SlideShare una empresa de Scribd logo

Secuenciación de ADN

Métodos de secuenciación del DNA por generaciones

1 de 33
Descargar para leer sin conexión
1
UNIVERSIDAD AUTÓNOMA DE YUCATÁN
Campus Ciencias de la Salud
Facultad de Química
Lic. En Químico Farmacéutico Biólogo
FARMACOGENÉTICA Y FARMACOGENÓMICA
ADA3: Secuenciación masiva
Equipo: 4
Alumnos
Br. Cool Méndez Carlos Alberto
Br. Encalada Salazar Rai
Br. Jiménez Becerra Daniel Eduardo
Mérida, Yucatán 23 de Junio 2017
2
La secuenciación del ADN consiste en determinar el orden de las
bases A, C, G y T en un fragmento de ADN.
ATCGATCGATCGATCAGCTACGATCG
ATCGATCGATCGATCGATCAGCATCG
ATCGATCGATCGATCGATCGATCGAT
CGATCGATCGATCGATCGATCGATCG
ATCGATCGATCATTTATATTCTGCCGT
ACGACCTGACTGATCTGATCGAGTCG
ATCGACTACATATCGATCGATCGACG
ATCGTACGTATGCATGCGATCGTATCG
AGTCGTACTACGAGTCGACTGATCGT
AGTATATATGCAGCGATCGATGATCG
AGTCGATGTATTCTGACGCGATCTGA
GTCTGATGCCGTAGCAACGCTATGCT
ACTAGCTGACGTCATGCGTACGTAGT
CGTAGTACGTATCGATGCTGATGCAC
3
Las bases de la
secuenciación de ADN
Principales tecnologías
de Secuenciación
Aplicaciones de la
secuenciación de ADN
4
El impacto de las tecnologías de secuenciación masiva
5
Allan M. Maxam y Walter Gilbert establecieron el proceso de
digestión química del DNA para determinar la secuencia de
nucleótidos del ADN.
3´
3´
5´
5´
3´5´
5´3´
Isótopo radioactivo (32P)
A y G Dimetil sulfato (DMS)
C y T Hidracina y Piperidina
Metilan
Trata
6
Lectura de unas 100
bases de secuencias
Técnica de baja
resolución y en desuso

Recomendados

Más contenido relacionado

La actualidad más candente (20)

Tecnicas de Bandeo Cromosomico
Tecnicas de Bandeo CromosomicoTecnicas de Bandeo Cromosomico
Tecnicas de Bandeo Cromosomico
 
secuenciación por el medoto de sanger
secuenciación por el medoto de sangersecuenciación por el medoto de sanger
secuenciación por el medoto de sanger
 
SECUENCIACIÓN DEL ADN
SECUENCIACIÓN DEL ADNSECUENCIACIÓN DEL ADN
SECUENCIACIÓN DEL ADN
 
PCR
PCRPCR
PCR
 
cuantificacion de DNA
cuantificacion de DNAcuantificacion de DNA
cuantificacion de DNA
 
Prueba PCR (Reacción en cadena de la polimerasa)
Prueba PCR (Reacción en cadena de la polimerasa) Prueba PCR (Reacción en cadena de la polimerasa)
Prueba PCR (Reacción en cadena de la polimerasa)
 
Electroforesis de ADN
Electroforesis de ADN Electroforesis de ADN
Electroforesis de ADN
 
Marcadores moleculares
Marcadores molecularesMarcadores moleculares
Marcadores moleculares
 
Secuenciacion
SecuenciacionSecuenciacion
Secuenciacion
 
Clase de ADN A, B, Z y H
Clase de ADN A, B, Z y HClase de ADN A, B, Z y H
Clase de ADN A, B, Z y H
 
Reacción en cadena de la polimerasa
Reacción en cadena de la polimerasaReacción en cadena de la polimerasa
Reacción en cadena de la polimerasa
 
Metodos de secuenciacion
Metodos de secuenciacionMetodos de secuenciacion
Metodos de secuenciacion
 
PCR
PCRPCR
PCR
 
Clase 3
Clase 3Clase 3
Clase 3
 
3 alelos letales
3 alelos letales3 alelos letales
3 alelos letales
 
Lab enzimas restriccion y clonacion
Lab enzimas restriccion y clonacionLab enzimas restriccion y clonacion
Lab enzimas restriccion y clonacion
 
Reacción en cadena de la polimerasa
Reacción en cadena de la polimerasaReacción en cadena de la polimerasa
Reacción en cadena de la polimerasa
 
Gen, Genoma, Transcriptoma, Proteoma
Gen, Genoma, Transcriptoma, ProteomaGen, Genoma, Transcriptoma, Proteoma
Gen, Genoma, Transcriptoma, Proteoma
 
Regulación Postranscripcional y traduccional.
Regulación Postranscripcional y traduccional.Regulación Postranscripcional y traduccional.
Regulación Postranscripcional y traduccional.
 
Electroforesis
ElectroforesisElectroforesis
Electroforesis
 

Similar a Secuenciación de ADN

D912f51131ed787b91.en.es
D912f51131ed787b91.en.esD912f51131ed787b91.en.es
D912f51131ed787b91.en.esJaime Paredes
 
Leticia ines morales quispe
Leticia ines morales quispeLeticia ines morales quispe
Leticia ines morales quispeleticiamorales38
 
4.9 Técnicas de Biología Molecular.pptx
4.9 Técnicas de Biología Molecular.pptx4.9 Técnicas de Biología Molecular.pptx
4.9 Técnicas de Biología Molecular.pptxjans velarde
 
PRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsx
PRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsxPRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsx
PRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsxssuser40d9a5
 
TIB-SecuenciacionEnsamblado-2015-2016.pdf
TIB-SecuenciacionEnsamblado-2015-2016.pdfTIB-SecuenciacionEnsamblado-2015-2016.pdf
TIB-SecuenciacionEnsamblado-2015-2016.pdfCristVillar
 
Ingeniería genética
Ingeniería genéticaIngeniería genética
Ingeniería genéticamerchealari
 
Curso gen..[1]
Curso gen..[1]Curso gen..[1]
Curso gen..[1]braguetin
 
Reac. polimerasa 4 b_ yaricahua maria f
Reac. polimerasa  4 b_ yaricahua maria fReac. polimerasa  4 b_ yaricahua maria f
Reac. polimerasa 4 b_ yaricahua maria fMariafeET
 
molecular diapositiva 1-30.pptx
molecular diapositiva 1-30.pptxmolecular diapositiva 1-30.pptx
molecular diapositiva 1-30.pptxTristanRodriguez16
 
8C153328-9163-4010-BD9F-F719C94C2555.pdf
8C153328-9163-4010-BD9F-F719C94C2555.pdf8C153328-9163-4010-BD9F-F719C94C2555.pdf
8C153328-9163-4010-BD9F-F719C94C2555.pdfMaraFernandaLinceCru
 
Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1RuthApaza8
 
Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1RosalindaApazaapaza
 

Similar a Secuenciación de ADN (20)

SECUENCIAS MASIVAS.pptx
SECUENCIAS MASIVAS.pptxSECUENCIAS MASIVAS.pptx
SECUENCIAS MASIVAS.pptx
 
D912f51131ed787b91.en.es
D912f51131ed787b91.en.esD912f51131ed787b91.en.es
D912f51131ed787b91.en.es
 
Secuenciamiento.pptx
Secuenciamiento.pptxSecuenciamiento.pptx
Secuenciamiento.pptx
 
Snapgene informe
Snapgene informeSnapgene informe
Snapgene informe
 
Leticia ines morales quispe
Leticia ines morales quispeLeticia ines morales quispe
Leticia ines morales quispe
 
4.9 Técnicas de Biología Molecular.pptx
4.9 Técnicas de Biología Molecular.pptx4.9 Técnicas de Biología Molecular.pptx
4.9 Técnicas de Biología Molecular.pptx
 
PRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsx
PRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsxPRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsx
PRESENTACIÓN PCR IRENE FERNANDEZ. biotecnología.ppsx
 
PCR Cuantitativa
PCR CuantitativaPCR Cuantitativa
PCR Cuantitativa
 
tecnicas de biologi molecualr
tecnicas de biologi molecualrtecnicas de biologi molecualr
tecnicas de biologi molecualr
 
TIB-SecuenciacionEnsamblado-2015-2016.pdf
TIB-SecuenciacionEnsamblado-2015-2016.pdfTIB-SecuenciacionEnsamblado-2015-2016.pdf
TIB-SecuenciacionEnsamblado-2015-2016.pdf
 
Ingeniería genética
Ingeniería genéticaIngeniería genética
Ingeniería genética
 
Pcr
PcrPcr
Pcr
 
Curso gen..[1]
Curso gen..[1]Curso gen..[1]
Curso gen..[1]
 
Compendio Biología Molecular Parte 2
Compendio Biología Molecular Parte 2Compendio Biología Molecular Parte 2
Compendio Biología Molecular Parte 2
 
03-1-MarcaDirect
03-1-MarcaDirect03-1-MarcaDirect
03-1-MarcaDirect
 
Reac. polimerasa 4 b_ yaricahua maria f
Reac. polimerasa  4 b_ yaricahua maria fReac. polimerasa  4 b_ yaricahua maria f
Reac. polimerasa 4 b_ yaricahua maria f
 
molecular diapositiva 1-30.pptx
molecular diapositiva 1-30.pptxmolecular diapositiva 1-30.pptx
molecular diapositiva 1-30.pptx
 
8C153328-9163-4010-BD9F-F719C94C2555.pdf
8C153328-9163-4010-BD9F-F719C94C2555.pdf8C153328-9163-4010-BD9F-F719C94C2555.pdf
8C153328-9163-4010-BD9F-F719C94C2555.pdf
 
Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1
 
Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1Maqueta pcr biotecnologia informe-grupo n°1
Maqueta pcr biotecnologia informe-grupo n°1
 

Más de Rai Encalada

Reacciones de hipersensibilidad
Reacciones de hipersensibilidadReacciones de hipersensibilidad
Reacciones de hipersensibilidadRai Encalada
 
Algoritmo para la identificación de cocos gramspositivos
Algoritmo para la identificación de cocos gramspositivosAlgoritmo para la identificación de cocos gramspositivos
Algoritmo para la identificación de cocos gramspositivosRai Encalada
 
Interacciones Farmacológicas
Interacciones FarmacológicasInteracciones Farmacológicas
Interacciones FarmacológicasRai Encalada
 
Farmacología del Sistema Nervioso Central
Farmacología del Sistema Nervioso CentralFarmacología del Sistema Nervioso Central
Farmacología del Sistema Nervioso CentralRai Encalada
 
Urocultivo y antibiograma
Urocultivo y antibiogramaUrocultivo y antibiograma
Urocultivo y antibiogramaRai Encalada
 
Infecciones del tracto respiratorio inferior
Infecciones del tracto respiratorio inferior Infecciones del tracto respiratorio inferior
Infecciones del tracto respiratorio inferior Rai Encalada
 
Cultivo de secreciones de heridas y oftálmicos
Cultivo de secreciones de heridas y oftálmicosCultivo de secreciones de heridas y oftálmicos
Cultivo de secreciones de heridas y oftálmicosRai Encalada
 

Más de Rai Encalada (10)

Reacciones de hipersensibilidad
Reacciones de hipersensibilidadReacciones de hipersensibilidad
Reacciones de hipersensibilidad
 
Hemofilias
HemofiliasHemofilias
Hemofilias
 
Algoritmo para la identificación de cocos gramspositivos
Algoritmo para la identificación de cocos gramspositivosAlgoritmo para la identificación de cocos gramspositivos
Algoritmo para la identificación de cocos gramspositivos
 
Interacciones Farmacológicas
Interacciones FarmacológicasInteracciones Farmacológicas
Interacciones Farmacológicas
 
Farmacología del Sistema Nervioso Central
Farmacología del Sistema Nervioso CentralFarmacología del Sistema Nervioso Central
Farmacología del Sistema Nervioso Central
 
VIH/SIDA
VIH/SIDAVIH/SIDA
VIH/SIDA
 
Urocultivo y antibiograma
Urocultivo y antibiogramaUrocultivo y antibiograma
Urocultivo y antibiograma
 
Infecciones del tracto respiratorio inferior
Infecciones del tracto respiratorio inferior Infecciones del tracto respiratorio inferior
Infecciones del tracto respiratorio inferior
 
Hemocultivo
HemocultivoHemocultivo
Hemocultivo
 
Cultivo de secreciones de heridas y oftálmicos
Cultivo de secreciones de heridas y oftálmicosCultivo de secreciones de heridas y oftálmicos
Cultivo de secreciones de heridas y oftálmicos
 

Último

ERA CENOZOICA (1).pdf por estudiantes...
ERA CENOZOICA (1).pdf por estudiantes...ERA CENOZOICA (1).pdf por estudiantes...
ERA CENOZOICA (1).pdf por estudiantes...jifarapardes
 
MEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdf
MEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdfMEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdf
MEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdfJherikmatteoChamorro
 
DIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptxDIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptxmilenamoyaniacato25
 
precambrico (1) elaborado por estudiantes
precambrico (1) elaborado por estudiantesprecambrico (1) elaborado por estudiantes
precambrico (1) elaborado por estudiantesMelanieCasa
 
JUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBRERO
JUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBREROJUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBRERO
JUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBREROtorresdamaris71
 
PARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB .pdf
PARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB  .pdfPARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB  .pdf
PARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB .pdfJherikmatteoChamorro
 
Presentación: El origen y estructura del átomo
Presentación: El origen y estructura del átomoPresentación: El origen y estructura del átomo
Presentación: El origen y estructura del átomoDavid Rolando Velarde Grefa
 
DIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptx
DIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptxDIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptx
DIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptxmilenamoyaniacato25
 
manejo de la Hiperbilirrubinemia (1).pptx
manejo de la Hiperbilirrubinemia (1).pptxmanejo de la Hiperbilirrubinemia (1).pptx
manejo de la Hiperbilirrubinemia (1).pptxHENRYDARINELROJASLOP
 
GEOLOGIA.Tema 10 Recursos minerales.pptx
GEOLOGIA.Tema 10 Recursos minerales.pptxGEOLOGIA.Tema 10 Recursos minerales.pptx
GEOLOGIA.Tema 10 Recursos minerales.pptxBertaAriasLpez1
 
DETERMINACION DEL DBO5 DEL RIO TITIRE.pdf
DETERMINACION DEL DBO5 DEL RIO TITIRE.pdfDETERMINACION DEL DBO5 DEL RIO TITIRE.pdf
DETERMINACION DEL DBO5 DEL RIO TITIRE.pdfMaribelMamaniGoya
 
Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024
Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024
Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024SOCIEDAD JULIO GARAVITO
 
ÓXIDOS SALINOS explicación..pptx[1].pptx
ÓXIDOS SALINOS explicación..pptx[1].pptxÓXIDOS SALINOS explicación..pptx[1].pptx
ÓXIDOS SALINOS explicación..pptx[1].pptxAnderson Jumbo Tigse
 
ÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptx
ÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptxÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptx
ÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptxAnderson Jumbo Tigse
 
Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024
Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024
Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024SOCIEDAD JULIO GARAVITO
 
CV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades Laborales
CV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades LaboralesCV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades Laborales
CV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades LaboralesBaker Publishing Company
 
ERA MEZOSOICA elaborado por estudiantes.
ERA MEZOSOICA elaborado por estudiantes.ERA MEZOSOICA elaborado por estudiantes.
ERA MEZOSOICA elaborado por estudiantes.jifarapardes
 
DIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptxDIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptxmilenamoyaniacato25
 
La manera en la que la Tabla periodica esta dividida
La manera en la que la Tabla periodica esta divididaLa manera en la que la Tabla periodica esta dividida
La manera en la que la Tabla periodica esta divididasoldadouc12
 
sistema solar-CIENCIAS DE LA TIERRA DB1.pptx
sistema solar-CIENCIAS DE LA TIERRA DB1.pptxsistema solar-CIENCIAS DE LA TIERRA DB1.pptx
sistema solar-CIENCIAS DE LA TIERRA DB1.pptxEstebanJosue2
 

Último (20)

ERA CENOZOICA (1).pdf por estudiantes...
ERA CENOZOICA (1).pdf por estudiantes...ERA CENOZOICA (1).pdf por estudiantes...
ERA CENOZOICA (1).pdf por estudiantes...
 
MEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdf
MEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdfMEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdf
MEIOSIS UCE FACULTAD DE FILOSOFÍA PCEQB .pdf
 
DIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptxDIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_2_MILENA_MOYA.pptx
 
precambrico (1) elaborado por estudiantes
precambrico (1) elaborado por estudiantesprecambrico (1) elaborado por estudiantes
precambrico (1) elaborado por estudiantes
 
JUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBRERO
JUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBREROJUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBRERO
JUICIO JUAN ORLANDO HERNÁNDEZ ALVARADO 20 DE FEBRERO
 
PARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB .pdf
PARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB  .pdfPARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB  .pdf
PARED CELULAR FACULTAD DE FILOSOFÍA UCE PCEQB .pdf
 
Presentación: El origen y estructura del átomo
Presentación: El origen y estructura del átomoPresentación: El origen y estructura del átomo
Presentación: El origen y estructura del átomo
 
DIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptx
DIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptxDIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptx
DIVISION_CELULAR_REPRODUCCIÓN_3_MILENA_MOYA.pptx
 
manejo de la Hiperbilirrubinemia (1).pptx
manejo de la Hiperbilirrubinemia (1).pptxmanejo de la Hiperbilirrubinemia (1).pptx
manejo de la Hiperbilirrubinemia (1).pptx
 
GEOLOGIA.Tema 10 Recursos minerales.pptx
GEOLOGIA.Tema 10 Recursos minerales.pptxGEOLOGIA.Tema 10 Recursos minerales.pptx
GEOLOGIA.Tema 10 Recursos minerales.pptx
 
DETERMINACION DEL DBO5 DEL RIO TITIRE.pdf
DETERMINACION DEL DBO5 DEL RIO TITIRE.pdfDETERMINACION DEL DBO5 DEL RIO TITIRE.pdf
DETERMINACION DEL DBO5 DEL RIO TITIRE.pdf
 
Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024
Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024
Mujeres en astronomía_Luz Angela Cubides_17 de Febrero_ 2024
 
ÓXIDOS SALINOS explicación..pptx[1].pptx
ÓXIDOS SALINOS explicación..pptx[1].pptxÓXIDOS SALINOS explicación..pptx[1].pptx
ÓXIDOS SALINOS explicación..pptx[1].pptx
 
ÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptx
ÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptxÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptx
ÓXIDOS NEUTROS EXPLICACION Y EJEMPLOS .pptx[1].pptx
 
Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024
Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024
Citación Asamblea Estatutaria - Invita Junta Directiva de SJG 2024
 
CV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades Laborales
CV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades LaboralesCV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades Laborales
CV Leslie Olivares: Me Encuentro en Búsqueda de Nuevas Oportunidades Laborales
 
ERA MEZOSOICA elaborado por estudiantes.
ERA MEZOSOICA elaborado por estudiantes.ERA MEZOSOICA elaborado por estudiantes.
ERA MEZOSOICA elaborado por estudiantes.
 
DIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptxDIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptx
DIVISIÓN_CELULAR_REPRODUCCION_1_MILENA_MOYA.pptx
 
La manera en la que la Tabla periodica esta dividida
La manera en la que la Tabla periodica esta divididaLa manera en la que la Tabla periodica esta dividida
La manera en la que la Tabla periodica esta dividida
 
sistema solar-CIENCIAS DE LA TIERRA DB1.pptx
sistema solar-CIENCIAS DE LA TIERRA DB1.pptxsistema solar-CIENCIAS DE LA TIERRA DB1.pptx
sistema solar-CIENCIAS DE LA TIERRA DB1.pptx
 

Secuenciación de ADN

  • 1. 1 UNIVERSIDAD AUTÓNOMA DE YUCATÁN Campus Ciencias de la Salud Facultad de Química Lic. En Químico Farmacéutico Biólogo FARMACOGENÉTICA Y FARMACOGENÓMICA ADA3: Secuenciación masiva Equipo: 4 Alumnos Br. Cool Méndez Carlos Alberto Br. Encalada Salazar Rai Br. Jiménez Becerra Daniel Eduardo Mérida, Yucatán 23 de Junio 2017
  • 2. 2 La secuenciación del ADN consiste en determinar el orden de las bases A, C, G y T en un fragmento de ADN. ATCGATCGATCGATCAGCTACGATCG ATCGATCGATCGATCGATCAGCATCG ATCGATCGATCGATCGATCGATCGAT CGATCGATCGATCGATCGATCGATCG ATCGATCGATCATTTATATTCTGCCGT ACGACCTGACTGATCTGATCGAGTCG ATCGACTACATATCGATCGATCGACG ATCGTACGTATGCATGCGATCGTATCG AGTCGTACTACGAGTCGACTGATCGT AGTATATATGCAGCGATCGATGATCG AGTCGATGTATTCTGACGCGATCTGA GTCTGATGCCGTAGCAACGCTATGCT ACTAGCTGACGTCATGCGTACGTAGT CGTAGTACGTATCGATGCTGATGCAC
  • 3. 3 Las bases de la secuenciación de ADN Principales tecnologías de Secuenciación Aplicaciones de la secuenciación de ADN
  • 4. 4 El impacto de las tecnologías de secuenciación masiva
  • 5. 5 Allan M. Maxam y Walter Gilbert establecieron el proceso de digestión química del DNA para determinar la secuencia de nucleótidos del ADN. 3´ 3´ 5´ 5´ 3´5´ 5´3´ Isótopo radioactivo (32P) A y G Dimetil sulfato (DMS) C y T Hidracina y Piperidina Metilan Trata
  • 6. 6 Lectura de unas 100 bases de secuencias Técnica de baja resolución y en desuso
  • 7. 7 Método de terminación de cadena o método Sanger (Frederick Sanger) Se basa en hacer cuatro reacciones diferentes de síntesis de ADN utilizando la función propia de la ADN polimerasa y utilizando un didesoxinucleótido (ddNTP) ddNTP no tiene un grupo hidroxilo en el 3´ Un dNTP marcado con 32P
  • 8. 8 Lectura de unas 300-500 nucleótidos Una técnica mucho más eficiente en tiempo, ejecución y sensibilidad de los resultados que la de digestión enzimática
  • 10. Conformado por equipos que emplean distintos métodos para la secuenciación con un esquema de trabajo similar. Tienen en común en que los amplicones de PCR derivados de cualquier molécula de biblioteca única terminan agrupados espacialmente, ya sea en una única ubicación en un sustrato plano o en la superficie de perlas de escala micrométrica. Ventajas Desventajas Construcción de librería y amplificación in vitro sin el empleo de microorganismos. Longitudes de lectura más cortas que en la secuenciación convencional. La secuenciación basada en matriz tiene un grado mucho más alto de paralelismo en la lectura que la secuenciación convencional. Precisión en bruto diez veces menor al convencional. La inmovilización en una superficie permite manipular enzimáticamente con un único volumen de reactivo (Uso de pL o fL).
  • 11. 11 Muestra ADN, ARN Librería Fragmentación Ligación adaptadores Librería Muestra Single o paired-end Secuenciación Equipo Illumina, Roche… Reads NGS crudos Formato fastQ o CS-FastQ Informe experimento Pasan/Fallan Tasas error Alineamiento BWA, BFAST, Bowtie… Secuencia de referencia Informe alineamiento Reads y bases alineados Fichero BAM Unir, ordenar y marcar reads duplicados Informe duplicados Tasas duplicados y únicos Indexación fichero BAM Reads alineados, no alineados y duplicados
  • 12. 12 fichero BAM Indexado y con duplicados marcados Alineados Distancia/orientación correctas Aberrantes Distancia/orientación inesperadas No alineados No alineados a la secuencia referencia SNPs y pequeñas indels Cambios de número de copia Detección de VE/indels grandes Variantes estructurales Nuevas inserciones Identificación
  • 13. 13 Preparación del template Secuenciación e imágenes Terminación reversible cíclica (CRT) Adición de un solo nucléotido (SNA) o pirosecuenciación Secuenciación por ligación (SBL) ADN polimerasa ADN polimerasa ADN ligasa Template amplificados clonalmente • Emulsión PCR • Amplificación en fase sólida (PCR Puente) Templates de una sola molécula • Primer inmovilizado • Template inmovilizado
  • 15. 15 Preparación de la muestra Extracción del ADN Purificación del ADN Fragmentación del ADN La fragmentación se lleva a cabo mediante el proceso de tagmentación: 1. Combinación del transposoma con adaptador parcial y el ADN. 2. Fragmentación y adición del adaptador parcial por el transposoma. 3. PCR de ciclo limitado para añadir cebadores e indexes.
  • 16. 16 Generación de clusters: Amplificación en fase sólida Unión covalente de cebadores directo e inversos en el soporte Se colocan los templates que contienen la región desconocida y adaptadores Formación de la cadena complementaria Desnaturalización con formamida de la doble cadena Amplificación del ADN con PCR puente con ayuda de cebadores inmóviles Desnaturalización con formamida de la doble cadena Formación de clusters de cadena sencilla con extremos libres Densidad de amplificación dependiente de la densidad de cebadores
  • 17. 17 Secuenciación: Terminación reversible cíclica 2. Adición de los 4 nucléotidos con marcadores fluorescentes de diferente color. 4. Lavado y obtención de imagen de colores según el nucleótido ensamblado 3. Incorporación de nucleótidos por la polimerasa. 5. Eliminación del marcador fluorescente de los nucleótidos incorporados (regenera 3’-OH) con TCEP* 6. Lavado y adición de los 4 nucleótidos modificados 7. Continuación en Paso 3 1. Hibridación de cebador a secuencia universal del tamplate *TCEP: tris (2-carboxietil) fosfina (agente reductor)
  • 19. 19 Tratamiento de datos Alineamiento o ensamblado Análisis de los resultados De novo Resecuenciación
  • 20. Características Costo por Megabase: 2 dólares Costo de equipo: 430,000 – 540,000 dólares Longitud de lectura: 36 – 100 pb Tiempo de corrida: 4 – 9 días Tasa de error: 1 – 1.5% hasta <0.1%
  • 21. Ventajas • Plataforma más empleada actualmente • Requiere de poca muestra (aprox. 1 ng) • Bajo costo de secuenciación • Numerosas aplicaciones • Pocos requisitos de infraestructura Desventajas • Lento • Multiplexación (combinación de señales) • Capacidad de muestras • Equipo costoso • Laborioso • Personal capacitado • Mutaciones durante la amplificación • Reducida eficiencia en la secuenciación dirigida a regiones de interés • Longitudes de lectura limitadas por factores que causan la desintegración de señal y el desfasado
  • 22. 22
  • 23. 23
  • 24. 24
  • 25. 25
  • 26. 26
  • 27. 27
  • 28. • La detección por citometría de secuenciación de ADN rápida basada en la detección de moléculas simples: se basa en la detección de los fotones emitidos por moléculas simples en un flujo laminar a su paso a través de un haz concentrado de rayos laser. El espectro de emisión de los cuatro marcadores fluorescentes, permite identificar a las cuatro bases. • Lectura directa de secuencia de bases en la cadena de ADN mediante microscopios de túnel de barrido. • Análisis de la secuencia de ADN mediante espectrometría de masas. • La secuenciación por hibridación sobre paneles de oligonucleótidos de secuencia conocida
  • 29. Secuenciación de moléculas de ADN individuales nucleótido a nucleótido (Tecnología en desarrollo)
  • 30. • El primer secuenciador de tercera generación lo vende Helicos BioSciences • Permite generar de forma fiable fragmentos de entre 25 y 45 bases. • Dada la pequeñez de las lecturas generadas, esta tecnología está recomendada para la resecuenciación de genomas y no para la secuenciación de novo. 30
  • 31. Equipo Compañía Método de secuenciación DNA molde Longitud lecturas (pb) Tiemp o carrera Nt/carrera (Gb) Helicos tSMS Helicos BioSciences Polimerasa Molécula única 25-45 192 37 Pacific Bioscien ces Pacific Biosciences Polimerasa Molécula única 1000 NA NA ZX Genetics ZX Genetics Microscopia electrónica Molécula única NA NA NA
  • 32. 32 Mide el efecto a nivel iónico y eléctrico del paso de una hebra de ADN a través de un nanoporo Oxford Nanopore´s MinION Ventajas • Secuenciación individualizada • Secuenciación de forma directa • Lectura ultralarga (lectura de la longitud total) • Económico • Rápido Desventajas • Requiere gran cantidad de ADN • Necesita secuenciar muchas moléculas únicas para un consenso aceptable
  • 33. 33 • Rodríguez, J. Secuenciación de genomas. Arbor. 2004, 698, 287-289. • Maxam, A.; Gilbert, A. A new method for sequencing DNA. PNAS, 1977, 74, 2, 560- 564. • Rodríguez, B.; Armengol, L. Tecnologías de secuenciación de nueva generación en diagnóstico genético pre- y postnatal. Diagn. Prenat. 2012, 23, 2, 56 – 66. • Shendure, J.; Ji, Hanlee. Next-generation DNA sequencing. Nature biotechnology. 2008, 26, 10, 1135 – 1145. • Metzker, M. Sequencing technologies – the next generation. Nature Reviews. 2010, 11, 31 – 46. • Technical Support Note: Sequencing. Illumina. https://support.illumina.com/content/dam/illumina- support/documents/documentation/chemistry_documentation/samplepreps_nexter a/nextera-xt/nextera-xt-troubleshooting-guide.pdf (consultado junio 2017). • Applied Biological Materials. https://www.abmgood.com (consultado junio 2017). • Genética Médica Blog. http://revistageneticamedica.com/blog/secuenciacion- tercera-generacion/ (consultado junio 2017). • Romero, C. Genética Humana, 1 ed.; Bilvao: España, 1995; 47-49. • Bautista, R. Las tres generaciones de la secuenciación. Universidad de Málaga. 2010, 3, 128