genéticamente idénticas, por tanto muy importante en el crecimiento del individuo y recambio celular. • Este proceso consta de varias etapas: Profase, Metafase, Anafase y Telofase. • Al final del proceso se reparte el citoplasma entre las células hijas, (Citocinesis).
  • 61. PROFASE Comienza a desaparecer el núcleo, los centríolos se duplican y se van a polos opuestos de la célula. La cromatina comienza a condensarse para formar los cromosomas. Cada cromosoma consta de dos cromátidas genéticamente idénticas (cromátidas hermanas) 61
  • 62. METAFASE 62 • Los cromosomas se condensan al máximo y se disponen en la zona ecuatorial.
  • 63. ANAFASE 63 • Las cromátidas hermanas (que son genéticamente idénticas) se separan y van a polos opuestos de la célula.
  • 64. TELOFASE 64 • Los cromosomas comienzan a descondensarse. • Comienza a formarse los núcleos de las dos células. • Al final los cromosomas se han descondensado del todo, formando la cromatina. • Al final la célula se divide en dos, repartiéndose el citoplasma (Citocinesis).
  • 65. 65
  • 66. MEIOSIS 66 • Proceso de división en el que a partir de una célula se obtienen cuatro con la mitad de cromosomas y que no son genéticamente idénticas. • Es necesario para la formación de gametos o células reproductoras, que tienen la mitad de cromosomas que el resto de células del organismo. • Cuando se produce la fecundación cada gameto aporta la mitad de cromosomas a la nueva célula (célula huevo o cigoto). • Consta de dos grandes etapas (Meoisis I y Meoisis II). Cada una de ellas divida en pequeñas etapas.
  • 67. MEIOSIS I 67 • Al final se obtienen dos células, genéticamente diferentes y se reduce el nº de cromosomas a la mitad. • Etapas: – Profase I.- Los cromosomas formados cada uno de ellos por dos cromátidas hermanas se asocian en parejas (de homólogos) y se producen intercambios de fragmentos entre los homólogos (Recombinación). – Metafase I.- Las parejas de homólogos se disponen en el ecuador. – Anafase I.- Separación (al azar) de cromosomas homólogos que van a polos opuestos. – Telofase I.- Se obtienen dos células, pero con la mitad de cromosomas que habían al principio.
  • 68. 68
  • 69. MEIOSIS II 69 • Ocurre lo mismo que en una mitosis. • A partir de cada célula obtenida en la meiosis I se obtienen dos. Por tanto al final del proceso obtenemos cuatro células. • No se reduce el nº de cromosomas. • Etapas: – Profase II.- condensación de los cromosomas. – Metafase II.- Los cromosomas se disponen en el ecuador de la célula. – Anafase II.- Separación (al azar) de cromátidas hermanas. – Telofase II.- Descondensación de los cromosomas.
  • 70.
  • 72. TRADUCCIÓN DE UNA CADENA DE mRNA
  • 73. Problema tipo de código genético
  • 74. ADN recombinante INICIO ESQUEMA RECURSOS INTERNET Características de la ingeniería genética SALIRANTERIOR Herramientas necesarias para la manipulación de genes • Vector de transferencia Plásmidos de Escherrichia coli • Enzimas de restricción • ADN ligasas Síntesis de ADN de forma artificial
  • 75. INICIO ESQUEMA RECURSOS INTERNET Etapas de un proyecto de ingeniería genética SALIRANTERIOR 1. Localización y aislamiento del gen que se desea transferir 2. Selección del vector 3. Unión del ADN elegido al ADN del vector. 4. Inserción del vector con el gen transferido en la célula hospedadora. 5. Multiplicación del organismo transgénico.
  • 76. Terapia génica INICIO ESQUEMA RECURSOS INTERNET Aplicaciones de la ingeniería genética SALIRANTERIOR Obtención de fármacos Mejora en la producción agrícola y animal. • Insulina • Proteínas de coagulación del suero sanguíneo. • Vacunas Carpas y salmones portadores del gen de la hormona del crecimiento Maíz resistente al frío Tratamiento de enfermedades humanas: • Diabetes • Hemofilia • Parkinson
  • 77. INICIO ESQUEMA RECURSOS INTERNET Los alimentos transgénicos SALIRANTERIOR Transgen Organismo transgénico APLICACIONES DE LA INGENIERÍA GENÉTICA EN LA AGRICULTURA
  • 79.
  • 80. ESTRUCTURA DEL tRNA Posee una secuencia de tres bases llamado anticodón complementario a un o varios codones El aminoácido se unirá al tRNA que tenga el anticodón correspondiente
  • 81. INICIO ESQUEMA RECURSOS INTERNET La clonación SALIRANTERIOR Clonación reproductiva Tiene como objetivo conseguir individuos nuevos idénticos entre sí y al original. transferencia nuclear Clonación terapeútica Tiene como objetivo tratar enfermedades y regenerar tejidos.
  • 82. INICIO ESQUEMA RECURSOS INTERNET Implicaciones de los avances en biotecnología SALIRANTERIOR Implicaciones ecológicas Implicaciones sanitarias Implicaciones sociales Implicaciones éticas Implicaciones legales Extinción de especies naturales Aparición de nuevos virus o bacterias que provoquen enfermedades desconocidas Vulneración del derecho a la intimidad La manipulación de material genético de nuestra especie La posibilidad de patentar plantas y animales transgénicos, así como secuencias del genoma humano